ID: 1168249122

View in Genome Browser
Species Human (GRCh38)
Location 19:55131462-55131484
Sequence GTTTTTGAGGGGCTAGGGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168249122_1168249129 2 Left 1168249122 19:55131462-55131484 CCGTCCCCTAGCCCCTCAAAAAC No data
Right 1168249129 19:55131487-55131509 GAACCTCCTTCCTACTTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168249122 Original CRISPR GTTTTTGAGGGGCTAGGGGA CGG (reversed) Intergenic
No off target data available for this crispr