ID: 1168241382

View in Genome Browser
Species Human (GRCh38)
Location 19:55090849-55090871
Sequence GACACGCACGGCCCCCCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 63}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168241373_1168241382 8 Left 1168241373 19:55090818-55090840 CCCACCCAAGTGGCCCAGTGGTT 0: 1
1: 0
2: 2
3: 15
4: 105
Right 1168241382 19:55090849-55090871 GACACGCACGGCCCCCCAGCAGG 0: 1
1: 0
2: 0
3: 10
4: 63
1168241369_1168241382 16 Left 1168241369 19:55090810-55090832 CCCCGGCACCCACCCAAGTGGCC 0: 1
1: 0
2: 1
3: 32
4: 329
Right 1168241382 19:55090849-55090871 GACACGCACGGCCCCCCAGCAGG 0: 1
1: 0
2: 0
3: 10
4: 63
1168241379_1168241382 -5 Left 1168241379 19:55090831-55090853 CCCAGTGGTTTGGTCATGGACAC 0: 1
1: 0
2: 0
3: 8
4: 90
Right 1168241382 19:55090849-55090871 GACACGCACGGCCCCCCAGCAGG 0: 1
1: 0
2: 0
3: 10
4: 63
1168241368_1168241382 17 Left 1168241368 19:55090809-55090831 CCCCCGGCACCCACCCAAGTGGC 0: 1
1: 0
2: 1
3: 12
4: 331
Right 1168241382 19:55090849-55090871 GACACGCACGGCCCCCCAGCAGG 0: 1
1: 0
2: 0
3: 10
4: 63
1168241377_1168241382 3 Left 1168241377 19:55090823-55090845 CCAAGTGGCCCAGTGGTTTGGTC 0: 1
1: 0
2: 0
3: 5
4: 96
Right 1168241382 19:55090849-55090871 GACACGCACGGCCCCCCAGCAGG 0: 1
1: 0
2: 0
3: 10
4: 63
1168241374_1168241382 7 Left 1168241374 19:55090819-55090841 CCACCCAAGTGGCCCAGTGGTTT 0: 1
1: 0
2: 0
3: 8
4: 117
Right 1168241382 19:55090849-55090871 GACACGCACGGCCCCCCAGCAGG 0: 1
1: 0
2: 0
3: 10
4: 63
1168241376_1168241382 4 Left 1168241376 19:55090822-55090844 CCCAAGTGGCCCAGTGGTTTGGT 0: 1
1: 0
2: 0
3: 7
4: 115
Right 1168241382 19:55090849-55090871 GACACGCACGGCCCCCCAGCAGG 0: 1
1: 0
2: 0
3: 10
4: 63
1168241364_1168241382 26 Left 1168241364 19:55090800-55090822 CCAGCCCATCCCCCGGCACCCAC 0: 1
1: 1
2: 4
3: 114
4: 948
Right 1168241382 19:55090849-55090871 GACACGCACGGCCCCCCAGCAGG 0: 1
1: 0
2: 0
3: 10
4: 63
1168241365_1168241382 22 Left 1168241365 19:55090804-55090826 CCCATCCCCCGGCACCCACCCAA 0: 1
1: 0
2: 4
3: 39
4: 447
Right 1168241382 19:55090849-55090871 GACACGCACGGCCCCCCAGCAGG 0: 1
1: 0
2: 0
3: 10
4: 63
1168241371_1168241382 14 Left 1168241371 19:55090812-55090834 CCGGCACCCACCCAAGTGGCCCA 0: 1
1: 0
2: 0
3: 22
4: 230
Right 1168241382 19:55090849-55090871 GACACGCACGGCCCCCCAGCAGG 0: 1
1: 0
2: 0
3: 10
4: 63
1168241366_1168241382 21 Left 1168241366 19:55090805-55090827 CCATCCCCCGGCACCCACCCAAG 0: 1
1: 0
2: 2
3: 56
4: 728
Right 1168241382 19:55090849-55090871 GACACGCACGGCCCCCCAGCAGG 0: 1
1: 0
2: 0
3: 10
4: 63
1168241380_1168241382 -6 Left 1168241380 19:55090832-55090854 CCAGTGGTTTGGTCATGGACACG 0: 1
1: 0
2: 0
3: 6
4: 78
Right 1168241382 19:55090849-55090871 GACACGCACGGCCCCCCAGCAGG 0: 1
1: 0
