ID: 1168250008

View in Genome Browser
Species Human (GRCh38)
Location 19:55136628-55136650
Sequence GAGAACATGGAGAAACAGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 690
Summary {0: 1, 1: 0, 2: 3, 3: 41, 4: 645}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168249999_1168250008 20 Left 1168249999 19:55136585-55136607 CCACTCTGGGGTGGTTGAAGTTT 0: 1
1: 0
2: 0
3: 12
4: 129
Right 1168250008 19:55136628-55136650 GAGAACATGGAGAAACAGGCGGG 0: 1
1: 0
2: 3
3: 41
4: 645
1168250001_1168250008 -8 Left 1168250001 19:55136613-55136635 CCACAGCCCAGGCCAGAGAACAT 0: 1
1: 0
2: 1
3: 43
4: 379
Right 1168250008 19:55136628-55136650 GAGAACATGGAGAAACAGGCGGG 0: 1
1: 0
2: 3
3: 41
4: 645

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168250008 Original CRISPR GAGAACATGGAGAAACAGGC GGG Intronic
900317714 1:2067681-2067703 GTGAAGATGGAGAAACAAGCGGG - Intronic
901118268 1:6866937-6866959 GAGATCATGGAGAAGCACACGGG - Intronic
902220847 1:14963821-14963843 GAGAACATGTAGACGCAGGGAGG - Intronic
903478428 1:23636225-23636247 AAGAACATAGAGAAAAAGGATGG + Intronic
904487875 1:30839749-30839771 GCAAACATGCAGAAAGAGGCTGG + Intergenic
904903524 1:33876602-33876624 GAGAAGATGGAGACACAGAGAGG + Intronic
904988627 1:34573442-34573464 GAGAACAGAGAGACACAGACAGG + Intergenic
905035985 1:34918636-34918658 GAGAAAATGGAGAAGTAGGTCGG + Intronic
906073620 1:43035890-43035912 GGAAACCTGGAGAACCAGGCAGG - Intergenic
906258994 1:44372116-44372138 GAGAAAATGGAGACACGGCCGGG + Intergenic
906499849 1:46333652-46333674 GATAAAATGAAGAAACCGGCAGG + Intergenic
906539802 1:46576635-46576657 CAGATCATCGAGAAACAAGCAGG - Exonic
906654635 1:47538862-47538884 GAGAACACGTAGACACAGGGTGG + Intergenic
907715863 1:56925424-56925446 GAGGAAATGGAGACACAGACAGG + Intergenic
907921505 1:58918501-58918523 GACAACATGGACAATCAGCCTGG + Intergenic
908079586 1:60561559-60561581 GAGAACATGTGGACACAGGAAGG - Intergenic
908289616 1:62651246-62651268 GAGAACATGTGGAGACAGGAAGG + Intronic
908450009 1:64244706-64244728 GAGAATATGGAGAGAGAGGATGG - Intronic
908764750 1:67544407-67544429 GATAACATGGAAAAGCAGGTTGG - Intergenic
909294348 1:73927890-73927912 GAGAACAAGGAGACACATGGTGG - Intergenic
909297389 1:73968216-73968238 GAGAACATGTGGACACAGGGAGG + Intergenic
909677537 1:78254533-78254555 GAGAACATGTGGACACAGGGAGG - Intergenic
909800634 1:79803175-79803197 GACAACACGAAGAAACAGCCAGG + Intergenic
912089625 1:106055200-106055222 AAGAAAATGGATAAGCAGGCAGG + Intergenic
912843149 1:113057140-113057162 CAGAACAAGAAGAACCAGGCAGG - Intergenic
912961423 1:114198810-114198832 GAGAAAATGGAGGATCAGACTGG + Intergenic
913084240 1:115420852-115420874 GAGGATATGGAGAAACTGGGTGG - Intergenic
913571084 1:120120563-120120585 AAGAGCATGGAGAAAGGGGCAGG + Intergenic
913959836 1:143330401-143330423 GAGAACACGTAGACACAGGGAGG + Intergenic
914054195 1:144155974-144155996 GAGAACACGTAGACACAGGGAGG + Intergenic
914124951 1:144810387-144810409 GAGAACACGTAGACACAGGGAGG - Intergenic
914291894 1:146281541-146281563 AAGAGCATGGAGAAAGGGGCAGG + Intergenic
914552938 1:148732324-148732346 AAGAGCATGGAGAAAGGGGCAGG + Intergenic
914868499 1:151453214-151453236 GCGAAAAGGGAGAAAGAGGCTGG - Intronic
915046045 1:153018114-153018136 GAGAGCAAGGAAAAGCAGGCTGG + Intergenic
915073714 1:153292678-153292700 AGGAGCATGAAGAAACAGGCAGG + Intergenic
915460979 1:156070526-156070548 GAGAAGAGGGAGGAACAGACGGG - Intergenic
915537400 1:156545319-156545341 GAGAACTTCTGGAAACAGGCTGG - Intronic
915865669 1:159495348-159495370 GAGAGCAAGCAGAAACAGGATGG - Intergenic
915962523 1:160279079-160279101 GAGAATGGGGAGAAACAGCCTGG - Exonic
916364264 1:164006153-164006175 GAGAACATGTGGACACAGGAAGG + Intergenic
916488592 1:165281025-165281047 CAGAACATGGAGAAGTAGTCTGG + Intronic
916525916 1:165609351-165609373 GAGAAAATTGAGAGCCAGGCAGG + Intergenic
916837589 1:168563918-168563940 CAGAACAATGAGAAATAGGCGGG + Intergenic
916928605 1:169550326-169550348 GAGAACATTTAGACACAGGATGG - Intronic
917009142 1:170451211-170451233 AAGGACATGGAGATACAGGGAGG + Intergenic
917015684 1:170528980-170529002 GAGATCATGTAGGAACATGCAGG + Intergenic
917841988 1:178987785-178987807 GAGAACATGTGGACACAGGAAGG - Intergenic
918306658 1:183252553-183252575 GAGGAGATGGAGAAACAGAGAGG + Exonic
919718489 1:200806429-200806451 AAAAATGTGGAGAAACAGGCAGG + Intronic
920092152 1:203462392-203462414 GAGAAGCTGGAGAACCAGGCTGG - Intergenic
920126044 1:203694576-203694598 GTGAACATGGAGAAACTAGTAGG + Intronic
920145904 1:203861048-203861070 CAGAAAATGGAGATACAGGCCGG + Intergenic
920333911 1:205231087-205231109 GGGAGCATGGGGAAACAAGCAGG + Intronic
921145079 1:212347280-212347302 GAAAACTAAGAGAAACAGGCAGG - Intronic
922588448 1:226753697-226753719 GAGAACATGGAGAACAATACAGG + Intergenic
923362433 1:233224900-233224922 GAGAACATATAGACACAGGGAGG + Intronic
923490880 1:234483019-234483041 GTGAAGATGGAGAATTAGGCAGG - Intergenic
923661452 1:235960716-235960738 GATTACATGGAGACACAGGGAGG - Intergenic
924063533 1:240200791-240200813 GAGAACATGGAAAAAGAGTTGGG - Intronic
924263033 1:242251612-242251634 CTGAACATGGAGAAAAGGGCAGG + Intronic
924534344 1:244921561-244921583 GAGAAAGTTGAGATACAGGCAGG + Intergenic
924593568 1:245426227-245426249 GAGCAGATGGAAAAACAGGAAGG - Intronic
1062812413 10:476898-476920 GGGATCCTGGAGAAGCAGGCAGG + Intronic
1062903576 10:1163997-1164019 GAGAATGTGGGGAGACAGGCGGG - Intergenic
1063503128 10:6572424-6572446 GAGAACATGTGGACACAGGGAGG - Intronic
1063538377 10:6907949-6907971 GTAAACCTGGAGAGACAGGCAGG - Intergenic
1063859453 10:10291846-10291868 GAGAACATGTGGACACAGGGAGG + Intergenic
1064226494 10:13490480-13490502 GAGAGCATGGAGAGACATTCAGG - Intronic
1064525485 10:16251459-16251481 TAGAATATGGAGAATCAGCCAGG + Intergenic
1064710634 10:18120619-18120641 GAGAACATGTGGACACAGGAAGG - Intergenic
1064724850 10:18268638-18268660 GAGATTATAGAGGAACAGGCAGG + Intronic
1064785958 10:18894709-18894731 GAGAACATGCAGACCCAGGGAGG + Intergenic
1064833729 10:19501382-19501404 GAGAACCCAGAGAAACAGCCTGG + Intronic
1064870500 10:19931678-19931700 GACAACATTGATAAACAAGCTGG - Intronic
1065141318 10:22720900-22720922 GAGAAGATGGAGTAAAAAGCAGG + Intergenic
