ID: 1168242731

View in Genome Browser
Species Human (GRCh38)
Location 19:55095509-55095531
Sequence CCTGAAAGGCGGACAGCGGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 98}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168242731_1168242749 27 Left 1168242731 19:55095509-55095531 CCCTCCGCTGTCCGCCTTTCAGG 0: 1
1: 0
2: 0
3: 12
4: 98
Right 1168242749 19:55095559-55095581 CTTCAGGAGGCCAAAGCGCCTGG 0: 1
1: 0
2: 18
3: 264
4: 3485
1168242731_1168242746 14 Left 1168242731 19:55095509-55095531 CCCTCCGCTGTCCGCCTTTCAGG 0: 1
1: 0
2: 0
3: 12
4: 98
Right 1168242746 19:55095546-55095568 CAGAACTCCCTGTCTTCAGGAGG 0: 1
1: 0
2: 0
3: 22
4: 176
1168242731_1168242744 11 Left 1168242731 19:55095509-55095531 CCCTCCGCTGTCCGCCTTTCAGG 0: 1
1: 0
2: 0
3: 12
4: 98
Right 1168242744 19:55095543-55095565 CACCAGAACTCCCTGTCTTCAGG 0: 1
1: 0
2: 1
3: 8
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168242731 Original CRISPR CCTGAAAGGCGGACAGCGGA GGG (reversed) Exonic
903563463 1:24246465-24246487 CCTGAAAGGAGGAGAGGGAAGGG - Intergenic
904413921 1:30343086-30343108 CCTGGGAGGGGGCCAGCGGATGG + Intergenic
908069956 1:60449245-60449267 CCTGAAATGTGCACAGTGGAGGG + Intergenic
921823914 1:219650107-219650129 ACTGAAAGGCGTACAGTGGGTGG - Intergenic
1063227810 10:4032898-4032920 CCAGACAGGGGGACAGCAGAGGG + Intergenic
1071430663 10:85603874-85603896 CCTGCAAGGTGGACAGGGGATGG - Intronic
1072736455 10:97882665-97882687 GCAGAAAGGAGGACAGGGGAGGG - Intronic
1075224418 10:120613558-120613580 CCTGAATGGGGGACTGGGGAAGG - Intergenic
1076152494 10:128173860-128173882 CCTGAAAGATGGACAAAGGAGGG + Intergenic
1078313822 11:10274234-10274256 CCTCCAAGGTTGACAGCGGAAGG - Intronic
1078405859 11:11069441-11069463 CCTGAAAGGCTGTCATGGGAAGG - Intergenic
1082778747 11:57269756-57269778 CCTGAAAGGCAGACAGAGGCTGG - Intergenic
1083554267 11:63613755-63613777 CCTGAAACGCGCCCAGCGGAAGG - Intronic
1090056793 11:123430819-123430841 CCTGCAGGGCGGGCAGCGGCCGG - Exonic
1092090253 12:5798215-5798237 CATGAAAGGCAGCCAGGGGACGG + Intronic
1092470221 12:8771360-8771382 GGTGAAAGGAGGACAGGGGAAGG + Intronic
1092633068 12:10406638-10406660 TCTGAAAGGTGGAAAGAGGAAGG + Intronic
1099688005 12:85913896-85913918 CCTGAAAGGGGGATAGGGCAAGG - Intergenic
1104895217 12:132160652-132160674 CCTGAAGGGCTGACAGGGAAGGG - Intergenic
1112248462 13:97755999-97756021 CCTGTAAGGAGGACAGAGCACGG + Intergenic
1112547171 13:100382232-100382254 GCTGAAAAGGGGACAGAGGAGGG + Intronic
1112607988 13:100926866-100926888 CCTGAGAGCCAGACAGCTGATGG - Intergenic
1113472853 13:110559102-110559124 CCTGCAAGGCAGGCAGTGGATGG - Intronic
1113554065 13:111216894-111216916 TCTGAAAGGCAGAAAGAGGAAGG - Intronic
1118863489 14:69683970-69683992 CCTGCAAGGGGGACTGCAGAAGG - Intronic
1121552585 14:94813624-94813646 CCAGAGAGGGGGACAGGGGATGG + Intergenic
1122366283 14:101196812-101196834 CCTGGAAGGCTGGCAGCAGAGGG - Intergenic
