ID: 1168252109

View in Genome Browser
Species Human (GRCh38)
Location 19:55147151-55147173
Sequence CTTAGGCCGCACCAGGATGT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 63}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168252109_1168252124 19 Left 1168252109 19:55147151-55147173 CCGACATCCTGGTGCGGCCTAAG 0: 1
1: 0
2: 0
3: 2
4: 63
Right 1168252124 19:55147193-55147215 AGTGGGGTGGGGCCCCAAGGAGG 0: 1
1: 0
2: 3
3: 35
4: 377
1168252109_1168252120 8 Left 1168252109 19:55147151-55147173 CCGACATCCTGGTGCGGCCTAAG 0: 1
1: 0
2: 0
3: 2
4: 63
Right 1168252120 19:55147182-55147204 AGAAGAGGCCCAGTGGGGTGGGG 0: 1
1: 0
2: 2
3: 41
4: 500
1168252109_1168252122 16 Left 1168252109 19:55147151-55147173 CCGACATCCTGGTGCGGCCTAAG 0: 1
1: 0
2: 0
3: 2
4: 63
Right 1168252122 19:55147190-55147212 CCCAGTGGGGTGGGGCCCCAAGG 0: 1
1: 0
2: 2
3: 40
4: 341
1168252109_1168252116 2 Left 1168252109 19:55147151-55147173 CCGACATCCTGGTGCGGCCTAAG 0: 1
1: 0
2: 0
3: 2
4: 63
Right 1168252116 19:55147176-55147198 CCAGAGAGAAGAGGCCCAGTGGG 0: 1
1: 0
2: 3
3: 39
4: 290
1168252109_1168252125 20 Left 1168252109 19:55147151-55147173 CCGACATCCTGGTGCGGCCTAAG 0: 1
1: 0
2: 0
3: 2
4: 63
Right 1168252125 19:55147194-55147216 GTGGGGTGGGGCCCCAAGGAGGG 0: 1
1: 0
2: 0
3: 59
4: 456
1168252109_1168252127 22 Left 1168252109 19:55147151-55147173 CCGACATCCTGGTGCGGCCTAAG 0: 1
1: 0
2: 0
3: 2
4: 63
Right 1168252127 19:55147196-55147218 GGGGTGGGGCCCCAAGGAGGGGG 0: 1
1: 0
2: 5
3: 81
4: 729
1168252109_1168252114 1 Left 1168252109 19:55147151-55147173 CCGACATCCTGGTGCGGCCTAAG 0: 1
1: 0
2: 0
3: 2
4: 63
Right 1168252114 19:55147175-55147197 ACCAGAGAGAAGAGGCCCAGTGG 0: 1
1: 0
2: 1
3: 38
4: 357
1168252109_1168252112 -7 Left 1168252109 19:55147151-55147173 CCGACATCCTGGTGCGGCCTAAG 0: 1
1: 0
2: 0
3: 2
4: 63
Right 1168252112 19:55147167-55147189 GCCTAAGGACCAGAGAGAAGAGG 0: 1
1: 0
2: 5
3: 25
4: 285
1168252109_1168252126 21 Left 1168252109 19:55147151-55147173 CCGACATCCTGGTGCGGCCTAAG 0: 1
1: 0
2: 0
3: 2
4: 63
Right 1168252126 19:55147195-55147217 TGGGGTGGGGCCCCAAGGAGGGG 0: 1
1: 0
2: 4
3: 41
4: 461
1168252109_1168252117 3 Left 1168252109 19:55147151-55147173 CCGACATCCTGGTGCGGCCTAAG 0: 1
1: 0
2: 0
3: 2
4: 63
Right 1168252117 19:55147177-55147199 CAGAGAGAAGAGGCCCAGTGGGG 0: 1
1: 0
2: 7
3: 79
4: 669
1168252109_1168252118 6 Left 1168252109 19:55147151-55147173 CCGACATCCTGGTGCGGCCTAAG 0: 1
1: 0
2: 0
3: 2
4: 63
Right 1168252118 19:55147180-55147202 AGAGAAGAGGCCCAGTGGGGTGG 0: 1
1: 1
2: 9
3: 73
4: 706
1168252109_1168252119 7 Left 1168252109 19:55147151-55147173 CCGACATCCTGGTGCGGCCTAAG 0: 1
1: 0
2: 0
3: 2
4: 63
Right 1168252119 19:55147181-55147203 GAGAAGAGGCCCAGTGGGGTGGG 0: 1
1: 0
2: 1
3: 34
4: 362

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168252109 Original CRISPR CTTAGGCCGCACCAGGATGT CGG (reversed) Exonic