1065193687 10:23239661-23239683 GAGAACAGAAAGAAACAGACAGG + Intronic
1066013089 10:31212132-31212154 GACAACATGGATGAACAGGAAGG - Intergenic
1066721752 10:38346837-38346859 CCGAACATGGAGAAAAGGGCAGG - Intergenic
1066965299 10:42258403-42258425 GAGGATATGGAGAAATAGGAAGG - Intergenic
1069348452 10:67497561-67497583 GAGGACGTGGAGAAATAGGAAGG - Intronic
1069846495 10:71375697-71375719 AAGGAAATGGAGAATCAGGCAGG + Intergenic
1070320215 10:75348977-75348999 GAGAAAAAAGAGAAACAGGAAGG - Intergenic
1073025285 10:100482968-100482990 GAGGAATTGGGGAAACAGGCTGG - Exonic
1073514798 10:104066676-104066698 GAGATCAGGGAGTAACAGGAAGG + Intronic
1073588094 10:104730541-104730563 GAAAACATGGAGAGAAAAGCGGG - Intronic
1073801064 10:107042401-107042423 GGGAACATCTAGAATCAGGCTGG + Intronic
1074618274 10:115092783-115092805 GAGAAAAAGAAGAAATAGGCAGG + Intergenic
1074731012 10:116375485-116375507 GAGAACATGTGGACACAGGGAGG - Intronic
1075060682 10:119254756-119254778 AAAAAAATGGAAAAACAGGCCGG + Intronic
1075202629 10:120418543-120418565 GATGATGTGGAGAAACAGGCAGG - Intergenic
1077055505 11:590472-590494 GACAACAGGAAGAAACAGTCAGG + Intronic
1077108817 11:853259-853281 GAGAACATGGAGGCAAAGGTGGG - Intronic
1077391119 11:2301072-2301094 GAGAACCAGGAGAACCAGGAGGG - Intronic
1077801615 11:5544718-5544740 GCGAGGATGGAGAAAAAGGCAGG + Exonic
1078095674 11:8295228-8295250 GAGAGCATGGGGAAGCAGCCGGG + Intergenic
1078159773 11:8830692-8830714 GAAAGCAGGGAGGAACAGGCGGG - Intronic
1078201433 11:9187523-9187545 GATAGACTGGAGAAACAGGCTGG - Intronic
1079264794 11:18920943-18920965 GAGAGCAAGGAGAAGCAGGGTGG + Intergenic
1079266969 11:18943090-18943112 GAGAGCAAGGAGAAGCAGGGTGG + Intergenic
1079382461 11:19949898-19949920 GAGCACACAGAGAAACAGGGAGG - Intronic
1079804778 11:24916524-24916546 GAGAACATGTGGACACAGGAAGG - Intronic
1080184749 11:29468709-29468731 GAGAACATGTAAACACAGGGAGG - Intergenic
1080440172 11:32286751-32286773 GAGACCATGGAGAAGCAAACAGG + Intergenic
1081320710 11:41688786-41688808 GAGAACATGTGGACACAGGAAGG + Intergenic
1081477531 11:43449238-43449260 GAGAGGATGAAAAAACAGGCAGG - Intronic
1082207566 11:49456119-49456141 AAGAATCTGGAGGAACAGGCTGG - Intergenic
1082593427 11:55043922-55043944 GAGAACACATAGAAACAGGAAGG - Intergenic
1082713109 11:56578642-56578664 GTGTACATGAATAAACAGGCAGG - Intergenic
1082720203 11:56665013-56665035 AAAAACATGGAGAATGAGGCTGG + Intergenic
1082863055 11:57873614-57873636 GAGAAATTGAAGATACAGGCTGG - Intergenic
1082875763 11:57986689-57986711 GAGAACACGTGGACACAGGCAGG - Intergenic
1083518328 11:63282400-63282422 GAGAACATGTGGACACAGGAAGG - Intronic
1083847809 11:65346165-65346187 GAGAAGATGTAGCCACAGGCAGG + Intronic
1083908417 11:65689762-65689784 GAGTAAATGGAGAATCAGACAGG + Intergenic
1084595456 11:70114178-70114200 TTAAAGATGGAGAAACAGGCTGG + Intronic
1085146060 11:74198746-74198768 GAGAAAATGAAGAGCCAGGCTGG - Intronic
1085802813 11:79606513-79606535 GAGAACATGTGGACACAGGGAGG - Intergenic
1085972842 11:81613640-81613662 TCAAAAATGGAGAAACAGGCTGG + Intergenic
1086047339 11:82548363-82548385 GAGAACATGTGGACACAGGGAGG - Intergenic
1086647710 11:89245624-89245646 AAGAATCTGGAGGAACAGGCTGG + Intronic
1086809582 11:91291180-91291202 GAGAACATATAGACACAGGGAGG - Intergenic
1087326463 11:96728988-96729010 GAGAACATGTGGACACAGGGAGG + Intergenic
1087504662 11:99003985-99004007 GAGAACATGTGGACACAGGTTGG - Intergenic
1087545033 11:99574095-99574117 GAGAACATGTGGACACAGGGAGG - Intronic
1087712764 11:101572809-101572831 GAGAACATATGGACACAGGCAGG + Intronic
1087937078 11:104046930-104046952 GAGAACATGTAGACACAGGGAGG - Intronic
1088086259 11:105984267-105984289 GAGAAAATGGACAAGGAGGCAGG - Intergenic
1088572328 11:111234476-111234498 GAGAACATAGAGCAAGGGGCTGG + Intergenic
1088950882 11:114568637-114568659 GAGAAGTTAGAGAAACAAGCAGG - Intergenic
1089020870 11:115213191-115213213 GAGCACATGCAGAAAAAGGGAGG + Intronic
1090149075 11:124362883-124362905 GAGGACGTGGAGAAATAGGAAGG + Intergenic
1090402679 11:126458986-126459008 GAGAACATGGACACTCAGGGAGG + Intronic
1090583652 11:128186878-128186900 GAGAACATGTGGACACAGGGAGG + Intergenic
1090871248 11:130750538-130750560 GAGAAGATAGAGATACATGCAGG + Intergenic
1091168895 11:133503329-133503351 GAGAAGATTTAGAAACATGCAGG + Intronic
1091337143 11:134780705-134780727 GAGAAGAAGGAGAAAGAGGAGGG - Intergenic
1091439643 12:502539-502561 AAGAGAAAGGAGAAACAGGCGGG + Intronic
1091938146 12:4449962-4449984 GAGAACAGGGAGATCCACGCAGG - Intergenic
1091966279 12:4745071-4745093 GAGAATGTGGAGAATCAGACAGG + Intronic
1093086393 12:14870031-14870053 GAGAACATAGAAAAGCAGGGTGG - Intronic
1095111481 12:38298926-38298948 AAGAACATAGAGTAGCAGGCTGG + Intergenic
1095187139 12:39213682-39213704 GAGAACATGTGGACACAGGGCGG + Intergenic
1095244832 12:39907804-39907826 GAGAAAGTGGAGAATCAGGCAGG - Intronic
1096571998 12:52528849-52528871 GAGCAGATTGAGAAACTGGCTGG - Intergenic
1096612008 12:52808289-52808311 GAGAACATCAAGAAGCAGGTGGG - Exonic
1097075158 12:56387581-56387603 GAGGACATGAAGACAAAGGCAGG + Intergenic
1100024344 12:90109484-90109506 GACACCATGGAGAAACATACAGG - Intergenic
1100448618 12:94684132-94684154 GAGAAAATGCAGACACAGGAAGG - Intergenic
1100626959 12:96345018-96345040 GAGAACATATGGAAACAGGGAGG - Intronic
1100956011 12:99909150-99909172 GAGAACATGGATAAACCTGGAGG - Intronic
1102021444 12:109686234-109686256 GAGGACATGGAGAACCAGAAAGG - Intergenic
1102105089 12:110314399-110314421 GAGAGAATGGGGAAACAGGAGGG + Intronic
1102814915 12:115858038-115858060 GAGAACAGGGAGAAAGTTGCTGG - Intergenic
1103130552 12:118464786-118464808 TAGAACAAGGAGACACAGGAAGG + Intergenic
1103767542 12:123291759-123291781 GGGAAAAGGGAGAAACAGGTGGG + Exonic
1104392761 12:128404938-128404960 AAGAAAATGGATAAACAGGAAGG + Intronic
1104456531 12:128918260-128918282 GAGAACATGTGGACACAGGGAGG + Intronic
1105863015 13:24433483-24433505 GAGAACATGGAGGCACAGAAAGG + Intronic
1106248246 13:27966430-27966452 GAGGAAATGGAGAATCAGACCGG + Intronic
1106287277 13:28328874-28328896 GGGATGATGGAGAAGCAGGCGGG + Intronic
1106317019 13:28603320-28603342 GAGAACATGGAGGATCTTGCAGG - Intergenic
1106343682 13:28855464-28855486 GAGAACATACAGACACAGGGAGG - Intronic
