ID: 1168246642

View in Genome Browser
Species Human (GRCh38)
Location 19:55115950-55115972
Sequence CCCTGTCATGGCATCTTCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 185}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168246642_1168246649 7 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 1168246642 19:55115950-55115972 CCCTGGAAGATGCCATGACAGGG 0: 1
1: 0
2: 2
3: 21
4: 185
Right 1168246649 19:55115980-55116002 AGAGCTAGCACAGACTAGAGAGG 0: 1
1: 0
2: 0
3: 6
4: 120
1168246642_1168246653 15 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 1168246642 19:55115950-55115972 CCCTGGAAGATGCCATGACAGGG 0: 1
1: 0
2: 2
3: 21
4: 185
Right 1168246653 19:55115988-55116010 CACAGACTAGAGAGGTAAGGGGG 0: 1
1: 0
2: 1
3: 20
4: 218
1168246642_1168246654 16 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 1168246642 19:55115950-55115972 CCCTGGAAGATGCCATGACAGGG 0: 1
1: 0
2: 2
3: 21
4: 185
Right 1168246654 19:55115989-55116011 ACAGACTAGAGAGGTAAGGGGGG 0: 1
1: 0
2: 5
3: 19
4: 211
1168246642_1168246657 22 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 1168246642 19:55115950-55115972 CCCTGGAAGATGCCATGACAGGG 0: 1
1: 0
2: 2
3: 21
4: 185
Right 1168246657 19:55115995-55116017 TAGAGAGGTAAGGGGGGTAGGGG 0: 1
1: 0
2: 0
3: 22
4: 361
1168246642_1168246655 20 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 1168246642 19:55115950-55115972 CCCTGGAAGATGCCATGACAGGG 0: 1
1: 0
2: 2
3: 21
4: 185
Right 1168246655 19:55115993-55116015 ACTAGAGAGGTAAGGGGGGTAGG 0: 1
1: 0
2: 0
3: 20
4: 239
1168246642_1168246651 13 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 1168246642 19:55115950-55115972 CCCTGGAAGATGCCATGACAGGG 0: 1
1: 0
2: 2
3: 21
4: 185
Right 1168246651 19:55115986-55116008 AGCACAGACTAGAGAGGTAAGGG 0: 1
1: 0
2: 1
3: 17
4: 268
1168246642_1168246656 21 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 1168246642 19:55115950-55115972 CCCTGGAAGATGCCATGACAGGG 0: 1
1: 0
2: 2
3: 21
4: 185
Right 1168246656 19:55115994-55116016 CTAGAGAGGTAAGGGGGGTAGGG 0: 1
1: 0
2: 0
3: 26
4: 228
1168246642_1168246652 14 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 1168246642 19:55115950-55115972 CCCTGGAAGATGCCATGACAGGG 0: 1
1: 0
2: 2
3: 21
4: 185
Right 1168246652 19:55115987-55116009 GCACAGACTAGAGAGGTAAGGGG 0: 1
1: 0
2: 0
3: 17
4: 222
1168246642_1168246650 12 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 1168246642 19:55115950-55115972 CCCTGGAAGATGCCATGACAGGG 0: 1
1: 0
2: 2
3: 21
4: 185
Right 1168246650 19:55115985-55116007 TAGCACAGACTAGAGAGGTAAGG 0: 1
1: 0
2: 3
3: 14
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168246642 Original CRISPR CCCTGTCATGGCATCTTCCA GGG (reversed) Intronic
900407231 1:2498071-2498093 CCCTGTCCTGCCCTCTCCCATGG - Intronic
902747170 1:18481870-18481892 ACCTCTCAGGCCATCTTCCAGGG + Exonic
902983116 1:20139558-20139580 CCCTGAGATGGAATCCTCCAGGG + Intronic
