ID: 1168255020

View in Genome Browser
Species Human (GRCh38)
Location 19:55160392-55160414
Sequence AGAATATTCTCACAGGGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 136}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168255020_1168255026 23 Left 1168255020 19:55160392-55160414 CCAGCACCCTGTGAGAATATTCT 0: 1
1: 0
2: 1
3: 15
4: 136
Right 1168255026 19:55160438-55160460 TAAGATTAGAATTCTGCTAGTGG 0: 1
1: 0
2: 0
3: 15
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168255020 Original CRISPR AGAATATTCTCACAGGGTGC TGG (reversed) Intronic
901817120 1:11800663-11800685 AGAAAATTCTCCCAGGAGGCAGG - Intronic
904208368 1:28869704-28869726 AGCATTTCCTCTCAGGGTGCAGG - Intergenic
906238915 1:44229562-44229584 AGAATTTCCACACAGGGTGCGGG + Intronic
906945393 1:50290267-50290289 GGAAGATTCTCACAGGGAGTGGG - Intergenic
908923226 1:69221689-69221711 AGAACATTCTCACTGGGTCTTGG + Intergenic
909518481 1:76539581-76539603 AAAATTTTCTCCCATGGTGCAGG - Intronic
913265382 1:117038192-117038214 AGAATATTTACACAGGGTCTTGG + Intergenic
919506588 1:198406448-198406470 TGAAGATTCTCAGAGGGTGGAGG + Intergenic
924364712 1:243279443-243279465 ATAATATTCTCTCATGATGCTGG - Intronic
1063535291 10:6876940-6876962 AGAATAGTATCACAGACTGCAGG + Intergenic
1064245206 10:13662529-13662551 GGAGTATTCTCACATGGTTCTGG + Intronic
1065805370 10:29389187-29389209 AGTTCTTTCTCACAGGGTGCTGG - Intergenic
1066369316 10:34806726-34806748 AAAATATTCTCACAGCATGGAGG + Intronic
1067537774 10:47127287-47127309 AGAAGAGTCTCACAGGCAGCAGG - Intergenic
1069154679 10:65012789-65012811 ACAATTTTCTCACAGGATGCAGG - Intergenic
1072990410 10:100186947-100186969 ATTAGATTCTCACAGGGAGCCGG + Exonic
1076200506 10:128554061-128554083 AGAAAATTCTCACTGTGTGAGGG + Intergenic
1076461396 10:130649834-130649856 AGGTTCTTCTCCCAGGGTGCTGG - Intergenic
1077240031 11:1505815-1505837 AGGATATTCATACAGGGTCCTGG + Intergenic
1079001961 11:16765259-16765281 AGAATATTTTCACTGGGTATAGG - Intergenic
1079722076 11:23827817-23827839 ACAATATTCCCTCAGGGTTCAGG + Intergenic
1080233414 11:30043242-30043264 AGAAAATGCTCACAGGGGCCAGG - Intergenic
1082200516 11:49360795-49360817 ACAATATTCTCTCATGATGCTGG - Intergenic
1084680846 11:70665434-70665456 AGAAAATTCTCAGATGGAGCAGG - Intronic
1086655163 11:89345444-89345466 ACAATATTCTCTCATGATGCTGG + Intronic
1096516258 12:52157192-52157214 GGAATGTTCTCAGAGGGTGAGGG - Intergenic
1096587966 12:52636035-52636057 AGAATATTCTCTCAGGCAGCTGG - Intergenic
1097289484 12:57902265-57902287 AGCATATTTTCACAGGCTACTGG + Intergenic
1097823340 12:64149645-64149667 CTAAGATTCTTACAGGGTGCAGG - Exonic
1099389664 12:82064087-82064109 AGACCATACTCACAGGGTGAGGG - Intergenic
1100415275 12:94366027-94366049 AGATTAATCTCACATGGGGCAGG + Intronic
1100745759 12:97644047-97644069 AGAAAATTCTCACACTGTGATGG - Intergenic