2: 0
3: 10
4: 63
1168241370_1168241382 15 Left 1168241370 19:55090811-55090833 CCCGGCACCCACCCAAGTGGCCC 0: 1
1: 0
2: 2
3: 28
4: 238
Right 1168241382 19:55090849-55090871 GACACGCACGGCCCCCCAGCAGG 0: 1
1: 0
2: 0
3: 10
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168241382 Original CRISPR GACACGCACGGCCCCCCAGC AGG Intergenic
903371067 1:22836584-22836606 GCCACGCACAGGCCCCCAGAAGG - Intronic
904461333 1:30682108-30682130 GACCCCCAAGGCCACCCAGCTGG - Intergenic
904801068 1:33093252-33093274 GACACGCAGTGCCCCTCTGCTGG - Intronic
923367500 1:233277243-233277265 GCCACGCCAGGCCTCCCAGCAGG - Intronic
1070582261 10:77731040-77731062 GACAGGGTCGGCTCCCCAGCAGG + Intergenic
1076570920 10:131432394-131432416 GACACCCGCTGCCTCCCAGCAGG - Intergenic
1081528615 11:43943283-43943305 GACGCGCGCGTCCCCCCCGCGGG - Intronic
1083258088 11:61508843-61508865 GCCCCGCACGGCCCCCCTCCCGG + Exonic
1103834060 12:123804957-123804979 CACAGGCAAGGCCCCCAAGCTGG + Exonic
1121325167 14:93015639-93015661 GACATGCCCTGCCCCCAAGCAGG + Intronic
1124512460 15:30338938-30338960 TACACGCAGGGCACACCAGCGGG + Intergenic
1124730454 15:32191813-32191835 TACACGCAGGGCACACCAGCGGG - Intergenic
1125193425 15:37019703-37019725 GAAACGCAGGGCCCAACAGCAGG + Intronic
1126158534 15:45587430-45587452 GACACTCATGTCCCTCCAGCTGG - Exonic
1131250655 15:90828089-90828111 GACACCCAGGGCGCCCCAGCAGG + Intergenic
1131699525 15:94918940-94918962 CCCAAGCACGGCTCCCCAGCTGG + Intergenic
1132761576 16:1511018-1511040 GCCACGCACCGTCCCCGAGCAGG - Exonic
1132782469 16:1635317-1635339 CACACGCAAGGCCCCCAAGCTGG - Intronic
1133257972 16:4529838-4529860 GCCACTCACGGCCACCCAGGTGG + Intronic
1136419153 16:30121774-30121796 GTCAGGCACGGCCTCGCAGCTGG - Intronic
1138448690 16:57080038-57080060 GCCAAGCACGGCCAGCCAGCAGG - Intronic
1138561578 16:57803662-57803684 GACAGTCACAGTCCCCCAGCTGG + Intronic
1141329208 16:83093357-83093379 GCCACTCACGGCACTCCAGCCGG - Intronic
1141897111 16:86965129-86965151 GACAGGCAGGGCTCCACAGCAGG + Intergenic
1142157139 16:88537730-88537752 CACCCCCTCGGCCCCCCAGCTGG + Intergenic
1142253076 16:89001669-89001691 GACACACACGGACCCCCACCTGG - Intergenic
1142496810 17:310376-310398 CACACACACGCGCCCCCAGCAGG - Intronic
1142808730 17:2385436-2385458 GACACGCTCGGCTCCCCACCTGG - Exonic
1144666263 17:17104476-17104498 GAAAGACACGGCCACCCAGCTGG - Intronic
1148149344 17:45387095-45387117 AACACGCACGGCCCAGCACCTGG - Intergenic
1152506332 17:80751353-80751375 GACACGGACTGCCCTGCAGCTGG - Intronic
1152818322 17:82422230-82422252 GACACACAGGCCCACCCAGCAGG + Intronic
1159620814 18:70636536-70636558 GTCTCGCTCTGCCCCCCAGCTGG + Intronic
1160503185 18:79412238-79412260 GCCACTCACAGCCCACCAGCTGG - Intronic