904396140 1:30223853-30223875 CCCTGTAATGGCATCTCCAAGGG + Intergenic
905275979 1:36818571-36818593 CCCTGCCCTGGCCTCTGCCATGG + Intronic
905878035 1:41445871-41445893 CCCTGTCATGGCATCACTGATGG + Intergenic
906651640 1:47517008-47517030 GCCTCTCATCCCATCTTCCAGGG - Intergenic
907890352 1:58631033-58631055 CCCGGTGATGTCATCTTTCATGG + Intergenic
908315470 1:62928001-62928023 CCCTGGCAAGGCAGCCTCCAAGG - Intergenic
909318501 1:74253413-74253435 CCCTGCCATGGGCTCTTGCATGG - Intronic
912961457 1:114199150-114199172 GCCTCTCATTGCCTCTTCCAAGG + Intergenic
913333201 1:117684271-117684293 CATTGTCCTGGCATCTTCCATGG - Intergenic
915039177 1:152953537-152953559 CCCTACCATGCCATCTTCCATGG - Intergenic
916047059 1:161007818-161007840 CCCTGTCATTGCAGCTGCCTTGG + Intronic
920702685 1:208229853-208229875 CCCTGTTCTGGAACCTTCCAAGG - Intronic
1067246906 10:44555000-44555022 ACCTGTCATGGAAACTCCCATGG - Intergenic
1068889132 10:62130520-62130542 CCATGTCATGCCTTCTGCCATGG + Intergenic
1069233787 10:66045090-66045112 CTCTGTCATTGAATCTTCCCTGG - Intronic
1069588511 10:69627384-69627406 CCCTGTCATACTGTCTTCCATGG + Intergenic
1071504007 10:86222129-86222151 CCATCTCATGGCATCCTCCCAGG + Intronic
1072780509 10:98248131-98248153 CCCTGTCAGGGCCTCTGCCAAGG - Exonic
1072861051 10:99006353-99006375 CCCTGTGGTGCCATCCTCCAGGG - Intronic
1076732634 10:132446244-132446266 CCCTGTGATGGCGGCTGCCATGG - Intronic
1078575992 11:12503223-12503245 CTCTCTCATGGCTTCTTCCAGGG + Intronic
1079952301 11:26820042-26820064 CCCTGGCTTGGCCTCCTCCAAGG + Intergenic
1080807929 11:35672738-35672760 CCCTGTCAGAGCTTCTTCTATGG - Intronic
1083940758 11:65894204-65894226 CCCTGCCATGACCTCTGCCAGGG - Intronic
1087963385 11:104380409-104380431 CCCTGTTATGTCATCCTCCTTGG + Intergenic
1088539593 11:110899828-110899850 CCCTGTAATGGCAGCCTCCTTGG + Intergenic
1089883810 11:121800429-121800451 CCCTGTGATGCCACATTCCAGGG + Intergenic
1090499743 11:127249811-127249833 GCAGGTCCTGGCATCTTCCAGGG - Intergenic
1092534203 12:9372460-9372482 CACTGTCTTGTAATCTTCCATGG + Intergenic
1092667197 12:10815876-10815898 CCCTGGGCTGGCTTCTTCCATGG + Intergenic
1104580399 12:130007264-130007286 CCAACTCATGGCATCATCCAAGG - Intergenic
1105843125 13:24272588-24272610 CCCTGACATGGCGTCCTCCTGGG - Intronic
1106023967 13:25940137-25940159 GCCTGTCACAGCAGCTTCCAGGG + Intronic
1109029542 13:57175645-57175667 ACCTGGCATGCCATCTGCCAGGG + Intergenic
1109696769 13:65971395-65971417 CCCTGTTATGGCATTTTGTATGG + Intergenic
1117207309 14:53457002-53457024 CCATCTCATTTCATCTTCCAGGG + Intergenic
1119396400 14:74329322-74329344 GCCTGCAGTGGCATCTTCCAGGG + Intronic
1121636734 14:95458726-95458748 CCCTGTTATTTCATCTCCCAGGG + Intronic
1121652494 14:95569621-95569643 CACTTTCATGGCATTTCCCAGGG + Intergenic
1121827335 14:97021118-97021140 CCCTGTCACTGCATCTACCACGG - Intergenic
1122272798 14:100575869-100575891 CCCTGGGATGGAATCCTCCAGGG + Intronic
