ID: 1168241549

View in Genome Browser
Species Human (GRCh38)
Location 19:55091540-55091562
Sequence CGCGGAGGTCAGACAGGGCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 190}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168241544_1168241549 -2 Left 1168241544 19:55091519-55091541 CCTTGAGGCGCTGGTTGTCAGCG 0: 1
1: 0
2: 0
3: 9
4: 66
Right 1168241549 19:55091540-55091562 CGCGGAGGTCAGACAGGGCCTGG 0: 1
1: 0
2: 0
3: 11
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168241549 Original CRISPR CGCGGAGGTCAGACAGGGCC TGG Exonic
900397718 1:2460079-2460101 ACCGGAGGGCAGAAAGGGCCTGG - Intronic
902802297 1:18838087-18838109 CACAGTGGCCAGACAGGGCCTGG + Intergenic
903334744 1:22617355-22617377 CTCGGAGGTCAGACAGAACTCGG - Intergenic
903749318 1:25610932-25610954 GGCTGAGGTCAGACAGGTTCGGG - Intergenic
903847253 1:26285720-26285742 CGTGGAGGGCAGGCTGGGCCTGG + Intronic
905306287 1:37020850-37020872 CACGGAGAGCAGCCAGGGCCGGG - Intronic
906297216 1:44656120-44656142 TGCTGGGGTCAGACAGGTCCGGG + Intronic
908006473 1:59733952-59733974 TGCTGAGGTCAGCAAGGGCCAGG - Intronic
910081477 1:83347654-83347676 GGGGAAGGCCAGACAGGGCCTGG - Intergenic
911078797 1:93908718-93908740 CACGGAGGTCACAGAGGGCCAGG - Intronic
912470938 1:109906370-109906392 CTCTGAAGTCACACAGGGCCAGG + Intergenic
912481021 1:109982203-109982225 AGAGGATGACAGACAGGGCCAGG - Intergenic
913150300 1:116035259-116035281 CTATGAGGCCAGACAGGGCCAGG - Exonic
915341617 1:155179595-155179617 AGCGGGTGTCAGTCAGGGCCTGG - Intronic
916078552 1:161217885-161217907 CTGGGAGGTAGGACAGGGCCTGG - Intronic
922078141 1:222268253-222268275 TGAGGAGGTCAGCCTGGGCCAGG - Intergenic
1063695586 10:8332154-8332176 CGTGGAGCTCAGAAAGGGGCTGG - Intergenic
1065629199 10:27660140-27660162 CTCAGAGGTGAGACAGGGTCCGG + Intergenic
1067299096 10:44993219-44993241 CACTGAGGCCAGACAGGGCAGGG - Intronic
1067763479 10:49068429-49068451 CGATGAGGCCAGACAGTGCCAGG + Intronic
1069542873 10:69308615-69308637 GGCTTAGGTCAGGCAGGGCCAGG + Intronic
1069886901 10:71629454-71629476 AGGGGAGGTCAGAGAGGCCCAGG + Intronic
1071603546 10:86970434-86970456 AGGGCAGGTCAGGCAGGGCCCGG - Intronic
1072663787 10:97379743-97379765 GGCGCAGGTCACACAGGGACTGG + Exonic
1073470777 10:103720876-103720898 GGCGGAGCAGAGACAGGGCCGGG + Intronic
1075483087 10:122798950-122798972 CTGGGAGGGCAGACACGGCCAGG - Intergenic
1078901958 11:15650337-15650359 AGCGGAGGTCAGCGAGGACCCGG + Intergenic
1079296626 11:19240981-19241003 TGCGGCGGGCGGACAGGGCCTGG - Intronic
1083429185 11:62605097-62605119 CGGGGAGGTGAGAGAGAGCCAGG - Exonic
1084021479 11:66420639-66420661 CGCAGAGGGCAGAGAGGGGCCGG - Intergenic
1084108490 11:66997187-66997209 CACTGAGGTCAGGCAGGGCGTGG + Intergenic
1084156966 11:67318426-67318448 CTCGTAGGTCACACAGAGCCAGG - Intronic
1084189671 11:67493284-67493306 CGCTGCAGTCAGGCAGGGCCCGG + Intronic
1084209675 11:67615214-67615236 CGCCCAGGTCAGACCTGGCCAGG + Intergenic