1107314310 13:39114626-39114648 GAGATCATGGAGAAATAGGAAGG - Intergenic
1107333973 13:39333728-39333750 GAGGATATGGAGAAATAGGAAGG + Intergenic
1108063104 13:46552834-46552856 GAGAACACGGATAAAACGGCGGG - Intergenic
1108150556 13:47529258-47529280 GAGAACATGTAAGAACAGACAGG + Intergenic
1108173033 13:47762917-47762939 GATAACATGGACACACAGGAAGG - Intergenic
1108393901 13:49974438-49974460 TTAAAGATGGAGAAACAGGCCGG - Intergenic
1109022277 13:57113154-57113176 GAGAACATGTGGACACAGGGAGG + Intergenic
1109290075 13:60463207-60463229 GCGAACATGGTGAAACATGGTGG + Intronic
1109839190 13:67900952-67900974 GAGAATGTGGAGAAATAGGAAGG + Intergenic
1111289491 13:86145612-86145634 GAGAACACGTGGAAACAGGGAGG + Intergenic
1111387647 13:87548098-87548120 AAGAAAATGGAGAAACGGCCAGG + Intergenic
1111739730 13:92188929-92188951 TAAAACTTGGAGAGACAGGCAGG + Intronic
1112353099 13:98653122-98653144 GAGAAAATTGAGAAACAGAGAGG + Intergenic
1113158104 13:107348633-107348655 GAGAACATGTGGACACAGGGAGG - Intronic
1113189563 13:107728483-107728505 GAGAACATGTGGACACAGGGAGG + Intronic
1113338395 13:109398896-109398918 GAGAACACATAGAAACAGGGAGG + Intergenic
1115043511 14:28960059-28960081 GAGAACATATGGACACAGGCAGG + Intergenic
1116372113 14:44149668-44149690 GAGGCCCTGGAGAAACAGGCAGG - Intergenic
1116822051 14:49635337-49635359 GAGATCATGGTGGAATAGGCCGG + Intergenic
1117213168 14:53522721-53522743 GAGAACACGGGGACACAGGGAGG + Intergenic
1117628761 14:57667524-57667546 GAGAACATGTGGACACAGGAAGG - Intronic
1117634784 14:57730286-57730308 GAGAAGATGGAGAAAGATGGTGG - Intronic
1117635062 14:57734129-57734151 GGGAACATTGAGATATAGGCTGG + Intronic
1118359217 14:65042056-65042078 GAGAACATTTATAAACAGCCTGG + Intronic
1118780874 14:69006676-69006698 GAGAACACTGAGGCACAGGCAGG - Intergenic
1118821751 14:69350480-69350502 AAGAGCATGAAGAAACAGGAGGG + Intronic
1119070290 14:71576446-71576468 GACAGCATGGTGCAACAGGCAGG + Intronic
1119351957 14:73973203-73973225 GCGGCCATGGAGAAACAGACTGG - Intronic
1119528287 14:75340754-75340776 AAGTACATTGAGAAACAGGATGG - Intergenic
1120463905 14:84831531-84831553 GAGAACACAGAAAAAGAGGCTGG - Intergenic
1120576810 14:86192204-86192226 GAGAACCAGGAGAATCAAGCAGG + Intergenic
1120579057 14:86223587-86223609 GAGAACATGGACCAGTAGGCTGG + Intergenic
1120845341 14:89120140-89120162 GAGTGCCTGGAGAACCAGGCTGG - Intergenic
1121092377 14:91191564-91191586 GGGAACAGGGAGAATGAGGCTGG - Intronic
1122195890 14:100085448-100085470 AGGGACATGGAGAAATAGGCTGG + Intronic
1122858703 14:104572444-104572466 GAGAGCATTGAGGGACAGGCTGG - Intronic
1123175046 14:106409073-106409095 GAGAACATGTGGACACAGGGTGG + Intergenic
1123201831 14:106673600-106673622 GAGAACATGTGGACACAGGGTGG + Intergenic
1202943639 14_KI270726v1_random:6704-6726 GAGAACATGTGGACACAGGGTGG - Intergenic
1123801531 15:23826149-23826171 CAAAATATGGAGAGACAGGCAGG - Intergenic
1123825975 15:24082511-24082533 AAGAATTTGGAAAAACAGGCTGG - Intergenic
1124114227 15:26826201-26826223 GAGAAAATGTAAAAAGAGGCTGG - Intronic
1124169966 15:27363856-27363878 GAGCAAATGGAGAGACAGACAGG + Intronic
1124982757 15:34580878-34580900 AGGAACATGGAGACACAGGTAGG - Intronic
1125072764 15:35575246-35575268 GAAAACAGGGAGAAAAAGACAGG - Intergenic
1125382725 15:39104289-39104311 GAGAACTTAGAGAGACAGGGAGG - Intergenic
1126550754 15:49926598-49926620 GAGAACATGGTAAAACAGACTGG - Intronic
1126715440 15:51511552-51511574 GAGGATGTGGAGAAACAGGAAGG + Intronic
1127349588 15:58137185-58137207 GAGGACATGGAGAAAGCAGCTGG - Intronic
1127496149 15:59514027-59514049 GAGAACATGTGGACACAGGGAGG + Intronic
1127628879 15:60806803-60806825 GACAAAAAGGAGAAAAAGGCAGG + Intronic
1128577751 15:68787997-68788019 GAGAACAGGGAGACAGACGCAGG + Intronic
1129272337 15:74425757-74425779 GAGCACATGGAGGAACTGGGAGG - Intronic
1130288306 15:82573403-82573425 GTGAACATAGAGAAGCAGGAGGG - Intronic
1130686774 15:86044608-86044630 GAGAAAATGGAGAAACAGAGAGG + Intergenic
1130781743 15:87047090-87047112 GAGCACATGGAGATACAGAGTGG + Intergenic
1131052164 15:89355855-89355877 GAAAACATATAGAAACATGCTGG + Intergenic
1131191247 15:90318678-90318700 AAGAATCTGGAGAGACAGGCTGG - Intergenic
1131416016 15:92258584-92258606 GAGAACATGTGGACACAGGGAGG + Intergenic
1131827307 15:96331753-96331775 CAGAACGTGGAGAAAGAGGGAGG - Exonic
1132134398 15:99320618-99320640 AAGAGCATGGAGAAATATGCTGG + Intronic
1133013129 16:2925715-2925737 GACGGCATGGAGGAACAGGCTGG + Intronic
1133491229 16:6271125-6271147 AAGAACATAGAAAAAGAGGCCGG + Intronic
1134850928 16:17478295-17478317 TAGGACAAGGGGAAACAGGCTGG + Intergenic
1135516837 16:23142988-23143010 GAGTGCATGGAAAAGCAGGCTGG + Intronic
1135673516 16:24394726-24394748 AAGGACATGGAGAGACAGCCAGG + Intergenic
1135988318 16:27201234-27201256 GAGAACACGTAGACACAGGGAGG + Intergenic
1136618485 16:31412805-31412827 GAGAAAAGGGTGAATCAGGCTGG - Intronic
1138162401 16:54766750-54766772 GAGAACATGTGGAAACATGCAGG + Intergenic
1138875435 16:60942973-60942995 GAGAACACGTAGACACAGGAAGG + Intergenic
1139171826 16:64639855-64639877 GAGAACATGTGGACACAGGGAGG - Intergenic
1139424494 16:66870964-66870986 GAGAACCTGCAGAAGAAGGCCGG + Intronic
1139494507 16:67306554-67306576 GAGAAAATGGAGAGGCAGGACGG - Intronic
1139718713 16:68835613-68835635 CAAAACGTGGAGAAAGAGGCCGG + Intergenic
1140703966 16:77608817-77608839 GAGAAAATGGAAAAACAAACTGG + Intergenic
1140721798 16:77778936-77778958 TAGAAAATGAAGCAACAGGCCGG + Intergenic
1140868376 16:79084098-79084120 GAAACCAGGGAGAAACAGGAAGG + Intronic
1141147078 16:81538481-81538503 AAGAACATGGAGACACAGGCTGG - Intronic
1141585609 16:85031583-85031605 ATGAAGCTGGAGAAACAGGCAGG - Intronic
1141747347 16:85934456-85934478 GAGGGCAGTGAGAAACAGGCCGG + Intergenic
1142174487 16:88638964-88638986 GAGGAGCTGGTGAAACAGGCAGG - Exonic
1143661513 17:8327237-8327259 GAGAACCAGGAGACACAGCCAGG - Intergenic
1143729659 17:8874011-8874033 CAGAACAGAGAGAAACAAGCTGG + Intergenic
1144818561 17:18054522-18054544 CAGAAGATGGACAAACAGGTGGG - Intronic
1145081375 17:19897293-19897315 GAAGACTTGGAGAAACAGGCAGG + Intergenic
1145255826 17:21321850-21321872 GAGAACGTGGAGAATCAGAGAGG - Intergenic
1145320792 17:21766096-21766118 GAGAACGTGGAGAAGCAGAGAGG + Intergenic