1202903010 14_GL000194v1_random:53966-53988 TCCTTTCATGGCGTCTTCCCAGG - Intergenic
1124650547 15:31470554-31470576 CCCTTCCCTGCCATCTTCCAAGG - Intergenic
1124991617 15:34680038-34680060 CACTTTCATAGCCTCTTCCAAGG - Intergenic
1126946833 15:53830916-53830938 CCCTGACTTGGAATTTTCCATGG - Intergenic
1126969925 15:54099289-54099311 CCCTGACCTGGCTTTTTCCATGG - Intronic
1130862095 15:87900272-87900294 CCCTTTCCTGGCATTTCCCAGGG - Intronic
1131546330 15:93319099-93319121 CCCTGTTCTGGAATCCTCCATGG + Intergenic
1132531876 16:455347-455369 GCCTGTCATGCCATCTACAAAGG + Intronic
1136725610 16:32354898-32354920 CCCTCTCATGATATCTTCCATGG - Intergenic
1138864025 16:60794631-60794653 TTCTGTCTTGGTATCTTCCAGGG + Intergenic
1139426702 16:66885030-66885052 CCTTGTCACCTCATCTTCCAGGG - Exonic
1141001332 16:80311288-80311310 CACAGTCATGACATCTTACATGG - Intergenic
1141267725 16:82512065-82512087 CCCTGTGATGACATATTACATGG - Intergenic
1203000821 16_KI270728v1_random:162856-162878 CCCCCTCATGATATCTTCCATGG + Intergenic
1203132423 16_KI270728v1_random:1699261-1699283 CCCTCTCATGATATCTTCCATGG + Intergenic
1143524109 17:7462569-7462591 CCCTGTCATTGCCTATTCCAAGG - Exonic
1143691064 17:8566446-8566468 CCATGTCATGGCAACATTCAAGG + Intronic
1143768013 17:9150326-9150348 CCCTGTTCTGGAACCTTCCATGG - Intronic
1144573511 17:16415422-16415444 CCCATCCATGGCAGCTTCCATGG + Intergenic
1144742291 17:17590837-17590859 GCCTGTCCTGGCATCTCCCCAGG - Intronic
1146100123 17:29972868-29972890 CCCTGTCAGGGTATCTATCATGG - Intronic
1149345305 17:55728508-55728530 GACTGCTATGGCATCTTCCACGG - Intronic
1152491231 17:80635933-80635955 CCCTGTTTTGGCTTCCTCCATGG - Intronic
1152655231 17:81516291-81516313 CCCTAACCTGGCATCTTACACGG - Intronic
1152720977 17:81923739-81923761 CCCTGTGTGTGCATCTTCCAGGG + Intronic
1156036590 18:32772033-32772055 ACCTGTAATTGCACCTTCCAGGG + Exonic
1159795046 18:72831877-72831899 CCCTTTCATGCCTTCTTCCTAGG + Intronic
1160185695 18:76674751-76674773 CCCTGTGATGGCCTCCTGCAGGG - Intergenic
1160774236 19:847820-847842 ATCTGTGATGGCATCATCCAAGG + Exonic
1162821588 19:13226595-13226617 CCCTGTCCTGGAATCTCCCTTGG - Intronic
1163846381 19:19640498-19640520 CCAGGTCTTGGCATATTCCAGGG + Exonic
1164861518 19:31565651-31565673 CCCAGGCATGGCAGCTTCCATGG - Intergenic
1165717614 19:38056464-38056486 CCCTTCCATGCCATCTTCCTTGG + Intronic
1168246642 19:55115950-55115972 CCCTGTCATGGCATCTTCCAGGG - Intronic
925425777 2:3747843-3747865 CCCTGGCATGGCATTTATCAGGG - Intronic
925491968 2:4405204-4405226 CAGTGTCATGGCTTCTTTCAAGG + Intergenic
925567135 2:5268654-5268676 CTCTGTCATGGCATCTTCTTAGG - Intergenic
930033272 2:47070881-47070903 CACAGCCATGGCATCTCCCAAGG + Intronic
930780546 2:55221248-55221270 CACTGTCAAGGCATCTTCCGGGG + Intronic
931301242 2:60980457-60980479 ACCTGTGATGGCAGCTTCCCTGG + Intronic
934320278 2:91965668-91965690 CCTTCTCATGATATCTTCCATGG + Intergenic