1084980993 11:72828708-72828730 CCCTGAGGACAGACAGGGCTGGG - Exonic
1090699163 11:129279196-129279218 CGCGGAGGGCAGACACGGAGCGG - Intronic
1090833970 11:130440363-130440385 GGGGGAGGCCAGACAGGGACTGG + Intergenic
1091335394 11:134762402-134762424 GGCGGGGGTCAGACCGGGGCTGG + Intergenic
1091805329 12:3352031-3352053 CGCGGAGGTCAGACAGTGGTGGG - Intergenic
1092882857 12:12901317-12901339 AGCGGGGTTCAGACATGGCCAGG + Intronic
1094701449 12:32874347-32874369 GGGGGAGGTCAGACAGGCACAGG + Intronic
1096691797 12:53325900-53325922 CCCGGCGGGCAGACTGGGCCTGG - Intergenic
1096771168 12:53936871-53936893 CGAGGAGAGCAAACAGGGCCTGG - Intergenic
1098270249 12:68762909-68762931 CTTGGAGGTCAGACAGGTCCAGG + Intronic
1099894294 12:88625525-88625547 CGCCAAGCACAGACAGGGCCTGG + Intergenic
1101730751 12:107425109-107425131 CCGGGAAGGCAGACAGGGCCTGG - Intronic
1105345105 13:19564598-19564620 GCTGCAGGTCAGACAGGGCCTGG - Intergenic
1113472142 13:110554791-110554813 CTCTGAGGCCAGAGAGGGCCTGG + Intronic
1113910503 13:113839116-113839138 TGCCGAGGACAGACAAGGCCAGG + Intronic
1117254163 14:53961599-53961621 CGTGGATGGCAGACAGGGCATGG + Intergenic
1117569213 14:57029685-57029707 CTCCGAGCTCACACAGGGCCTGG - Intergenic
1120502638 14:85315941-85315963 GTCGGAGGTCAGAAAGGGTCCGG + Intergenic
1120997574 14:90428111-90428133 CAGGGAGGTCAGAGAGGGCGAGG + Intergenic
1121019032 14:90567726-90567748 AGCGGAGGCCAGACAGGGGAAGG - Intronic
1122328201 14:100895305-100895327 TGTGGGGGTCAGACAGGGCAGGG + Intergenic
1122376002 14:101257758-101257780 CTCTGCGGTCAGGCAGGGCCAGG - Intergenic
1122946379 14:105012380-105012402 GGCGGGGGCCGGACAGGGCCGGG + Intronic
1125600049 15:40910535-40910557 TGCGGAGGCCAGGCTGGGCCAGG - Intergenic
1125893663 15:43284461-43284483 CCCAGAAGTCAGACAGAGCCTGG - Intronic
1126183034 15:45804614-45804636 AGCTGAGGTGAGACAGGGTCAGG - Intergenic
1129754972 15:78092644-78092666 CCTGGAGCTCAGCCAGGGCCTGG - Exonic
1131329074 15:91479684-91479706 CCCGGAGGTCAGGGAGGCCCAGG - Intergenic
1131906353 15:97147360-97147382 TGCAGAGGCCAGACAAGGCCGGG + Intergenic
1132861479 16:2073810-2073832 AGCGGAGCTCAGGCAGAGCCCGG - Intronic
1133270383 16:4608462-4608484 GGCAGAGGGCAGACAGAGCCAGG - Intergenic
1133920848 16:10151852-10151874 GTCGGAGGTCAGACAGAGGCTGG - Intronic
1135400314 16:22162457-22162479 CGAGGAGGGCAGAAAGGGGCGGG - Intergenic
1135417583 16:22280365-22280387 CGCAGAGATCAGGTAGGGCCTGG + Exonic
1135822217 16:25693825-25693847 GGCGGAGATTAGACAGGGCACGG - Intronic
1136003493 16:27313591-27313613 CGCGGAGGCCAGGCAGGAGCAGG + Intergenic
1136245756 16:28974968-28974990 CGGGGAGGCGTGACAGGGCCCGG + Exonic
1136347906 16:29688271-29688293 CAAGGTGGTCAGACAGCGCCTGG + Intronic
1138197061 16:55059583-55059605 GGCTGAGGTCACACAGGGACTGG + Intergenic
1138965710 16:62081618-62081640 CACGAAGGTCAGACAGGTCATGG + Intergenic
1139438174 16:66948770-66948792 CGCGGAGGGGTGACAGGGACCGG + Intergenic
1140399672 16:74660931-74660953 CTCAGAGGACAGACAGTGCCAGG - Exonic