1101035086 12:100697507-100697529 AAAATATTCTCACATGTTACTGG - Intergenic
1101231907 12:102749984-102750006 AGAAGATTTTCTCAGGATGCAGG - Intergenic
1101398312 12:104367223-104367245 AGAATCTTCCCACATAGTGCCGG - Intergenic
1103253466 12:119520827-119520849 AGAATATTCTCTAAGTGGGCTGG - Intronic
1103860442 12:124008306-124008328 AGAATGTCTTCAGAGGGTGCTGG + Intronic
1113038732 13:106081095-106081117 AGAATATTTTCACATGGTTTTGG - Intergenic
1113458444 13:110465390-110465412 TGAATTTTCACACAGGGTGATGG + Exonic
1118911418 14:70065082-70065104 AGCAGAGTCTCAAAGGGTGCAGG - Intronic
1124631798 15:31342183-31342205 AGACTACTGACACAGGGTGCAGG - Intronic
1127205899 15:56718607-56718629 AAAATTTTCACACAGGGTACAGG + Intronic
1128021326 15:64392902-64392924 AGAATATTCTGTCTGGGTTCGGG - Intronic
1130516795 15:84631968-84631990 AGAAGATTCCCACTGGGAGCAGG + Intergenic
1132355875 15:101170895-101170917 GCAATATTCTCACAGGATGAGGG + Intergenic
1135292964 16:21255986-21256008 AAGATATTCTCTCAGGATGCTGG + Intronic
1136454521 16:30372701-30372723 AGAATATTTTCTCTGGGTACTGG - Intronic
1137931170 16:52588963-52588985 AAACTCTCCTCACAGGGTGCAGG - Intergenic
1139962256 16:70724732-70724754 AGAAGATTCACACAAGGAGCTGG + Intronic
1141994624 16:87628510-87628532 AGAATATTCCTACAGAGTGTGGG + Intronic
1143777350 17:9208291-9208313 AGAATAATTGCAAAGGGTGCTGG + Intronic
1144195068 17:12885193-12885215 AGAATATGCTCAGCAGGTGCTGG - Intronic
1146570341 17:33946978-33947000 ACAATAATCTCAGTGGGTGCAGG - Intronic
1147682728 17:42262310-42262332 AAAATATTAGCACGGGGTGCTGG - Intronic
1154334341 18:13453921-13453943 AAAATATGCTAACAGGCTGCGGG + Intronic
1155625106 18:27825548-27825570 AGAACATTCTCACAGGATAATGG + Intergenic
1156039484 18:32804474-32804496 AGCATATTCTAACAGGGTTTGGG + Intergenic
1156697502 18:39784466-39784488 AGAATATTCTTGCAAGTTGCAGG - Intergenic
1162111556 19:8402551-8402573 AGAACATCCTCACAGGTGGCCGG + Exonic
1165882045 19:39051219-39051241 TGCTTATTCTCACAGGTTGCAGG - Intergenic
1166052965 19:40271591-40271613 AGAATGTTCTCACAAGACGCTGG - Intronic
1167815365 19:51876103-51876125 AGAATACTCGTCCAGGGTGCTGG + Intronic
1168255020 19:55160392-55160414 AGAATATTCTCACAGGGTGCTGG - Intronic
927404200 2:22749191-22749213 AGAGTATTCTCACTATGTGCAGG + Intergenic
930021819 2:47006387-47006409 TGAATGATCTCACAGGGTGATGG - Intronic
931496656 2:62814331-62814353 AGAAGATTCTCACAAGATGCTGG + Intronic
936835075 2:116699858-116699880 ACAATACTCTCACGAGGTGCTGG + Intergenic
940073102 2:149711432-149711454 TGAAGATTCTCACAGGGTTCTGG - Intergenic
940406288 2:153306112-153306134 AGAATATTCTCAAAGCATGTGGG - Intergenic
940537889 2:154969450-154969472 GGAATATCCCCACAGGCTGCTGG - Intergenic
942148450 2:173050376-173050398 AGTTTCTTCTCACAGGGGGCAGG + Intronic
947222077 2:227803524-227803546 ATAAAATTCTCACAGGGAGTAGG - Intergenic