937111795 2:119372251-119372273 AGCTTTCATGGCATCTTCCTTGG - Exonic
938924997 2:136030851-136030873 CCCTGTCATTGCATCCTCATGGG + Intergenic
941977786 2:171424424-171424446 CCCTGTCCTGGCTGCTTTCATGG - Intronic
942424731 2:175847618-175847640 CCCTGTCCTGGCATAATCCTGGG - Intergenic
947375101 2:229487958-229487980 CACTGACATGGCATCTTCAAAGG + Intronic
948965899 2:241380146-241380168 CACTGTCATGGCGTCTTCACTGG - Intronic
949050276 2:241894263-241894285 CCCTGTCTGGGCATCTCCCTGGG + Exonic
1169875737 20:10295177-10295199 CCCTGTCTCGGCATGTTTCAAGG + Intronic
1170593260 20:17787147-17787169 CGCTTTCCTGGCATCTTCCCAGG - Intergenic
1171399759 20:24865271-24865293 CCATGTGATGCCCTCTTCCATGG - Intergenic
1171415453 20:24977082-24977104 CACTGTTATGGTATCTTACAGGG - Intronic
1173454533 20:43191709-43191731 CCCAGTCATGGCAGATCCCAGGG + Intergenic
1176622373 21:9068733-9068755 TCCTTTCATGGCGTCTTCCCAGG - Intergenic
1178042470 21:28654559-28654581 CTCTGTCCTGGCAAGTTCCACGG - Intergenic
1178781036 21:35603641-35603663 CCCTGTTATGTCACCTGCCAGGG - Intronic
1179034627 21:37748841-37748863 CCTTGTCATTGCAGCTTCCTGGG - Intronic
1182212174 22:28685809-28685831 CCCTCTCATGATATCTTCCATGG - Intergenic
1182398579 22:30056119-30056141 CCAACTCATGGCTTCTTCCATGG + Intergenic
1184189059 22:42882811-42882833 CCCTGGCAGGGCAGCTTCCTAGG - Intronic
1184393431 22:44218752-44218774 CCCTCACACGGCAGCTTCCAAGG + Intronic
1184639415 22:45861335-45861357 CCCTGTCAGGAAACCTTCCAAGG + Intergenic
1185341185 22:50291843-50291865 CCCTGCCATGGCAGGTGCCAAGG + Intronic
949869934 3:8579939-8579961 GCCTCTCATGGCAGCATCCAAGG + Intergenic
954320768 3:49830715-49830737 CCCTCTCCTGGCATTTTCCCTGG + Intronic
956878984 3:73491296-73491318 CCCTTTCATGGCCTCCCCCATGG + Intronic
958048775 3:88318811-88318833 CCCATTGATGGCATCTGCCAGGG - Intergenic
958467458 3:94474702-94474724 CCCTGTGTTGACATTTTCCAAGG + Intergenic
958829153 3:99066680-99066702 CTCTTTCATGGCATCTTCCCAGG + Intergenic
961110449 3:124279001-124279023 CCCTGTCCTGGCATCTCCTCAGG + Intronic
961424180 3:126831931-126831953 CACTGTCTTGGGATCTTCCCTGG + Intronic
962317005 3:134365158-134365180 CCCTGCCATGGTACCTTCCTGGG + Intronic
962591450 3:136893745-136893767 CCAAGTCTTGACATCTTCCATGG + Intronic
963534609 3:146512298-146512320 CCCTAGCTTGGCATCTTGCATGG + Intergenic
966036153 3:175418608-175418630 GGCTGGCATGCCATCTTCCACGG - Intronic
967015925 3:185481545-185481567 TCCTATGATGGCATCATCCAGGG - Intronic
969499567 4:7544543-7544565 CCCTGCCATTGCAGATTCCAGGG + Intronic
969545030 4:7820410-7820432 CTCTGTCTTGCCATCTTCCCTGG - Intronic
970216294 4:13762274-13762296 CCCTGTCATGCCTGCTTCCCAGG - Intergenic
971546328 4:27891408-27891430 CCCCGTCCTGGCTTCTTTCATGG - Intergenic
973626874 4:52781650-52781672 CTCTGTCATGGTACCTTGCATGG + Intergenic
974054577 4:56972578-56972600 AACTGTCATGTCACCTTCCAAGG - Intronic