1141074713 16:80993578-80993600 CGCAGAGCTCACACAGGGCTGGG + Intronic
1141604386 16:85144589-85144611 GGAGGAGGTCAGGCACGGCCAGG + Intergenic
1141715404 16:85724185-85724207 CTCGGAAGTCAGAGCGGGCCAGG - Intronic
1142610961 17:1109082-1109104 CGCGGAGGGCAGACAGGAAGCGG + Intronic
1144236176 17:13262566-13262588 TGGGGAGGCCAGGCAGGGCCTGG + Intergenic
1144787589 17:17840476-17840498 CGCCGAGGTCGGGCAGGGGCCGG - Intergenic
1147938124 17:44025355-44025377 CTCAGTGGCCAGACAGGGCCAGG - Intergenic
1151829037 17:76538788-76538810 GCCTGAGGCCAGACAGGGCCTGG + Intronic
1151871078 17:76837312-76837334 CCCAGAGCTCAGACAGAGCCAGG + Intergenic
1152931371 17:83111807-83111829 CGCGCAGGGCAGCCAGGTCCCGG + Intergenic
1154497520 18:14973308-14973330 CCCAGAGGTCAGGCAGGGCAGGG + Intergenic
1160783952 19:891271-891293 CCCGGAGGCCAGACAGAGCCTGG + Intronic
1161028915 19:2049058-2049080 AACGGTGGCCAGACAGGGCCAGG - Intronic
1161664021 19:5564171-5564193 CCCGGAAGTGAGAGAGGGCCTGG + Intergenic
1162720006 19:12656695-12656717 GGCGGGGGTCAGAGAGGGCATGG + Intronic
1162840982 19:13356236-13356258 CACGGAGGTCACCCCGGGCCAGG + Intronic
1163124346 19:15236686-15236708 CGCCCAGGGCAGACAGGGACAGG + Exonic
1165256218 19:34578494-34578516 CTCTGAGGGCAGAGAGGGCCAGG + Intergenic
1166857169 19:45788184-45788206 TGCAGAGGACAGACAGGCCCAGG - Intronic
1167053321 19:47093519-47093541 CATGGAGGTCAGCTAGGGCCTGG + Intronic
1168241549 19:55091540-55091562 CGCGGAGGTCAGACAGGGCCTGG + Exonic
926382107 2:12301239-12301261 TGCTGAGGTCAGGCAGGGCTAGG + Intergenic
934552626 2:95271632-95271654 CACGGAGGTCAGAGGGTGCCAGG + Intergenic
937132362 2:119523320-119523342 CCCGGAGCTCAGAGAGGCCCGGG + Intronic
937201907 2:120209407-120209429 TCGGGAGGCCAGACAGGGCCAGG - Intergenic
937235996 2:120432308-120432330 AGTGGAGCGCAGACAGGGCCCGG - Intergenic
938903740 2:135819838-135819860 CCAGGAGGACAGTCAGGGCCAGG - Intronic
945647830 2:212522560-212522582 CGCAGAGGTAAGACAGGGGAGGG + Intronic
947061939 2:226176729-226176751 CTCAGAGTTCAGACAGGGGCAGG - Intergenic
947588849 2:231373139-231373161 TGAGGAGTTCAGAGAGGGCCTGG - Intronic
947743576 2:232496440-232496462 TGTAGAGGTCAGACTGGGCCAGG - Intergenic
948979094 2:241483671-241483693 CGTTGGAGTCAGACAGGGCCAGG + Intronic
1170870929 20:20205667-20205689 AGCCCAGGTCAGACAGGGTCAGG - Intronic
1174054063 20:47785864-47785886 CGCCGGGGACAGGCAGGGCCGGG - Exonic
1175158975 20:56994085-56994107 CAGGGAGGTCAGAGAGGGGCAGG - Intergenic
1175944889 20:62554083-62554105 CGCCGAGGTCAGAAGGGGGCAGG + Intronic
1175998225 20:62820786-62820808 TGTGGAGGGCAGACAGGGCCTGG + Intronic
1176212303 20:63930847-63930869 CGCAGAAGACAAACAGGGCCTGG - Exonic
1176220543 20:63967487-63967509 CGTGGTGGACAGACAGTGCCCGG - Exonic
1179250830 21:39669965-39669987 CCAGGAGGTCAAACAGGCCCAGG - Exonic
1179674598 21:42973481-42973503 CCCGGAAGGCAGACAGGCCCAGG - Intergenic
1179886266 21:44315487-44315509 GGAGCAGCTCAGACAGGGCCCGG - Intronic