947909459 2:233791720-233791742 AGAACAATCTCAAGGGGTGCAGG + Intronic
1169981913 20:11394236-11394258 AGAATTTTCTCCCACGGTCCAGG + Intergenic
1169982525 20:11402098-11402120 AGAATGTCCTCACCAGGTGCTGG + Intergenic
1174513400 20:51073013-51073035 AGAAGGTTATCGCAGGGTGCAGG - Intergenic
1175004022 20:55663234-55663256 ATAATATTCTTAGAGCGTGCTGG - Intergenic
1175126292 20:56754409-56754431 AGAATATTCTCTCAGAATGGAGG - Intergenic
1177486366 21:21761848-21761870 TGAACATTCTCACAGCGTGGTGG - Intergenic
1181578152 22:23809227-23809249 ACAATATTGTCACTGGGTACAGG - Intronic
1181578236 22:23809805-23809827 ACAATATTGTCACTGGGTACAGG - Intronic
1184675021 22:46036870-46036892 AAACTATTATCACAGGATGCCGG - Intergenic
949626075 3:5867887-5867909 ACAGTGTTCTCACAGTGTGCTGG + Intergenic
950726349 3:14919675-14919697 AGAAATTTCCCACAGGCTGCAGG + Intronic
955388776 3:58503072-58503094 AGAATATTCTCACAGAGAGAAGG - Intergenic
955402860 3:58605760-58605782 AGCATTTTCTCTCAGGGTCCTGG - Intronic
955700658 3:61679034-61679056 AGAATATTCACAAAGGGCACTGG + Intronic
959171031 3:102843811-102843833 AGAATATTCACTCAGGGAACAGG - Intergenic
962781758 3:138725487-138725509 AGTATTTTCTCACAGGTTCCTGG + Intronic
967296269 3:187968125-187968147 TGAATCTTCTGACAGGGTGCTGG - Intergenic
967725519 3:192858917-192858939 ATAAAATTCTCACCGTGTGCAGG - Intronic
969002230 4:3991710-3991732 AAAATATTCTCACATTGTGATGG + Intergenic
970527908 4:16951020-16951042 AGAAAATATTCACAGGGTCCAGG - Intergenic
973983261 4:56324645-56324667 AGAATATAGGCAGAGGGTGCTGG - Intronic
974618381 4:64321801-64321823 ATAATATTTTCACAGGCTGAAGG + Intronic
976017069 4:80569134-80569156 AGAATGTTCACAAAGGGTGATGG - Intronic
977054590 4:92175471-92175493 ACCCTATTCTCCCAGGGTGCAGG + Intergenic
977178450 4:93842922-93842944 AGAATAGTTTCACAGGGTGTAGG + Intergenic
978309087 4:107365777-107365799 AGAATAATCTCTCAGGGGTCTGG + Intergenic
979549423 4:121974077-121974099 AGAATATTCTCGGAGTGTGAAGG - Intergenic
981135707 4:141208500-141208522 AAAATATCCTGACAGGGTGATGG - Intronic
982173143 4:152680729-152680751 AGAATATGCTCTGAGGGTGGAGG + Intergenic
983511387 4:168612793-168612815 AAAATCTTCTCCCAGGGTCCTGG + Intronic
983535083 4:168848995-168849017 AAAAAATTCTCACAGCCTGCAGG - Intronic
984587231 4:181578354-181578376 AGACTCTTCTCTCAGGGAGCAGG - Intergenic
988055514 5:26089436-26089458 AGAACATTTTCACAGGGTTATGG - Intergenic
990473891 5:56143048-56143070 AAACTATTCTCACAGGGTCCTGG + Intronic
992333109 5:75738149-75738171 AGTCTATTCTCACATCGTGCTGG - Intergenic
992924698 5:81569749-81569771 AAAATCTTCTCACAGGTAGCTGG + Intronic
995572590 5:113495970-113495992 ATAATATACTCACAGGTTCCAGG + Intergenic
996595701 5:125200249-125200271 GGAAAATTCACACAGGGTACAGG + Intergenic
998618356 5:143767028-143767050 AGAATATTCTCACATGGTGTAGG - Intergenic
999853534 5:155568620-155568642 AGAACCCTCTCACAAGGTGCTGG - Intergenic