977600515 4:98929493-98929515 CCCTGTCCTCCCATCTTCCCCGG + Intronic
978514683 4:109557829-109557851 CCCTGGCATGGCATCCACTAGGG + Intergenic
978676528 4:111325646-111325668 CCCTGCCATGCCCTCTTCCCTGG + Intergenic
980469653 4:133234445-133234467 CCCTGTTATGGCCTCTGCCTAGG + Intergenic
982445072 4:155481366-155481388 CTATGTCATGCCATCTTCCAAGG + Intergenic
986069135 5:4265244-4265266 CCCTGTCATGCTGTCATCCAGGG + Intergenic
986632300 5:9785376-9785398 TCCTGCCAAGCCATCTTCCAAGG + Intergenic
986759957 5:10870819-10870841 CCCTATCCTGTCATCTTCCTAGG - Intergenic
986772682 5:10988109-10988131 ACCTGTCATGGCATCTTTCCTGG + Exonic
987362843 5:17122281-17122303 CCCTGTCATAGCCTGGTCCACGG - Intronic
988552697 5:32210997-32211019 CACTGACATGGCGGCTTCCATGG - Intergenic
989998360 5:50862643-50862665 CCCTGCCATGGCTTGTTCCCTGG + Intergenic
990770985 5:59244891-59244913 ACCTGTCATTGCAGCTTCCAGGG - Intronic
994553217 5:101262561-101262583 CCCTCTCCTGGCTTCTTTCACGG - Intergenic
995242750 5:109903415-109903437 CCCTGCCATGGAAACTTTCAAGG + Intergenic
997673229 5:135693730-135693752 ACCTGTCTGGGCATCTGCCATGG + Intergenic
999334180 5:150700860-150700882 CCCTGTCCTGCCAGCTTGCAAGG + Intronic
999699147 5:154212167-154212189 CCCTGTCAAGCCATCTCTCATGG - Intronic
1000200021 5:158998976-158998998 CTCTGTCATGGAAGCTTCAAAGG + Intronic
1001333163 5:170776621-170776643 CCCTGGCTTGGCATTTTCCCCGG - Intronic
1001383401 5:171318452-171318474 CCCTCTCTTGGCGTCTTCCCCGG - Intergenic
1001553456 5:172620668-172620690 CCCTGCCATGGCAGCAGCCAGGG - Intergenic
1004411714 6:15387215-15387237 CACTGTCTTGGCATCCTCAAGGG - Intronic
1004560189 6:16742437-16742459 CCCTGCCCTGGCAGGTTCCAAGG - Intronic
1005225630 6:23638811-23638833 CCCTGACATGACATTCTCCATGG - Intergenic
1006152523 6:31997020-31997042 ACCCGTCAGGGCAGCTTCCAAGG + Exonic
1006158829 6:32029757-32029779 ACCCGTCAGGGCAGCTTCCAAGG + Exonic
1007115097 6:39337719-39337741 CCCTATCCTGTCATCTCCCATGG + Intronic
1010029672 6:71259919-71259941 CCCCTTCATGGCATCCTCTAGGG + Intergenic
1010735265 6:79436950-79436972 AGCTTTCATGGCATCTTCCTTGG + Intergenic
1013316598 6:108949046-108949068 AAATGTCATGGCATCTTCTAAGG - Intronic
1014700352 6:124679197-124679219 CCAAGACATGGCTTCTTCCAGGG - Intronic
1016357648 6:143235561-143235583 CCCTGGCATGCCATGTTCCCAGG + Intronic
1017983472 6:159422583-159422605 CCCAGCAATGGCATCTTCCAAGG - Intergenic
1018646040 6:165949354-165949376 CCCTTCCAGGGCATCTGCCATGG - Intronic
1018824530 6:167399122-167399144 CCCTGCCCCTGCATCTTCCACGG - Intergenic
1019164686 6:170090185-170090207 CTCTGTCATGACGTCTGCCATGG + Intergenic
1019519356 7:1453712-1453734 CCGAGACATGGCATCCTCCAGGG + Intronic
1019622093 7:1997624-1997646 CAGTGTCATGGCTTCTTCCCGGG - Intronic
1020150691 7:5679668-5679690 CCCTGTCATGGAATCTCCCATGG + Intronic
1021678856 7:23108635-23108657 CCATGCCATGCCATCTTCTAAGG + Intronic
1026787760 7:73312773-73312795 CCCTATCATTACATGTTCCAGGG + Exonic