1145994957 17:29099831-29099853 GAGGAACTGGAGAAACAAGCAGG + Intronic
1146313882 17:31792221-31792243 GAGAACTGGAAAAAACAGGCAGG - Intergenic
1146463260 17:33064957-33064979 GAGAACATGGAGTTACAGAGAGG + Intronic
1147343729 17:39772581-39772603 GAGAACAAGAAGAAACAGGAAGG + Intronic
1147489684 17:40853853-40853875 GAGAACATGTGGACACAGGGAGG + Intergenic
1147556143 17:41480431-41480453 GAGAACACTGAGATTCAGGCTGG - Intronic
1147743029 17:42679473-42679495 GGGAACACTGAGAAAGAGGCAGG - Exonic
1147846184 17:43405431-43405453 AAGAAAATGAAGAAACTGGCTGG + Intergenic
1147998688 17:44375437-44375459 GTGAACATGGAGGAGCATGCTGG - Intronic
1148783947 17:50136097-50136119 GAGCGCATGGAGAAACTGGAAGG - Exonic
1149090665 17:52774338-52774360 GAGAACATTCAGACACAGGGTGG - Intergenic
1149768124 17:59297498-59297520 GATAACACAGAGAAACAAGCAGG - Intergenic
1150625671 17:66839649-66839671 GAGAAAATGGAGGAACATGGAGG + Intronic
1150939106 17:69670816-69670838 GAGAACATGTGGACACAGGGAGG - Intergenic
1151393034 17:73800686-73800708 GAGAACATGGAGAAACCGCCAGG + Intergenic
1152046413 17:77939143-77939165 GTGAACATGAAGACACAGGGAGG + Intergenic
1153696898 18:7652704-7652726 GAGAACATATGGACACAGGCAGG + Intronic
1154139612 18:11811319-11811341 GAGGACATGGTGAAAGAGGCTGG - Intronic
1155012663 18:21796344-21796366 GAGAACATGTGGACACAGGGAGG + Intronic
1155172806 18:23279617-23279639 GACAACATGAAGACACAGGGAGG + Intronic
1155642213 18:28031709-28031731 GAGAACTTGGAAAGCCAGGCAGG + Intronic
1155766174 18:29635750-29635772 GAGAAGATGGAGAAAAGGGAGGG + Intergenic
1156461010 18:37321323-37321345 GAGATCCTGGAGATAGAGGCAGG - Intronic
1156966392 18:43098932-43098954 GATGACATAGAGAAACAGGATGG + Intronic
1157535312 18:48453235-48453257 GAGAAGATCTAGGAACAGGCAGG - Intergenic
1157945368 18:51973411-51973433 GACAACATGAAGAAACAGATGGG + Intergenic
1158428726 18:57363828-57363850 GAGAAAATGGAGAAACAGGGAGG + Exonic
1158912102 18:62074803-62074825 GAGAACAATGAGAAAAAGGCTGG + Exonic
1159900114 18:74037817-74037839 GAGGACATGCAGAAACAAACAGG - Intergenic
1159960865 18:74555042-74555064 GAGAACAAGGGGAACTAGGCTGG - Intronic
1161662794 19:5557640-5557662 GAGAACAGAGAGATAGAGGCAGG + Intergenic
1161664474 19:5566888-5566910 GAGATGAGGGAGAAACAGGGAGG + Intergenic
1162186938 19:8913099-8913121 GAGAACATGTGGACACAGGAAGG + Intronic
1162337355 19:10070231-10070253 GGGAGCATGGAGAGAGAGGCGGG + Intergenic
1163068670 19:14819360-14819382 GAGAACACGGGGACACAGGGAGG - Intronic
1163177748 19:15576326-15576348 GAAACCAAGGAGAAATAGGCAGG + Intergenic
1163786758 19:19278819-19278841 GAGAAGAGGGAGAAGCAGGAAGG + Intronic
1164743309 19:30593160-30593182 GAGAGCAGCGAGAAAGAGGCCGG - Intronic
1165066308 19:33230845-33230867 GAGAACAGGGAAAATGAGGCAGG - Intergenic
1165534660 19:36433573-36433595 TAGAAAATAGAGTAACAGGCCGG + Intergenic
1165995176 19:39839006-39839028 GAGTAGATGGAGAGTCAGGCAGG - Intronic
1166331963 19:42083500-42083522 GAGAACATGTGGACACAGGGAGG - Intergenic
1166706416 19:44910411-44910433 GAGAACAGGGAGAGACAGAGGGG - Intergenic
1167682590 19:50933438-50933460 GAGAAAATGAAGAAAGGGGCCGG - Intergenic
1168180223 19:54657296-54657318 GAAAACATGGAGATTCCGGCCGG - Intronic
1168189509 19:54727483-54727505 AAGAACACGGAGACACAGACAGG + Intronic
1168250008 19:55136628-55136650 GAGAACATGGAGAAACAGGCGGG + Intronic
1202693674 1_KI270712v1_random:108653-108675 GAGAACACGTAGACACAGGGAGG + Intergenic
924975058 2:165289-165311 GAGAACACGTGGAAACAGGGAGG + Intergenic
925142978 2:1562623-1562645 GAGGACATGGAGGCACAGGTTGG - Intergenic
925485274 2:4321860-4321882 GAGAACAAGGAGAAAAAGGAAGG - Intergenic
926006809 2:9378945-9378967 GGGAACCTGGATAAACAGACAGG + Exonic
926383221 2:12312039-12312061 GAGGAGTTGGAGAAACAGCCTGG + Intergenic
927100707 2:19785739-19785761 GAGTTCATGGAGAAAAAGTCTGG + Intergenic
927947397 2:27144561-27144583 TAGAAAATAGAAAAACAGGCCGG - Intergenic
928132890 2:28666031-28666053 AAGAACATGTAGACACAGGGAGG - Intergenic
928890571 2:36198881-36198903 GAGAACATGTGGACACAGGAAGG - Intergenic
928975292 2:37080592-37080614 GAGAACATGGGGGAAAGGGCAGG + Intronic
929149800 2:38737369-38737391 TAGAACATGGAAAAAAATGCAGG + Intronic
930391350 2:50765416-50765438 GAGAAGATAGAGAAACACGTAGG - Intronic
930412242 2:51039735-51039757 GAGAACTAGAAGAAAAAGGCAGG - Intergenic
930547024 2:52781216-52781238 GAGAAAATAGAGAAAGGGGCAGG - Intergenic
930748036 2:54904655-54904677 GGGAATGTGGAGACACAGGCTGG + Intronic
930863681 2:56102291-56102313 GATAAAATGAAGAAACTGGCAGG + Intergenic
931216890 2:60253675-60253697 GAGGCCATGGAGAATCAGTCTGG - Intergenic
931455324 2:62405492-62405514 GAGACTTTGGGGAAACAGGCAGG + Intergenic
931852956 2:66271665-66271687 GAGAGAAAGGAGAAACAGGAGGG + Intergenic
932009396 2:67960223-67960245 GAGAACATGGAAAACAGGGCTGG - Intergenic
933100359 2:78248006-78248028 GAGAACATGTGGACACAGGGAGG + Intergenic
933360110 2:81271108-81271130 GAGAACATGTGGACACAGGGAGG + Intergenic
933550041 2:83764875-83764897 GAGAACATATGGACACAGGCAGG - Intergenic
933952892 2:87345926-87345948 GAGAACACGTAGACACAGGGAGG - Intergenic
934114794 2:88777453-88777475 GAGAACATAGGGACACAGGGAGG - Intergenic
934237129 2:90242270-90242292 GAGAACACGTAGACACAGGGAGG - Intergenic
934314736 2:91906842-91906864 GAGGATATGGAGAAATAGGAAGG + Intergenic
934511747 2:94950060-94950082 GAGGATGTGGAGAAACAGGAAGG - Intergenic
934529693 2:95077181-95077203 GAGAGCCTGGTGAAACAGGGAGG + Intergenic
935619633 2:105117501-105117523 GAGAACATGGGTAAATTGGCAGG - Intergenic
935678247 2:105614709-105614731 AAGAATATGCAAAAACAGGCTGG + Intergenic
936346778 2:111681530-111681552 GAGCAGATGGAGAAATAGGAAGG - Intergenic
936351533 2:111716436-111716458 GAGAAAATGGAGAAAGAGAGGGG + Intergenic
936953748 2:118003802-118003824 GAGGACATGGAGGAAAATGCAGG + Intronic
937964393 2:127491388-127491410 GAGAGCATGGAGAAAGAGAGGGG - Intronic
938209317 2:129453606-129453628 GAGAACATATGGAAACAGGGAGG + Intergenic
939319744 2:140603527-140603549 GAGAAGATGTAGAATCAGGATGG - Intronic
939771987 2:146332898-146332920 GAGAACATGTGGACACAGGAAGG - Intergenic
940467947 2:154056966-154056988 GAAAACATTAAGAAAAAGGCAGG + Intronic
941009341 2:160281615-160281637 GAGAAAAAGGCGAAACAGACTGG + Intronic