1161056106 19:2191382-2191404 GAAAGGAACGGCCCCACAGCGGG - Intronic
1161134986 19:2614273-2614295 GACGTGCAGGGCCCCCCTGCGGG - Intronic
1163308792 19:16499740-16499762 GACAGGCACAGCTCCCCAGCAGG - Intronic
1163608312 19:18287886-18287908 GGCACTCACGACCCCACAGCGGG + Intergenic
1165712867 19:38024531-38024553 GCCCGGCACTGCCCCCCAGCTGG + Intronic
1166103655 19:40586810-40586832 GACCCGCACGCCCCCTGAGCTGG - Exonic
1166376195 19:42328516-42328538 GACAGGAATGGCCCCCAAGCTGG - Intronic
1167001084 19:46746158-46746180 GGCGCGCTCGGCCTCCCAGCGGG + Exonic
1168241382 19:55090849-55090871 GACACGCACGGCCCCCCAGCAGG + Intergenic
926308379 2:11656925-11656947 AGCACGCCCGGCCCCGCAGCCGG - Intergenic
930717162 2:54604068-54604090 GACCAGCAAGGCCACCCAGCTGG + Intronic
933759946 2:85666192-85666214 CACACACACAGCACCCCAGCTGG - Intronic
935893732 2:107710463-107710485 CACACACACAGCCCCCCTGCAGG + Intergenic
943853700 2:192761606-192761628 GACAGGCAGAGCCCCTCAGCAGG - Intergenic
945251247 2:207768171-207768193 CACACGAACGGGCCCCCAGCGGG + Exonic
1171351283 20:24505102-24505124 GACACGCACAGACCCTCTGCTGG - Intronic
1172280375 20:33703657-33703679 GACTCCCAGGGCCGCCCAGCAGG - Exonic
1175913927 20:62416932-62416954 GACACTCACTGCCCCACTGCTGG + Intronic
1176197423 20:63843905-63843927 GACTCGCCCCGCCCCACAGCGGG - Intergenic
1176234840 20:64049404-64049426 GACACGCGCGGCCTCGCCGCCGG - Exonic
1180183840 21:46129896-46129918 CAGACGCACGGCAGCCCAGCTGG - Intronic
1183597037 22:38818954-38818976 GACCCTCAAGGCCACCCAGCTGG - Exonic
961658114 3:128454287-128454309 GACCCGCTTGGCCCCCCTGCTGG - Intergenic
962677549 3:137768111-137768133 GGCACACAGAGCCCCCCAGCTGG + Intergenic
966643537 3:182216927-182216949 GACTTGCAAGGACCCCCAGCTGG - Intergenic
969521128 4:7678334-7678356 GACACCCACCGTCCACCAGCTGG + Intronic
985510159 5:309000-309022 GACACGCACTGCCCACCAGAGGG - Intronic
997128626 5:131254185-131254207 GCCCCGCACCTCCCCCCAGCAGG + Intronic
998036626 5:138922688-138922710 GACTCGCACCTCCCCCCATCAGG + Intronic
1018962111 6:168456488-168456510 GACCCTCACGGCACCCCAGCAGG + Intronic
1029110786 7:98212182-98212204 GCCAGGGACGGCACCCCAGCGGG + Intronic
1032080715 7:128857154-128857176 GACAGACAAGGCCCCCGAGCCGG - Exonic
1033249440 7:139746223-139746245 GACACCCACTGTCCCCCAGCCGG + Intronic
1041710186 8:60887338-60887360 GACAAGCACGGGCCCTCACCTGG - Intergenic
1049814333 8:144591151-144591173 GAGGCTCACGGTCCCCCAGCAGG + Intronic
1053001792 9:34580664-34580686 GTCAGGCTCGGCCCCACAGCTGG + Intronic
1062411923 9:136430051-136430073 GCCACACCCAGCCCCCCAGCTGG + Intronic
1062585230 9:137246242-137246264 CACACGCAGGGCCCACCAGGAGG + Intronic
1190333751 X:49250644-49250666 CACACGCACAGCCCCCCAGTGGG - Exonic
1197774582 X:130110898-130110920 GACACACACGTCCCCGCAGGCGG + Intergenic