1122778901 14:104135446-104135468 CCTGGAAGGTGGACAGGCGAGGG - Intergenic
1128096483 15:64960302-64960324 CCTGAAGGGCTGACAGCTGGAGG - Intergenic
1129888211 15:79053335-79053357 CCTAGAAGGCTGACAGTGGAGGG - Intronic
1132090387 15:98943508-98943530 ACTGAAAGACAGACAGCAGATGG - Intronic
1132607775 16:800666-800688 CTTGAAAAGGTGACAGCGGAGGG + Exonic
1132925521 16:2427382-2427404 CCTGAAACGAGGACTGAGGAGGG - Intergenic
1133924867 16:10183909-10183931 CCTGAAAGGCAGACAGGCGTTGG - Intergenic
1135858553 16:26034162-26034184 CCTGGAAGGAGGACAGAGCAAGG + Intronic
1136111779 16:28067949-28067971 CCTGAAAGACGCACAGAGGAAGG - Intergenic
1140890222 16:79278764-79278786 CCTGACAGGGGGACAGGAGATGG + Intergenic
1149604727 17:57916595-57916617 CCTGACAGGAAGACAGCGGAAGG + Intronic
1150200396 17:63350303-63350325 TCTGAAAGGGGGAAAGCAGAGGG - Intronic
1151484164 17:74388109-74388131 CCAGAAAGGAGGCCAGCAGAAGG + Intergenic
1152730889 17:81969366-81969388 CCTGACAGGGTGACAGGGGAAGG + Intergenic
1153970125 18:10218554-10218576 CCTGACAGGCTGAAAGAGGAGGG + Intergenic
1159148213 18:64482432-64482454 TCAGAAAGGGGGACAGTGGAAGG - Intergenic
1160418287 18:78726995-78727017 CCTGGGAGGCGGGCAGCGCATGG - Intergenic
1160674638 19:383347-383369 CCTGAGAGAGGGACAGGGGAGGG - Intergenic
1160896828 19:1407083-1407105 TGTGAAATGCGGACAGGGGAAGG + Intergenic
1163223122 19:15935683-15935705 CCTTAGAGGGGGACAGAGGAGGG + Intergenic
1164861661 19:31566537-31566559 CCTGACAGGGGGAAAGAGGAGGG + Intergenic
1165043334 19:33084564-33084586 CCAGAAAGGCGGACAGTGCAGGG - Intronic
1165046409 19:33108328-33108350 CCTGAAAGGCGGGCAGGGGCGGG - Intronic
1165894515 19:39133616-39133638 CCTGGAATGCAGACAGCAGAAGG - Intronic
1166391036 19:42409054-42409076 CCTGAAAGTCAGAGAGAGGATGG + Intronic
1168242731 19:55095509-55095531 CCTGAAAGGCGGACAGCGGAGGG - Exonic
932599686 2:73114913-73114935 CCTGGAAGGTGGACAGTTGAGGG - Intronic
937535108 2:122876677-122876699 CCTGAAAGGAAGAAAGCAGAGGG - Intergenic
1169284638 20:4297737-4297759 TGTAAAATGCGGACAGCGGAGGG + Intergenic
1170406458 20:16043102-16043124 GCTCAAAGGCGGGCAGGGGATGG + Intronic
1173941344 20:46913782-46913804 GCTGAAATGGGGACAGTGGAGGG + Intronic
1174540626 20:51286464-51286486 TCTGAAAGCCAGACAGGGGAGGG + Intergenic
1179456686 21:41505548-41505570 TCTGAAAGGGGGCCTGCGGAGGG - Intronic
1180246943 21:46554751-46554773 CCAGAAAAGGGGGCAGCGGAGGG - Intronic
1180908467 22:19431872-19431894 CCTGGACGGCGGACAGCGAGCGG + Intronic
1181061379 22:20283674-20283696 CCTGAAAGGCGGATGGTGGAAGG - Intergenic
1182295490 22:29309458-29309480 CCTGGGAGGCAGATAGCGGATGG + Intronic
1182722431 22:32414320-32414342 CCTGATAAGCAGACAGTGGAGGG - Exonic
1182780793 22:32865862-32865884 CCTGGAAGGGGGACAGAGTAGGG + Intronic
1183195800 22:36352611-36352633 CCTGAAAGTCGGACAGGGTGAGG - Intronic
1183981066 22:41540584-41540606 CCTGTAAGGCTGAGGGCGGAAGG - Intronic
1184369249 22:44072198-44072220 CCGGAAAGGGGGACAGGGTAGGG - Intronic