941510157 2:166397447-166397469 GAGATCATGGAGCATCAGGAAGG + Intergenic
943007529 2:182403784-182403806 GAGAACACATGGAAACAGGCAGG + Intronic
943231686 2:185261681-185261703 GAAAACATTGAGAAACAGTAAGG + Intergenic
944241199 2:197486933-197486955 GAGAAAATGAAGAAAAAGGCTGG - Exonic
946359629 2:219211258-219211280 GAGAAGATGGGGAAACAGAGAGG - Intronic
946416166 2:219540807-219540829 CAGAGAATGTAGAAACAGGCAGG + Intronic
946537121 2:220643170-220643192 GAAAACATGGAGGAAAAGGGAGG + Intergenic
946807995 2:223491421-223491443 GAGAACATATGGAAACAGGGAGG + Intergenic
947805633 2:232966146-232966168 GAGAATATGGAGCAAGAGGTAGG - Intronic
948049102 2:234966080-234966102 GAGAAAGAGGAGAAAGAGGCTGG + Intronic
948389934 2:237604707-237604729 TAGAAAATGGAGAAACGGCCGGG + Intergenic
948640813 2:239375095-239375117 GAGAACACGCAGAGCCAGGCAGG + Intronic
948646021 2:239405546-239405568 GAGAACACGTGGACACAGGCTGG - Intergenic
1169055393 20:2616769-2616791 GAAACCGAGGAGAAACAGGCAGG + Intronic
1169316846 20:4599137-4599159 GAGAACATGTGGACACAGGCAGG - Intergenic
1169527881 20:6450004-6450026 GAGAACATGTGGACACAGGGAGG - Intergenic
1169695148 20:8379141-8379163 GAGAACATGTGGACACAGGGAGG - Intronic
1170088377 20:12562581-12562603 GAGAACATTTGGAAACAGGGAGG + Intergenic
1170873403 20:20229179-20229201 GAGCACATGGAGAGAGAGACTGG - Intronic
1171155960 20:22874358-22874380 GAGAACATGTGGACACAGGGAGG - Intergenic
1171324025 20:24274991-24275013 GGGAATATGGACAAAAAGGCAGG + Intergenic
1172741628 20:37172947-37172969 GAGAAGAAGGAGAAAAATGCAGG - Intronic
1173027245 20:39319887-39319909 GAGAAAATTGAGAAACAGAGAGG + Intergenic
1173397367 20:42691888-42691910 GAGAACATGAGGAAACAGGAAGG + Intronic
1174310601 20:49650998-49651020 TAGAAAATGGAAAAACAAGCCGG + Intronic
1174551904 20:51368240-51368262 GAGAAGATGGAGACAGAGGCTGG - Intergenic
1174654342 20:52157859-52157881 GAGAACATGTGGACACAGGGAGG - Intronic
1174713312 20:52729749-52729771 TAGAAAATGCATAAACAGGCTGG - Intergenic
1175072383 20:56345345-56345367 GAGAACATGGAGAAGCTGAGTGG + Intergenic
1177358548 21:20039376-20039398 GAACACATAGAGACACAGGCAGG - Intergenic
1177540281 21:22483938-22483960 GAGAACACAGTGACACAGGCAGG - Intergenic
1178611820 21:34089312-34089334 GAAAACATGAAATAACAGGCTGG - Intronic
1178929258 21:36803300-36803322 GAGACCATGGAGAAGGAAGCTGG - Intronic
1179129807 21:38624686-38624708 AAGAACATTGAGATACAGGAAGG - Intronic
1180059766 21:45378808-45378830 GAGGCCTTGGAGAAGCAGGCAGG + Intergenic
1180169265 21:46049465-46049487 GAGAAGATGAAGACACGGGCCGG + Intergenic
1180970459 22:19812251-19812273 GAGAACATGGGGCCTCAGGCAGG + Intronic
1181919914 22:26312591-26312613 AAGAATATGGGGAAACTGGCAGG - Intronic
1182285867 22:29246585-29246607 GAGAACCAGGAGAAGCAAGCAGG + Intronic
1182995628 22:34809431-34809453 TGGAACATGGAGAAAGTGGCAGG - Intergenic
1183257335 22:36770968-36770990 AAGAAAAAGGAGAAGCAGGCGGG - Intronic
1183377804 22:37475154-37475176 GGGTACAGGGAGAATCAGGCGGG + Intronic
1183455797 22:37922384-37922406 GAGAACCTGGTGGAGCAGGCTGG + Exonic
1183707215 22:39481475-39481497 GGGAACATGGGGAGACAGGACGG - Intronic
1183847103 22:40551130-40551152 GAGAAAATGTATAAAGAGGCTGG - Intronic
1184050187 22:41998609-41998631 GAGAAAGGGGAGAAAGAGGCGGG - Intergenic
1184259305 22:43305588-43305610 GAGCACAGGGAGAAACAGAAAGG + Intronic
1184268834 22:43365937-43365959 CAGACCATGGAGAGAGAGGCTGG + Intergenic
1185144869 22:49127133-49127155 GAGAACATAGGGACACAGGGAGG + Intergenic
949411248 3:3766807-3766829 GTGAAGATGGATAATCAGGCAGG + Intronic
949728394 3:7077523-7077545 GAGAACATGTTGATACAGGGAGG + Intronic
949935033 3:9109928-9109950 GTGAACATGGAGACTGAGGCAGG + Intronic
950815729 3:15700248-15700270 GAGAACATGTGGACACAGGGAGG + Intronic
950969916 3:17176039-17176061 GAGAACATGGAGAGGCAGCCTGG + Intronic
951411828 3:22375222-22375244 GAGAATATTGAGAAACAAGGAGG - Intergenic
951875207 3:27417246-27417268 ATGAACAGGGAGAACCAGGCAGG + Intronic
952864448 3:37843705-37843727 GAGGACGTGGAGAAATAGGAAGG + Intergenic
953148047 3:40297029-40297051 AAGAACAGGGAGAAAAAGGCAGG - Intergenic
953554726 3:43935065-43935087 GAGGATATGGAGAAATAGGAAGG - Intergenic
953841038 3:46390445-46390467 GAGGCCATGTTGAAACAGGCAGG + Intergenic
954117228 3:48473576-48473598 GAGAACATGGGGAGACAGATTGG - Intronic
954489920 3:50893924-50893946 GAGAACATTGGGACACAGGAAGG + Intronic
954929121 3:54265213-54265235 GAGGATGTGGAGAAACAGGAAGG - Intronic
954993586 3:54861823-54861845 GTGACCATGGAAACACAGGCAGG - Intronic
955109222 3:55931114-55931136 GAGGACATGGAGAAATAGGGAGG + Intronic
955929862 3:64045708-64045730 GAGAAATGGGATAAACAGGCAGG + Intergenic
956698096 3:71935719-71935741 GGGAAGATGCAGAACCAGGCAGG - Intergenic
956811289 3:72866339-72866361 TAGAAGATGGAGAAAGAGGGAGG - Intergenic
957699409 3:83689104-83689126 GAGAACATGTGGACACAGGGAGG - Intergenic
957950481 3:87119855-87119877 AAGAACTTGGACAAATAGGCTGG - Intergenic
957969331 3:87363031-87363053 GAGCACATGGTGAGAGAGGCGGG - Intergenic
957976590 3:87453356-87453378 GAGAACACGTAGACACAGGAAGG - Intergenic
958924117 3:100139142-100139164 GAGAACATGTGGACACAGGGAGG + Intronic
960251445 3:115460041-115460063 GACAACATGCAGAAACAGATTGG - Intergenic
960649651 3:119932811-119932833 GAAAACATGGAAATATAGGCTGG + Intronic
960906516 3:122606984-122607006 GAGAACATGAAGAAAGCAGCCGG - Intronic
961116280 3:124332744-124332766 TAGAACATGCAGAGAAAGGCTGG - Intronic
961323204 3:126092665-126092687 GAGAACGTGGAGAACTAAGCTGG + Intronic
963069613 3:141292133-141292155 CACACCATGGGGAAACAGGCTGG + Intronic
963161052 3:142150471-142150493 GGAAACATGGCGAAACAGCCGGG - Intergenic
963306708 3:143661473-143661495 GAGCACTTGGAGAGACAGGAAGG - Intronic
963819413 3:149871336-149871358 AAGAAAATGTAGTAACAGGCTGG - Intronic
964721887 3:159775522-159775544 GAGAGAAAGGCGAAACAGGCAGG - Intronic
965078702 3:164010261-164010283 GAGAACACACAGAAAAAGGCAGG + Intergenic
965381627 3:167996468-167996490 GAGGACATGAAGAAACCTGCTGG - Intergenic
965688897 3:171334240-171334262 GAGAGCAAGGGCAAACAGGCAGG - Intronic
965849375 3:173005024-173005046 TAGAAAATGTAGAATCAGGCCGG + Intronic
965938951 3:174152447-174152469 GAGAACATTTGGACACAGGCAGG + Intronic