1181041631 22:20195145-20195167 CTGGGAGGCCATACAGGGCCTGG - Intergenic
1181568066 22:23751584-23751606 CGGGGAGGGCAGACAGGAACAGG - Intergenic
1181669854 22:24420964-24420986 GGGGGTGGTCAGGCAGGGCCTGG - Intronic
1182520244 22:30880971-30880993 CCTGGTGGTCAGGCAGGGCCTGG + Intronic
1183188417 22:36305914-36305936 GGCAGAGGTGAGCCAGGGCCCGG - Exonic
1183211653 22:36455083-36455105 CGCGGACGGCGGACTGGGCCGGG + Intergenic
1183486468 22:38089690-38089712 CACGGGGGTCAGCCAGGTCCGGG + Intronic
1183745153 22:39687642-39687664 CGGGGAGGAGAGACAGGGGCTGG - Exonic
1183986669 22:41574020-41574042 CGTGGAGGTCTGAGAGGGCTAGG + Intronic
1184108711 22:42383202-42383224 AGCTGAGGTCAGAGAGGCCCAGG + Exonic
1184920073 22:47599886-47599908 CGCACAGCTCAGACAGGTCCAGG + Intergenic
950526636 3:13528318-13528340 CGGGGAGGCAAGGCAGGGCCGGG + Intergenic
953050027 3:39332559-39332581 AAAGCAGGTCAGACAGGGCCAGG - Exonic
954809525 3:53239596-53239618 TGCGGTGGTCAGATATGGCCTGG - Intronic
955449778 3:59053218-59053240 CACGGAGGTGAGACAGAGACTGG - Intergenic
967913425 3:194560295-194560317 CCCGGAAGTCAGCCAGGGTCAGG + Intergenic
967975293 3:195030984-195031006 CGCTGCGGTCACACTGGGCCAGG - Intergenic
970675509 4:18444408-18444430 CCTGGAGGTCACACAAGGCCAGG + Intergenic
971478141 4:27091148-27091170 CCCTGAGGTCAGAGAGGCCCCGG - Intergenic
985791664 5:1931429-1931451 GGTGGAGGTCAGGCAGGACCCGG - Intergenic
986262404 5:6159975-6159997 AGAGGAGGGCAGACATGGCCTGG - Intergenic
988837367 5:35046431-35046453 AGGGGAGGATAGACAGGGCCTGG + Intronic
996416279 5:123214166-123214188 TGTGGAGGTCAGAGAGGGCTTGG - Intergenic
997197992 5:131992378-131992400 GGCCCAGATCAGACAGGGCCTGG - Intronic
998379205 5:141712007-141712029 CCTGGAGGCCAGACAGAGCCTGG - Intergenic
999248409 5:150167382-150167404 AGCAGAGGTCAGACAGGGGGCGG - Intronic
1001771076 5:174296260-174296282 CTAGGAAGTCAGACAAGGCCAGG + Intergenic
1002644301 5:180645639-180645661 TGCGGGCCTCAGACAGGGCCGGG + Intronic
1002889042 6:1317675-1317697 CGCGGAGACCAGGCTGGGCCGGG - Intergenic
1006457499 6:34140334-34140356 CGATGAAGTCAGAGAGGGCCTGG + Intronic
1007390069 6:41545877-41545899 GAGGGAGGCCAGACAGGGCCCGG + Intergenic
1007430758 6:41775418-41775440 CGCCGATGTCAGACAGGCCAGGG - Exonic
1015164034 6:130183415-130183437 AGCAGAGATCTGACAGGGCCAGG + Intronic
1015729352 6:136332550-136332572 CAGGGAGGTCAGGCAGGGCTGGG + Intergenic
1019276827 7:180166-180188 GGTGGAGGTCAGGCAGGCCCTGG + Intergenic
1019348377 7:541500-541522 TGCAGACCTCAGACAGGGCCCGG - Intergenic
1019552491 7:1610148-1610170 CGGGGAAGGCAGACAGTGCCAGG - Intergenic
1020085622 7:5308800-5308822 CGGGCAGCTCAGACAGGGCCCGG - Intronic
1023847321 7:44129753-44129775 CGTGGAGGTCAGGGAGGGGCTGG + Intergenic
1024254018 7:47526569-47526591 GGTGGAGGTCAGACAGAGCTGGG - Intronic
1025247537 7:57328610-57328632 CCCAGATGTCAGGCAGGGCCTGG + Intergenic
1027298964 7:76809894-76809916 GGGGAAGGCCAGACAGGGCCTGG - Intergenic