1028605732 7:92653453-92653475 CTATGTCTTGGCATCTTCAAAGG - Intronic
1029836395 7:103316543-103316565 CTCTGTCATGGCTTGTTCTAGGG - Intronic
1030213660 7:107021373-107021395 CCCTGTCTTGGCACCTGTCACGG - Intergenic
1030525522 7:110648834-110648856 CTCTGTAGTGGCAACTTCCAGGG - Intergenic
1031451840 7:121930923-121930945 CCTTGTAATGTCATCTTCCATGG - Intronic
1032488358 7:132305451-132305473 CCCTGGCCCGGGATCTTCCAAGG + Intronic
1034475224 7:151277718-151277740 CCATCTCATGGGCTCTTCCAGGG + Intronic
1034702592 7:153109332-153109354 CCCCGTCATCCCATCCTCCATGG + Intergenic
1034954052 7:155322431-155322453 CTCTGGGATGGCACCTTCCAAGG - Intergenic
1036058271 8:5285254-5285276 CATTGTAATGTCATCTTCCAAGG + Intergenic
1036608399 8:10328565-10328587 CCCTGTGTCAGCATCTTCCACGG + Intronic
1037554736 8:20011253-20011275 CCCTCTCCTGGCATTTGCCATGG - Intergenic
1040894182 8:52348881-52348903 CACTGTCTTAGCATTTTCCAAGG + Intronic
1042150526 8:65778394-65778416 CCATCTCATGTCATCTTCCAGGG - Intronic
1044812436 8:96077459-96077481 CCCTGTTATGACATCTTATATGG + Intergenic
1045629999 8:104107804-104107826 CCCTGTGATGGCACATGCCAAGG + Intronic
1045733001 8:105263582-105263604 CACTTTCATGGCATCTCACAAGG - Intronic
1046639091 8:116705512-116705534 CCCTGTCATTGCATTCTCCTGGG - Intronic
1047198292 8:122741378-122741400 CCCAGACATGGCATATTTCAAGG + Intergenic
1049076351 8:140399387-140399409 CCCTGTCCTGGCTGCTTTCATGG - Intronic
1049213132 8:141395791-141395813 TCCTCTCCTGGCATCTTCCCGGG + Intronic
1050183399 9:2944475-2944497 CCCTGTCATGTACTTTTCCAAGG + Intergenic
1050345334 9:4680056-4680078 CCCTTTTATGGCATCTTCGGAGG + Intronic
1054732217 9:68713025-68713047 CACTGCCCTGGCTTCTTCCATGG - Intronic
1056262843 9:84865687-84865709 CCCTGGCATGGCATTTGCCTTGG + Intronic
1056690158 9:88801475-88801497 CCCTCCCATGTAATCTTCCACGG + Intergenic
1059254172 9:112913729-112913751 CCCTGGCAGGCCATCTTCCTAGG - Intergenic
1059471250 9:114505911-114505933 CCCTGACATGACAAATTCCAGGG + Intergenic
1203745570 Un_GL000218v1:39162-39184 TCCTTTCATGGCGTCTTCCCAGG - Intergenic
1203564538 Un_KI270744v1:80321-80343 TCCTTTCATGGCGTCTTCCCAGG + Intergenic
1186906882 X:14120203-14120225 CATTGTCAAGGAATCTTCCAGGG - Intergenic
1187195206 X:17077288-17077310 CCTTTTCATGGCCTCTTCTATGG - Exonic
1188604851 X:32015669-32015691 CCTTATCATAGCAGCTTCCACGG + Intronic
1188796369 X:34471340-34471362 CTCTGTCATGCCATCTTCCAGGG - Intergenic
1189351086 X:40276323-40276345 CCCAGTCTTGGGAACTTCCATGG + Intergenic
1190496810 X:51034225-51034247 CCCCTTCCTGGGATCTTCCAGGG + Intergenic
1190509159 X:51159712-51159734 CCCCTTCCTGGGATCTTCCAGGG - Intergenic
1194245067 X:91500509-91500531 CCCTGTCATGACCTCTGCCCAGG + Intergenic
1200564042 Y:4741819-4741841 CCCTGTCATGACCTCTGCCCAGG + Intergenic
1201158894 Y:11154174-11154196 TCCTTTCATGGCGTCTTCCCAGG - Intergenic
1201187791 Y:11420781-11420803 CCTTCTCATGATATCTTCCATGG + Intergenic