966474938 3:180333843-180333865 GAGAACATACAGACACAGGAAGG + Intergenic
967177025 3:186870282-186870304 GACAAGATGGAGGAAAAGGCAGG - Intergenic
967267170 3:187701042-187701064 CAGAACATGGACACAAAGGCTGG - Intronic
967575324 3:191083111-191083133 TAGAAAATAGAGAAATAGGCTGG + Intergenic
967664799 3:192158294-192158316 GAGAAAAGGGAAAAGCAGGCAGG - Intronic
967974407 3:195024895-195024917 AAGAACATGGAAAACAAGGCCGG - Intergenic
968979307 4:3838098-3838120 GAGAACCTGGTAAAACAGGGAGG - Intergenic
969047295 4:4345671-4345693 GAGAACATGTGGACACAGGGAGG - Intergenic
969969483 4:11031100-11031122 GACAACATGGATAAACATGGAGG + Intergenic
970163981 4:13216829-13216851 GAGAACATGTGGACACAGGGAGG + Intergenic
970947629 4:21713774-21713796 GAGAACATGGGAAAAAAGGCTGG - Intronic
970989704 4:22198507-22198529 GAGAACATGTGGACACAGGGAGG + Intergenic
971278366 4:25219555-25219577 GAGAAGGAGGAGAAACAGGAGGG + Intronic
972637727 4:40899132-40899154 GAGGACATTGAGACACAGACAGG - Intronic
972727741 4:41760234-41760256 GGTATCATGGAGAATCAGGCAGG + Intergenic
973075485 4:45919824-45919846 GAGAAAATTGAGAATCAGGAAGG + Intergenic
973588801 4:52419743-52419765 GAGAAAATGGAGGCACAGGGAGG - Intergenic
974700187 4:65433748-65433770 TTGAACATGGAGGAAGAGGCTGG - Intronic
974726488 4:65805746-65805768 GAGAACATAGTGAAATAGGATGG - Intergenic
974903203 4:68026156-68026178 GACAACATGGAAAAACACACAGG - Intergenic
975059542 4:69979937-69979959 GAGAACATGGAAAAAGATGTAGG - Intergenic
975289147 4:72656643-72656665 GAGGATATGGAGAAATAGGAAGG + Intergenic
975302857 4:72811687-72811709 GAGAAAAGGGAGAAAAAGACTGG + Intergenic
975511569 4:75199169-75199191 GAGAACATATGGACACAGGCAGG - Intergenic
975639350 4:76483943-76483965 GAGAACATGTGGACACAGGGAGG + Intronic
975724702 4:77280528-77280550 GAGAACATGTGGACACAGGGAGG - Intronic
976773878 4:88685548-88685570 GAGAACATGTGGACACAGGGAGG + Intronic
976793422 4:88905985-88906007 GAGAGCATCAAGAAACATGCTGG + Intronic
977024199 4:91794876-91794898 GAGAACATGTGGACACAGGGAGG - Intergenic
977799538 4:101210199-101210221 GGGAACTTGGAGAAATAGTCTGG - Intronic
978076706 4:104540032-104540054 GAGAACACAGAGACACAGGGAGG - Intergenic
978517082 4:109580069-109580091 GAGAACACGTGGAAACAGGGCGG - Intronic
978627015 4:110697850-110697872 ATGAACATGGGGATACAGGCAGG + Intergenic
979204123 4:118014446-118014468 CAGCACATGGAGAAAAAAGCAGG - Intergenic
980442249 4:132864714-132864736 GAGATCATGTAGAAATATGCAGG - Intergenic
980689685 4:136279262-136279284 GAAGACATGGAGCAACAGGACGG + Intergenic
981404112 4:144347264-144347286 AAAAGCATGGAGAAAGAGGCTGG - Intergenic
981432601 4:144678582-144678604 GAGAACATGTGGACACAGGGAGG - Intronic
981488229 4:145311150-145311172 GATAACATGCAGAAACAGATGGG - Intergenic
981637198 4:146894481-146894503 GAGAACATGTGGACACAGGAAGG + Intronic
982066565 4:151659657-151659679 GAGCACCTGAAGAAAAAGGCAGG - Intronic
982686587 4:158497520-158497542 GAGAACATGGAGAAAGATACAGG - Intronic
983169137 4:164515817-164515839 GAGAACACGTAGACACAGGGAGG - Intergenic
983278156 4:165644123-165644145 GAGAACATGTAGACACAGGAAGG + Intergenic
984191123 4:176606935-176606957 GTGAAGATGGAGAGAGAGGCTGG + Intergenic
984382746 4:179015960-179015982 GTGAAGATGGAGAGAGAGGCTGG - Intergenic
984632567 4:182076187-182076209 AAGAAGAAGGAGAAAGAGGCTGG - Intergenic
985215997 4:187655253-187655275 GTCACCATGGAAAAACAGGCAGG - Intergenic
985544494 5:502324-502346 GAGAACAGACAGACACAGGCAGG + Intronic
985758008 5:1730644-1730666 GAAAACAGGGAGAAAAAGGAAGG - Intergenic
986111961 5:4728225-4728247 GGGAAGATGGAGAAATAGGCTGG + Intergenic
986593126 5:9391912-9391934 GAGATCATGTAGAAATAGGGAGG - Intronic
987229489 5:15878720-15878742 GAGAAAATGGAGACGCAGCCAGG + Intronic
987894588 5:23927527-23927549 GAGAACATGCGGACACAGGGAGG - Intergenic
988628885 5:32907758-32907780 GAGGATATGGAGAAACAGGAAGG - Intergenic
988794014 5:34635550-34635572 GAGAACATGTGGACACAGGGAGG - Intergenic
988841355 5:35086948-35086970 GAGAAGATGGGGAAAGAGGAAGG - Intronic
989087806 5:37694647-37694669 GAGAACATGTAGACACAGGGCGG + Intronic
989785530 5:45323754-45323776 GAGAACACAGAGACACAGGAAGG - Intronic
990252767 5:53933348-53933370 GTAAAGATGGAGAAAAAGGCCGG + Intronic
990527424 5:56641670-56641692 GAGAGGAAGGAGAAACAGGTGGG + Intergenic
991224100 5:64249055-64249077 GAGAACACATAGACACAGGCAGG + Intronic
991327988 5:65459172-65459194 GAAAATGTAGAGAAACAGGCCGG - Intronic
992784866 5:80159916-80159938 AAGAATATGAATAAACAGGCAGG - Intronic
993420408 5:87694428-87694450 GAGAACATGTGGACACAGGAAGG - Intergenic
994399743 5:99264165-99264187 GAGACCATGGTGAATCTGGCTGG + Intergenic
994449578 5:99925375-99925397 TAAAACATGGAAAAACAGGTTGG - Intergenic
995293825 5:110493970-110493992 GAGAACATATGGACACAGGCAGG - Intronic
995567062 5:113441692-113441714 GAGAACATGTGGACACAGGGAGG - Intronic
995877017 5:116801023-116801045 GAGAATGTGAAGAAATAGGCAGG + Intergenic
996348940 5:122517303-122517325 GACAACATGGATAAACCTGCAGG - Intergenic
997038021 5:130216406-130216428 GAGAACTTGGAGAAAAAGAATGG + Intergenic
997976765 5:138445613-138445635 CAGAGCTTGGGGAAACAGGCAGG + Intronic
998400887 5:141848631-141848653 GAGAAGTTGGAGAAGAAGGCAGG - Intergenic
998586330 5:143431447-143431469 GAGAACATGTGGACACAGGGAGG + Intronic
1000612603 5:163391123-163391145 GAGAACATGTGGACACAGGGAGG - Intergenic
1000721883 5:164718436-164718458 GAGAACATGTGGAAACATGGGGG - Intergenic
1002032806 5:176443219-176443241 GAGAACATGTAAACACAGGGAGG + Intergenic
1002674152 5:180896531-180896553 GAGAACATGTGGACACAGGAAGG - Intergenic
1002871822 6:1173096-1173118 GAGAACATGTGGACACAGGGAGG - Intergenic
1003808049 6:9748777-9748799 GAGAACATGTGGACACAGGGAGG + Intronic
1004324803 6:14665042-14665064 GGAAACCTGGAGAAACAGGCTGG - Intergenic
1004484168 6:16049942-16049964 GAGCTCCTGGGGAAACAGGCAGG - Intergenic
1005429855 6:25744110-25744132 GAGAACATGGACATACAGTGGGG + Intergenic
1005446906 6:25933477-25933499 GAGAACATGTGGACACAGGGAGG + Intergenic
1005806853 6:29481477-29481499 GAGGATGTGGAGAAACAGGAAGG - Intergenic
1005936758 6:30528837-30528859 CAGAACTTTGGGAAACAGGCAGG + Intergenic
1006168665 6:32080773-32080795 GGGGACATGGAGGAACAGGCTGG + Intronic
1006689591 6:35870382-35870404 GAGGAAATGGAGAAAGAGTCGGG - Exonic