1184393052 22:44216668-44216690 CCTGAATGGAGGAGAACGGATGG - Intronic
950504595 3:13386855-13386877 GGTGAAAGGCGGGCAGGGGAAGG - Intronic
951391129 3:22105566-22105588 CCTGAAAGCCAGAGAGCTGATGG + Intronic
954489255 3:50886147-50886169 TCTGAAAGGCGGAAAGAAGAAGG - Intronic
955232425 3:57110882-57110904 CCTGAAAGGCAGACACCCAAGGG + Intronic
962917432 3:139917392-139917414 CCTGTCAGGTTGACAGCGGAAGG + Intergenic
971111824 4:23593485-23593507 CCTGAAAGCCAGACAGCCAATGG + Intergenic
972678151 4:41280093-41280115 CCTGGAAGGCGGAAGGTGGAAGG - Intergenic
973743968 4:53945726-53945748 GATGAAAGGAGGACAGGGGAAGG - Intronic
981517089 4:145621040-145621062 TCTGAAAGGAGGACTGAGGAGGG + Intronic
992079379 5:73219661-73219683 CCTGAAAGGCATGCAGAGGAGGG - Intergenic
1001199060 5:169699432-169699454 CCTCCAAGGGGGACAGTGGAGGG + Exonic
1006113486 6:31762949-31762971 CCTGAGAGGCTGACAGAGGCAGG + Exonic
1007590164 6:43016256-43016278 CCTGAAAGGCGGATAGAGGTGGG - Intronic
1013006747 6:106081128-106081150 CCTGAGAGGTGGAGAGGGGAGGG - Intergenic
1018931228 6:168241691-168241713 CCTCAAAGGCGGCCAGAGGAGGG + Intergenic
1019199930 6:170306298-170306320 CCGGAAACGGGGACAGCGGGGGG - Intronic
1020175653 7:5880102-5880124 CCTGAAAGGTGGGAAGCAGATGG - Intronic
1025041466 7:55649779-55649801 CCTGAGAGGGGGACAGGGAAGGG - Intergenic
1027463000 7:78478711-78478733 CCTGAAAGGTGGAAAGAAGAAGG + Intronic
1029083174 7:97990874-97990896 CCTGAAAGGTGGGAAGCAGATGG + Intronic
1031172818 7:118313041-118313063 ACTGAGAGGAGGACAGGGGAAGG + Intergenic
1031947135 7:127854026-127854048 CCTGAAAGGCAGAAAGCAGATGG - Intronic
1041796983 8:61755638-61755660 CCAGAAAGGCTGACAGAAGAGGG + Intergenic
1046784833 8:118254719-118254741 CCTGAATGGTGGAAAGCTGAAGG - Intronic
1049033774 8:140058626-140058648 CCTGCAAGACAGACAGTGGAAGG + Intronic
1060796398 9:126515213-126515235 CCTGAAGGGCAGCCAGGGGAGGG - Intergenic
1062319553 9:135984118-135984140 CCTCAGAGGAGGACAGGGGAGGG + Intergenic
1062483503 9:136763208-136763230 CCTAAAAGGCGGGGGGCGGAGGG + Intronic
1185625543 X:1478886-1478908 CCAGAAAGGCAGACAGCAGGGGG - Intronic
1189256756 X:39645775-39645797 CCAGGAAGGCAGACAGCGGCTGG - Intergenic
1189380257 X:40497677-40497699 CCTGTGAGGCTGACAGCAGAGGG - Intergenic
1189396039 X:40623676-40623698 CTTTAAAGGCAGCCAGCGGAAGG - Intergenic
1190227816 X:48559652-48559674 ACTGACAGGCCGAGAGCGGATGG + Exonic
1190477443 X:50842021-50842043 CCTGAAATGAGGACAGCATATGG + Intergenic
1191129857 X:56995801-56995823 CCTGAAAGGTGGAAAGCAGAAGG - Intergenic
1195625617 X:107003492-107003514 CCTGAAGGGCTAACAGCTGAAGG - Intergenic
1196717287 X:118823929-118823951 CCTGCAAGGCGGAGACCAGAAGG + Exonic
1202170264 Y:22036025-22036047 TCTGAAAGGCAGAAAGAGGAAGG + Intergenic
1202221101 Y:22550348-22550370 TCTGAAAGGCAGAAAGAGGAAGG - Intergenic
1202322011 Y:23645314-23645336 TCTGAAAGGCAGAAAGAGGAAGG + Intergenic
1202548756 Y:26024742-26024764 TCTGAAAGGCAGAAAGAGGAAGG - Intergenic