ID: 1168256026

View in Genome Browser
Species Human (GRCh38)
Location 19:55165848-55165870
Sequence CAGGAGGTTCAACGTGAGCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 79}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168256026_1168256036 16 Left 1168256026 19:55165848-55165870 CCCAGCTCACGTTGAACCTCCTG 0: 1
1: 0
2: 0
3: 9
4: 79
Right 1168256036 19:55165887-55165909 CTCGGGACAGGGTCCGCAGCAGG 0: 1
1: 0
2: 1
3: 8
4: 78
1168256026_1168256033 4 Left 1168256026 19:55165848-55165870 CCCAGCTCACGTTGAACCTCCTG 0: 1
1: 0
2: 0
3: 9
4: 79
Right 1168256033 19:55165875-55165897 GCCAGAACTTCGCTCGGGACAGG 0: 1
1: 0
2: 0
3: 1
4: 56
1168256026_1168256035 5 Left 1168256026 19:55165848-55165870 CCCAGCTCACGTTGAACCTCCTG 0: 1
1: 0
2: 0
3: 9
4: 79
Right 1168256035 19:55165876-55165898 CCAGAACTTCGCTCGGGACAGGG 0: 1
1: 0
2: 0
3: 1
4: 61
1168256026_1168256032 -1 Left 1168256026 19:55165848-55165870 CCCAGCTCACGTTGAACCTCCTG 0: 1
1: 0
2: 0
3: 9
4: 79
Right 1168256032 19:55165870-55165892 GCGAGGCCAGAACTTCGCTCGGG 0: 1
1: 0
2: 0
3: 2
4: 39
1168256026_1168256031 -2 Left 1168256026 19:55165848-55165870 CCCAGCTCACGTTGAACCTCCTG 0: 1
1: 0
2: 0
3: 9
4: 79
Right 1168256031 19:55165869-55165891 TGCGAGGCCAGAACTTCGCTCGG 0: 1
1: 0
2: 0
3: 1
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168256026 Original CRISPR CAGGAGGTTCAACGTGAGCT GGG (reversed) Exonic
905845334 1:41225979-41226001 CAGGAGGTTCAAGGTGAGGCAGG - Intronic
905980807 1:42224982-42225004 CAGGAGGATCAACCTGGGCCCGG + Intronic
905981914 1:42236403-42236425 CCGGAAGTTCAAGATGAGCTTGG - Intronic
916080631 1:161229755-161229777 CAGGGTGTTCCAGGTGAGCTGGG + Exonic
920338348 1:205259712-205259734 CAGGAAGTTCCACGGGAGCCAGG + Intronic
923606926 1:235452640-235452662 TAGGAGGATCAACTTGAGCCTGG - Intronic
1064089897 10:12374461-12374483 CAGGAGATACTACGTGAGCAAGG - Intronic
1074113747 10:110440547-110440569 CAGCAGGTTCAACGGGAGAAGGG - Intergenic
1075966524 10:126616498-126616520 CAGGAGGTGGAATGTGAGCTGGG + Intronic
1079477056 11:20842079-20842101 CAGGAGCTTCAGCATGGGCTGGG + Intronic
1081062857 11:38502855-38502877 CAGGAGGTGCAACATGGGTTTGG + Intergenic
1084385026 11:68838152-68838174 CAGGAGGGTCACCGTCACCTTGG - Intronic
1089990845 11:122858316-122858338 CAGGAGGATCAACTTGAGCCTGG - Intronic
1094330440 12:29285966-29285988 CATGAGGTTCAACATGATTTTGG + Intronic
1095988659 12:48018059-48018081 CAAGAGGTTAAAAGAGAGCTTGG + Intergenic
1103467575 12:121154027-121154049 TGGGAGGATCAACTTGAGCTCGG + Intronic
1104994629 12:132646019-132646041 CTGGAAGTTCAAGGTGAGCCTGG + Intronic
1105328649 13:19393941-19393963 CAGGATCATCAATGTGAGCTGGG - Intergenic
1105541347 13:21319882-21319904 CAGTAGGTTTATAGTGAGCTTGG + Intergenic
1105863242 13:24435593-24435615 CAGGATCATCAATGTGAGCTGGG + Intronic
1111369897 13:87303935-87303957 CAGGAGGTTTTATGTTAGCTGGG - Intergenic
1113039755 13:106091963-106091985 CTGAAGGTTCAACGGGAGGTTGG + Intergenic
1119061137 14:71476007-71476029 CAGGAGGTTTACAGTGAGGTAGG + Intronic
1121201940 14:92124956-92124978 AAGGAGGTGGAACATGAGCTGGG + Intronic
1121527491 14:94629322-94629344 CAAGAGGTTCAGCCTTAGCTAGG + Intergenic
1127430632 15:58904094-58904116 CCGGAGGATCAACTTGAGCCTGG - Intronic
1128585532 15:68846339-68846361 CAGGAAGTACAAGGTGAGCCTGG + Intronic
1129470851 15:75752575-75752597 CAGGAGGTGGAAGCTGAGCTAGG + Intergenic
1139214666 16:65115506-65115528 CTGAAGGCTCATCGTGAGCTAGG + Intronic
1139563486 16:67758382-67758404 CAGGAGGCTCAAAAGGAGCTCGG - Intronic
1140210213 16:72963559-72963581 CAGGTGGTTCCAAGGGAGCTTGG - Intronic
1141305138 16:82855797-82855819 CAGGAGGTTCACCGTGTGGCTGG - Intronic
1142667755 17:1472199-1472221 CAGGAGGCTCATCTTGAACTGGG + Exonic