1006752306 6:36386475-36386497 GAGAAAATGAAGAAAGTGGCAGG + Intronic
1006931716 6:37692690-37692712 TGGAACATGGAGGGACAGGCTGG - Intronic
1007354895 6:41307164-41307186 GAAAACATGGAGAAAGAGAGTGG - Intergenic
1007686151 6:43668489-43668511 GAGAGCAAGGAGAAACTGGCAGG - Intronic
1007844865 6:44745499-44745521 GAGAACATGTGGACACAGGGAGG - Intergenic
1008377769 6:50810750-50810772 GAGACCGTGGAGAGAGAGGCAGG + Intergenic
1008577423 6:52874323-52874345 GGGAACATGGAGAAAGATCCGGG - Intronic
1009212892 6:60884219-60884241 GAGGATATGGAGAAATAGGAAGG - Intergenic
1009579109 6:65508915-65508937 GAGAACGTGGAGAAAAATCCTGG + Intronic
1009707206 6:67266774-67266796 GAGAGCAAGGAGAAGCAGGGTGG - Intergenic
1009887350 6:69639513-69639535 GAGAGCCTGGAGATACAGTCAGG - Intergenic
1010345502 6:74805424-74805446 GAGAACACGGGGACACAGGGAGG + Intergenic
1010577601 6:77551737-77551759 GAGAACATGGCAAAACTAGCTGG - Intergenic
1010669134 6:78665857-78665879 GAGAACATGTGGACACAGGGTGG - Intergenic
1011386470 6:86803439-86803461 GAGAACACATAGAAACAGGGAGG - Intergenic
1011971282 6:93226126-93226148 GAGAACATTTAGAACCAGGAAGG + Intergenic
1012922495 6:105234284-105234306 GAGAGCAAGCAGAAACAGGGTGG - Intergenic
1013759187 6:113496669-113496691 GAGAACAAGGAAATACCGGCGGG + Intergenic
1013896709 6:115097442-115097464 GAGAACATGTGGATACAGGGAGG - Intergenic
1014537428 6:122631612-122631634 AACAACCTGGAGAGACAGGCAGG + Intronic
1015411209 6:132895754-132895776 GATTAAAAGGAGAAACAGGCTGG + Intergenic
1015827733 6:137333010-137333032 GAGAAAATGCAGAAACAGCAGGG - Intergenic
1016014984 6:139174515-139174537 GACAACATGGAGAGGCAGCCAGG - Exonic
1016270535 6:142283443-142283465 GAGAACATGTGGACACAGGGCGG + Intergenic
1016471411 6:144378549-144378571 GAGAACAGGGTGAAGGAGGCAGG + Intronic
1016493523 6:144633526-144633548 AACAAAATGGAGAAGCAGGCCGG - Intronic
1016805401 6:148207143-148207165 GAGGACATGGAAAATCAGGGTGG - Intergenic
1016958981 6:149653547-149653569 GAGAACAAGGAAAAGAAGGCTGG + Intergenic
1018153860 6:160966612-160966634 GATCACAAGGAGAAACAGGAAGG - Intergenic
1018862237 6:167719604-167719626 GAGAACATGTGGACACAGGGAGG + Intergenic
1018934945 6:168267842-168267864 GAGAACATGTGGACACAGGAAGG - Intergenic
1019843388 7:3472856-3472878 GAGAACATGGGGTAACAGTCAGG + Intronic
1019980740 7:4620117-4620139 GAGAATCTGGAGAACCAGGCTGG + Intergenic
1020426454 7:8071672-8071694 AAGAACATGGAGAGACAGTTGGG - Intronic
1020624632 7:10562043-10562065 GCAAACATAGAGAAACAAGCTGG - Intergenic
1021405809 7:20265962-20265984 GAGAACATGTGGACACAGGGAGG - Intergenic
1021496392 7:21279097-21279119 CTGAATATGGAGAAACAGTCAGG - Intergenic
1022036305 7:26537857-26537879 GAGAAAATGGAGTAACCGTCAGG + Intronic
1022143223 7:27511722-27511744 TATAAAATGGAGAAGCAGGCTGG - Intergenic
1022174365 7:27859236-27859258 GAGGATGTGGAGAAACAGGAAGG + Intronic
1022221985 7:28322636-28322658 GAGAACATGTGGAGACAGGGAGG - Intronic
1023076535 7:36488421-36488443 GAGAACATGCGGACACAGGGAGG - Intergenic
1023664254 7:42504895-42504917 GAGAACATTTAGACACAGGCAGG - Intergenic
1024454194 7:49584373-49584395 GAGAACATGGAGGCAGAGACTGG + Intergenic
1025173592 7:56783594-56783616 AAGAACCTGGAAATACAGGCAGG + Intergenic
1025698511 7:63794559-63794581 AAGAACCTGGAAATACAGGCAGG - Intergenic
1025726593 7:64067688-64067710 GAGAACATGTGGACACAGGGAGG + Intronic
1026589831 7:71684997-71685019 GAGAACATGGAGATTCAGATAGG + Intronic
1027882216 7:83855132-83855154 AAGAAGAAGGAGAAAGAGGCAGG + Intergenic
1028051759 7:86196748-86196770 GAGAACATGTGGACACAGGAAGG - Intergenic
1028061618 7:86325617-86325639 GAGAACATAGAGCAACAGAAAGG + Intergenic
1028408408 7:90501194-90501216 TAGAAAAAGGAGATACAGGCAGG + Intronic
1028555911 7:92124821-92124843 CAGAGCAGGTAGAAACAGGCAGG + Intronic
1030455142 7:109762804-109762826 GAGGACAGGGAGGAATAGGCAGG - Intergenic
1030932566 7:115542925-115542947 GAGAAAATGGACAAAAGGGCAGG - Intergenic
1031120328 7:117714733-117714755 GAGAACATGGAGAATCACTTGGG + Intronic
1031230372 7:119097946-119097968 GACAACATAGATTAACAGGCAGG - Intergenic
1031406320 7:121391681-121391703 GAAGACATGGAGAAACAGAATGG + Intronic
1031530751 7:122873360-122873382 GAGAACATGTGGACACAGGGAGG - Intronic
1032224884 7:130023429-130023451 GGCAGCATGGAGAAGCAGGCAGG - Intronic
1033004392 7:137545865-137545887 GAGAAAATGTAGAAACAGAATGG + Intronic
1033995219 7:147337411-147337433 GAAGACATGAAGGAACAGGCTGG - Intronic
1034063290 7:148112738-148112760 GAGAATATAGAGAAAGGGGCTGG + Intronic
1035767631 8:2119761-2119783 GAGCACATGGGGACACAGGAGGG + Intronic
1035884888 8:3281144-3281166 AAGAAAATGGGTAAACAGGCTGG + Intronic
1036623346 8:10443847-10443869 GAGAAAAAGGAGGAACAGGGTGG + Intergenic
1036687131 8:10919101-10919123 GAGAGGATGGAGAGAAAGGCAGG - Intronic
1037076874 8:14731336-14731358 GAGAACATGTGGACACAGGGAGG + Intronic
1037087636 8:14872119-14872141 GAGAACATATGGAAACAGGGAGG + Intronic
1037338586 8:17816467-17816489 GAGGATATGGAGAAATAGGAAGG + Intergenic
1037515298 8:19624971-19624993 AAGAAGATGGTGAAACCGGCTGG - Intronic
1037573530 8:20179361-20179383 GAGAAGATGGTGGAAAAGGCAGG + Exonic
1037598595 8:20374659-20374681 GAGAGCAGGGAGAAGGAGGCAGG - Intergenic
1037622412 8:20576405-20576427 GAGACTATGGAGAAGTAGGCAGG + Intergenic
1037682020 8:21105441-21105463 AATAATATGGAGAAATAGGCTGG - Intergenic
1037911522 8:22746543-22746565 GAGGACAGGGAGGAAGAGGCTGG - Intronic
1037918608 8:22788102-22788124 GAGAACCAGGAGCAGCAGGCAGG + Intronic
1037954384 8:23042744-23042766 GAGAAGATGGAGCAACAGCAGGG - Intronic
1038095258 8:24302130-24302152 GAGAACACGTGGACACAGGCAGG - Intronic
1038548539 8:28444925-28444947 GTGAAAATGAAGAAATAGGCCGG - Intronic
1038648570 8:29381773-29381795 GAGAAGATTGAGAGACAGGAGGG + Intergenic
1039010090 8:33084551-33084573 GAGAAAATGGAGGCACAGGGAGG - Intergenic
1039202178 8:35107834-35107856 TATAGCATGGAGCAACAGGCTGG - Intergenic
1039329835 8:36524912-36524934 GAGAACATGTGGACACAGGGAGG + Intergenic
1039712089 8:40066058-40066080 GTGCACATGGACAAACAGACTGG + Intergenic
1039776247 8:40739835-40739857 GAGAACATGTGGACACAGGGAGG - Intronic
1039776886 8:40745988-40746010 GAGATCTGGAAGAAACAGGCAGG - Intronic
1040847289 8:51857008-51857030 GAGAACATGCATAAGCATGCAGG + Intronic