1000202515 5:159025688-159025710 AGAAAAATCTTACAGGGTTCAGG - Intronic
1001036475 5:168300335-168300357 AGAATATTCTCTAAAGATGCAGG + Intronic
1003438776 6:6120822-6120844 ACAATATTGTCACTGGCTGCAGG + Intergenic
1007019646 6:38506480-38506502 ATAATATTCTCTCATGCTGCTGG - Intronic
1008292486 6:49734383-49734405 ACAATATTTTCACAGGTTACAGG + Intronic
1008533672 6:52489548-52489570 AGAATAGTAACACAGGGTGTTGG - Intronic
1010170512 6:72969966-72969988 AAAATATTCCCATTGGGTGCAGG + Intronic
1010811639 6:80307421-80307443 AGAATATTGACAGAGGGGGCAGG - Intronic
1013032817 6:106352014-106352036 AGAATATTTTCACTGGGTATAGG + Intergenic
1017751657 6:157494333-157494355 AGAAGAGTGTCAGAGGGTGCAGG - Intronic
1017881249 6:158564151-158564173 AGAAACTTCTCAAAGGGAGCAGG - Intronic
1018605526 6:165593917-165593939 AGAATGTTGTCATATGGTGCAGG - Intronic
1019207351 6:170373498-170373520 AGAACATTTTCACAGCCTGCAGG - Intronic
1021806734 7:24364633-24364655 AGAATATTCTCTCTGGTTGCTGG + Intergenic
1023618956 7:42049989-42050011 ATTATATTCTGACAGGGTGATGG - Intronic
1024433919 7:49325824-49325846 AGAATATTTTCACTGAGTGTAGG - Intergenic
1024954039 7:54897109-54897131 AGATTATTTTCACATAGTGCTGG + Intergenic
1025742321 7:64207555-64207577 AGAATCCTGACACAGGGTGCAGG + Intronic
1028558550 7:92148363-92148385 TGAAAATTCTCACAGGCTGGGGG - Intronic
1029616167 7:101659249-101659271 AGCATATTTTCACAGGGAGCAGG + Intergenic
1030255805 7:107507888-107507910 AGAATATTCTCTCATGGGGTGGG + Intronic
1030334506 7:108310118-108310140 AGAATAACCTGACAAGGTGCTGG - Intronic
1030823584 7:114126155-114126177 AGAATATCCCTACAGGCTGCTGG - Intronic
1032264350 7:130360445-130360467 AGAATGTACACAGAGGGTGCAGG + Intronic
1033815039 7:145060843-145060865 AGAATATACTCACAGGCTCCAGG - Intergenic
1039872764 8:41560788-41560810 AAAATATTTTCACAAGGAGCAGG + Intergenic
1045417766 8:101984033-101984055 AAAATAATGTCACAGGGTCCAGG - Intronic
1048565394 8:135591210-135591232 AGAATACATTGACAGGGTGCTGG - Intronic
1050057044 9:1666571-1666593 ATTAGATTCTCACAGGGAGCAGG - Intergenic
1051115100 9:13685601-13685623 AGACTATTCTCTCAGTGTCCAGG + Intergenic
1055462566 9:76532490-76532512 AGAATATTCTCACAATCAGCTGG + Intergenic
1057231120 9:93322073-93322095 AGAATCTCCTCAGAGGGTGCTGG - Intronic
1058109568 9:101017677-101017699 AGAAAATTCTCACCAGGTGCCGG - Intergenic
1061889607 9:133610945-133610967 ACAAGATACTCACAGGGGGCAGG - Intergenic
1187581366 X:20610880-20610902 AAAATATTCTCATAGGTTGTGGG - Intergenic
1187891282 X:23937270-23937292 AGAATTATCCCACAGGGGGCAGG + Intronic
1189272113 X:39759156-39759178 AGAATATTCTAACAGGCTGTGGG + Intergenic
1192156567 X:68751179-68751201 GTAGTCTTCTCACAGGGTGCTGG - Intergenic
1194789773 X:98132735-98132757 AGAAGATGCTTACAGGGTCCTGG - Intergenic
1201981108 Y:19911240-19911262 TGAATATTCTCACTGGGAGAAGG + Intergenic