1029439482 7:100579054-100579076 TGAGGAGGACAGACAGGGCTGGG - Intronic
1032485758 7:132286311-132286333 CAGGGTGGACAGACAGGGCCAGG - Intronic
1035312057 7:157975674-157975696 CACGGAGGGCAGGCAGGGGCTGG - Intronic
1035399643 7:158556696-158556718 CGCGCAGGTCAGACGGCTCCCGG + Intronic
1035399678 7:158556841-158556863 CGCGCAGGTCAGACAGCTCCCGG + Intronic
1035446451 7:158946537-158946559 AGCGGAGGACAGAAAGGCCCTGG + Intronic
1035451512 7:158980070-158980092 AGCGGAGGTCAGGCTGGGGCGGG + Intergenic
1036295131 8:7528954-7528976 AGCAGAGGCCAGGCAGGGCCCGG + Intergenic
1036327432 8:7792037-7792059 AGCAGAGGCCAGGCAGGGCCCGG - Intergenic
1036640953 8:10583420-10583442 AGCAGGTGTCAGACAGGGCCTGG - Intergenic
1038217693 8:25577838-25577860 CTCGGTGGTCAGACCAGGCCAGG - Intergenic
1039560146 8:38505980-38506002 GGCAGAGGTCAGACAGGATCTGG - Intergenic
1048991352 8:139762022-139762044 CTGGGAGCCCAGACAGGGCCGGG - Intronic
1049234988 8:141507951-141507973 GGTGGAGCTCAGAGAGGGCCAGG + Intergenic
1049665628 8:143841333-143841355 CGAGGAGGTGAGGCGGGGCCTGG - Intergenic
1051063313 9:13071094-13071116 CCCGGAGCTCATACAGAGCCAGG + Intergenic
1051821792 9:21178946-21178968 CATGGAGGACAGACAGGGCCGGG + Intergenic
1051824836 9:21209537-21209559 CATGGAGGACAGACAGGGCCTGG + Intronic
1051826832 9:21231614-21231636 CATGGAGGACAGACAGGGCCTGG + Intronic
1051843098 9:21420456-21420478 CATGGAGGACAGACAGGGCCTGG - Intronic
1055400915 9:75923016-75923038 CGAGGAGGTGAGACAGGGTGGGG + Intronic
1056584887 9:87921382-87921404 CGTGGAGGACTGCCAGGGCCTGG - Intergenic
1056611994 9:88131558-88131580 CGTGGAGGACTGCCAGGGCCTGG + Intergenic
1056687137 9:88776096-88776118 TGGTGAGGTCAGAGAGGGCCAGG + Intergenic
1057447484 9:95127525-95127547 CGCGGGGCTCTGACAGGGGCAGG + Intronic
1057448803 9:95138158-95138180 AGCCGAGGTCAGAGAGGACCAGG + Intronic
1057684512 9:97220972-97220994 CGCTGCGGGCAAACAGGGCCTGG + Intergenic
1057695731 9:97321882-97321904 CCCGGAGGCAAGACAGGGCTGGG + Intronic
1060183880 9:121552187-121552209 GGAGGAGGCCAGACAGGGCTGGG - Intergenic
1061800970 9:133113244-133113266 CGTGGAGCTCAGAGAAGGCCTGG + Intronic
1061839145 9:133347692-133347714 CGCGGTGCTCAGGGAGGGCCCGG + Exonic
1061873964 9:133534848-133534870 TGCGGAGGGCAGACGGCGCCAGG - Intronic
1062067653 9:134537370-134537392 TGGGGAGGGCAGGCAGGGCCAGG + Intergenic
1062392308 9:136338726-136338748 CGCGGCGGGCAGACCCGGCCCGG + Intronic
1062445312 9:136591316-136591338 TGCGGAGGTCAGACAGACCATGG + Intergenic
1062573616 9:137196616-137196638 CAGGGTGGTCAGACAAGGCCAGG + Intronic
1185506411 X:634781-634803 CGAGGAGCTCAGCCAGCGCCTGG + Exonic
1185519789 X:729772-729794 CGCCCAGGTCAGACTGGGTCAGG + Intergenic
1189481288 X:41394183-41394205 AGGGGAGGTGAGACAGGGCAGGG - Intergenic
1192141805 X:68652561-68652583 CCTGGAGGCCAGTCAGGGCCCGG + Intronic
1192554986 X:72082162-72082184 AGAATAGGTCAGACAGGGCCTGG + Intergenic
1200215403 X:154365996-154366018 AGCAGAGGGCAGTCAGGGCCGGG + Intronic