1040879308 8:52188339-52188361 GAGAAAATGCAGAAACAGTGGGG + Intronic
1041041268 8:53848581-53848603 GAGAACATGTGGACACAGGAAGG - Intergenic
1041830066 8:62143865-62143887 CAGAAGATGGAGATGCAGGCAGG + Intergenic
1043795609 8:84534706-84534728 GAGAACAGGGAGAAGAAGGAAGG + Intronic
1044479285 8:92666426-92666448 GAGAACATGCAGACACAGGGAGG - Intergenic
1045293972 8:100858255-100858277 GAGAACATGTGGACACAGGAAGG + Intergenic
1045497290 8:102719320-102719342 GAGGTCATGGAGAAAGAAGCAGG + Intergenic
1045636129 8:104192974-104192996 GAGAAACTAGAGAAACAGGGTGG + Intronic
1046065581 8:109193209-109193231 GAGAAAATGCAGAAACATACAGG + Intergenic
1046740005 8:117817827-117817849 TAGCAAATGGAGAAAAAGGCCGG + Intronic
1046906472 8:119579088-119579110 GATAACATGTTGAAACAGCCAGG - Intronic
1047773965 8:128053853-128053875 GGGCACTTGGAGATACAGGCTGG - Intergenic
1047817351 8:128479278-128479300 GAGAGCATGGAGACCCAGGGAGG + Intergenic
1047936087 8:129780192-129780214 GAGAAGATTGAGAAACAGATAGG + Intronic
1048180611 8:132191070-132191092 GTGAACTTGGAGAGACAGGCTGG + Intronic
1048382762 8:133882512-133882534 GAGCACATGGAGAAAAAGAGAGG + Intergenic
1048747383 8:137630042-137630064 GAGAAAAGTGAGAAACGGGCAGG + Intergenic
1049069609 8:140346261-140346283 GATGACCTGGAGAAACTGGCTGG - Intronic
1050305984 9:4306486-4306508 GAGAACATGTAGAAATGGCCTGG - Intronic
1050320562 9:4448046-4448068 GAGTACAGATAGAAACAGGCAGG - Intergenic
1050335607 9:4587472-4587494 GATAACAAGAAGAAAAAGGCAGG - Intronic
1050768185 9:9162600-9162622 GAGAAAATGGAGATGCAAGCAGG - Intronic
1051045983 9:12874192-12874214 GAGAACATGTGGACACAGGGAGG + Intergenic
1051705655 9:19877271-19877293 GAGGAAAAGGAGAGACAGGCTGG + Intergenic
1052040709 9:23735764-23735786 GAGAACAGTTATAAACAGGCTGG + Intronic
1052123308 9:24744750-24744772 GAGAACACGTAGACACAGGGAGG + Intergenic
1052323940 9:27197034-27197056 GAGAACATATGGAAACAGGAAGG + Intronic
1052507104 9:29369794-29369816 GAGAACACATAGAAACAGGGAGG - Intergenic
1052842464 9:33304414-33304436 GAGAGCATGCAGAAACAAACAGG - Intronic
1053452327 9:38203424-38203446 GAGAAAATGGAGGCACAGGGAGG - Intergenic
1055039115 9:71849903-71849925 GAGAACATATGGAAACAGGGAGG + Intergenic
1056844668 9:90026773-90026795 GAGAATTTGCAGAAATAGGCTGG - Intergenic
1057055815 9:91959864-91959886 AAGAACAGAGAGAAGCAGGCTGG - Intergenic
1057311433 9:93945680-93945702 GAAGAAATGGAGAGACAGGCTGG - Intergenic
1057523024 9:95775202-95775224 GAGAAGGTGGAGTAACAGGGTGG - Intergenic
1057909065 9:99004252-99004274 GCAAACTTGGAGAAAGAGGCCGG + Intronic
1058284181 9:103154788-103154810 GAGAACATATAGACACAGGAAGG - Intergenic
1058714554 9:107712109-107712131 GAAAACATCGAGACAAAGGCAGG - Intergenic
1058961614 9:109997648-109997670 GAGCTCATTGAGAAACAGGAAGG - Intronic
1059687648 9:116652792-116652814 GTGCACATGAAGAAAGAGGCAGG - Intronic
1060030557 9:120211532-120211554 GAGAAAATGGAGGCACAGGGAGG + Intergenic
1060203381 9:121666530-121666552 GAGAACATGTGGACACAGGGAGG + Intronic
1060237739 9:121877911-121877933 GAGGACCTGGAGAGTCAGGCCGG + Intronic
1060354714 9:122894581-122894603 AAGAACATGAAGAGAGAGGCTGG + Intronic
1060866106 9:126998969-126998991 GAGAACATGTGGACACAGGAAGG + Intronic
1062193121 9:135257744-135257766 GAGGCCATGGAGATACAGCCAGG - Intergenic
1062453248 9:136624251-136624273 GAGAACATGGAGGACCAGGGAGG - Intergenic
1203485079 Un_GL000224v1:45703-45725 GAGAACACGTAGACACAGGAAGG + Intergenic
1185548400 X:964630-964652 GAGAACAGAGGGAAACAGGGAGG - Intergenic
1185603490 X:1354616-1354638 GAGAAAATGGAGAAAGAGGAGGG + Intronic
1185666482 X:1769237-1769259 GAGAAGATGGAGACAGAGGTTGG + Intergenic
1186075941 X:5879039-5879061 GAGAACATGCATGAACATGCAGG + Intronic
1186252133 X:7679680-7679702 GAGAACATGTGGACACAGGGAGG - Intergenic
1186333132 X:8557687-8557709 GAGGATATGGAGAAATAGGAAGG + Intronic
1187251389 X:17601306-17601328 GAAATCATGGAGAAGCAGGAAGG + Intronic
1188036461 X:25322941-25322963 GAGAAAAAGGAGAAAGAGGAAGG - Intergenic
1188318081 X:28700743-28700765 GAGAACATGTGGATACAGGGAGG - Intronic
1188874631 X:35414799-35414821 GAGTACGTGGAGAAATAGGAAGG - Intergenic
1189285848 X:39852030-39852052 GAGGACATGGAGAGAGAGCCAGG + Intergenic
1189505333 X:41607730-41607752 GAGAACATGGAGAATCTTGCAGG - Intronic
1190608126 X:52166190-52166212 GAGAACATGTGGACACAGGAAGG + Intergenic
1192315515 X:70048324-70048346 AAGAGACTGGAGAAACAGGCAGG - Intronic
1192567335 X:72176147-72176169 GAGAATGTGGAGAAATAGGAAGG + Intergenic
1193038215 X:76976579-76976601 CAGAACATGGAGAAACAAACTGG + Intergenic
1193237125 X:79121144-79121166 GAGAACATTTAGACACAGGAAGG - Intergenic
1193476646 X:81974284-81974306 GAGGACATGGAGAAATAGGAAGG + Intergenic
1193942617 X:87694787-87694809 GATCACATGGTGAAACAGGAAGG + Intergenic
1194152280 X:90340418-90340440 GAGAACATATGGAAACAGGGAGG - Intergenic
1195950498 X:110266879-110266901 GAGAACATGTGGACACAGGGAGG - Intronic
1196316969 X:114238306-114238328 GAGAATGTGGAGAAATAGGAAGG - Intergenic
1196345624 X:114653645-114653667 ATGAACAAGGAGAAACAGGAGGG - Intronic
1196741079 X:119026661-119026683 GAGAACAATGAGACACAGGGTGG + Intergenic
1196754872 X:119149169-119149191 GAGCACATGGAGGAACTGTCGGG - Intronic
1197413955 X:126151277-126151299 GAGAGCAAGGAAAAACAGGGTGG - Intergenic
1198025448 X:132701598-132701620 GAGAAGATGGGGAAGCAGGTGGG - Intronic
1198259342 X:134951980-134952002 GAGAACACGTGGAAACAGGGGGG + Intergenic
1198628205 X:138603182-138603204 GAGAACATGTGGACACAGGGAGG - Intergenic
1199184368 X:144897908-144897930 GAGAACATGGGTACACATGCTGG + Intergenic
1199397421 X:147355549-147355571 GAGAACATGTGGACACAGGAAGG + Intergenic
1199481183 X:148299941-148299963 GAGAACATGTGGACACAGGAAGG - Intergenic
1199494575 X:148438883-148438905 CTGAGCCTGGAGAAACAGGCAGG + Intergenic
1200370277 X:155717596-155717618 GAGAACATGTGGACACAGGGAGG - Intergenic
1201231201 Y:11866556-11866578 GAGAACATGTGGACACAGGGAGG + Intergenic
1201431624 Y:13908546-13908568 GAGAAAATGGGGAAAGAGGAAGG - Intergenic
1202088378 Y:21162955-21162977 GAGCAGATGGAAAAACATGCTGG - Intergenic
1202360920 Y:24109563-24109585 GAGAACATGTGGACACAGGAAGG - Intergenic
1202509858 Y:25560555-25560577 GAGAACATGTGGACACAGGAAGG + Intergenic