1143714267 17:8755879-8755901 CAGGAGGGTCTTGGTGAGCTGGG + Intronic
1145993496 17:29092903-29092925 CAGGTGGTCCAGCATGAGCTGGG + Exonic
1148921307 17:51037194-51037216 CAGGAGGATCAACTTGAGCCTGG - Intronic
1157626310 18:49054006-49054028 CAGGAGGTTTTACGTGGGCTTGG + Intronic
1158204472 18:54976516-54976538 CAGGAGGCTCAACATGATCCTGG - Intergenic
1158283130 18:55849572-55849594 CAGGGAGTTGAACGTGAGCCAGG + Intergenic
1163008291 19:14409823-14409845 CAGGCCGTGCAGCGTGAGCTTGG + Exonic
1165130153 19:33626997-33627019 CAAGAAGTTCAAGATGAGCTTGG - Intronic
1167150098 19:47703406-47703428 CAGGGGGTTCAACATGAACAAGG + Intergenic
1167491582 19:49795688-49795710 CAGGAGCTTCACCGAGAGCCAGG - Exonic
1168256026 19:55165848-55165870 CAGGAGGTTCAACGTGAGCTGGG - Exonic
924998390 2:384722-384744 CAGGAGGTTGAACCTGAGGTGGG + Intergenic
930938891 2:56989496-56989518 CAGGGGGTTTAAAGTGAGGTTGG - Intergenic
937148626 2:119670196-119670218 CAGGAGATTCATCATAAGCTGGG - Intergenic
937385562 2:121428750-121428772 AAGGAGGCTCAACTTCAGCTAGG + Intronic
937922592 2:127141771-127141793 CAGGAAGTTCCGCGAGAGCTGGG - Intergenic
938274399 2:130005160-130005182 CACGAGGTTCAACATGATTTTGG - Intergenic
938440982 2:131332118-131332140 CACGAGGTTCAACATGATTTTGG + Intronic
1170000536 20:11608897-11608919 TAAGCGGTTCAACGTGGGCTTGG - Intergenic
1181266713 22:21634953-21634975 CAGGAAGTTCAGCGTGCGATGGG - Exonic
1183315314 22:37133796-37133818 CAGGAGGCTGAACTTGAGCCTGG - Intronic
1184225750 22:43128096-43128118 GAGGGGGTGCTACGTGAGCTCGG + Intronic
954327696 3:49872589-49872611 TAGGAGGCCCAACCTGAGCTGGG - Intergenic
961786397 3:129349722-129349744 GAGGGGGTTCTAGGTGAGCTGGG + Intergenic
962920108 3:139942996-139943018 TAGGAGGCTCAAAGTGAGCTAGG - Intronic
966682962 3:182662793-182662815 CAGGAGGTTCACTGTTTGCTTGG - Intergenic
971763369 4:30798183-30798205 AAGGAGATTCAACTTGAACTTGG + Intronic
971945267 4:33267285-33267307 CAGGAGTTTTAAGATGAGCTTGG - Intergenic
978989145 4:115056257-115056279 TAGGAGGATCAACCTGAGCCTGG + Intronic
979596645 4:122541934-122541956 CTGGACGTTGAACATGAGCTTGG + Intergenic
981312851 4:143313736-143313758 GAGGAGGTTGAATCTGAGCTAGG - Intergenic
994115646 5:96059030-96059052 CAGGAGGTTTAGGGAGAGCTGGG - Intergenic
996584297 5:125067394-125067416 CAGGAGTTTCAACTTAAGGTAGG + Intergenic
998528540 5:142864153-142864175 CAGAAGGTGGAACTTGAGCTTGG - Intronic
999263004 5:150249134-150249156 AAGGAGGTTCCACAAGAGCTGGG + Intronic
1002826175 6:776342-776364 CAAGAAGTTCACAGTGAGCTGGG - Intergenic
1006786437 6:36670591-36670613 GGGGAGGTTCAACTGGAGCTGGG + Intergenic
1010935925 6:81861332-81861354 CAGCAGCATCAACGTGATCTGGG - Intergenic
1019120810 6:169802051-169802073 CAGGAGGCTGATGGTGAGCTTGG + Intergenic
1023271693 7:38470029-38470051 CAGGATGTTCAACCTGATCAAGG - Intronic
1033060763 7:138104850-138104872 TAGGAGGATCCACTTGAGCTGGG - Intronic
1034218990 7:149430110-149430132 CAGGAGGTGGAATCTGAGCTGGG - Intergenic
1037563289 8:20094364-20094386 CAGGTGGCTTAACGTGAGTTGGG + Intergenic
1042959882 8:74292315-74292337 CAGGGGGTTCCAAGTGAGCATGG - Intronic
1045817557 8:106294301-106294323 CAGGAGAATTAACGTGAACTTGG + Intronic
1046080375 8:109363203-109363225 CAGGAGGATGAACCTGAGATAGG + Intronic
1048588367 8:135797239-135797261 CAGGAGGTCCAAAGTGAACGAGG + Intergenic
1053069907 9:35095181-35095203 TAGGAGGGTCAACCTGAGATCGG + Exonic
1053304811 9:36976891-36976913 CAGCAGATTCAAGGTGAGCTTGG + Intronic
1062268364 9:135697715-135697737 CTGGAGGGTCACTGTGAGCTCGG + Intronic
1187259593 X:17672968-17672990 AAGGAGGTGCAACTCGAGCTTGG + Intronic
1187389373 X:18875748-18875770 CAGGAGGTTCAGCCTCAGTTGGG + Intergenic
1192273678 X:69608796-69608818 CAGGAGGCGGAACTTGAGCTGGG + Intergenic
1192501649 X:71657919-71657941 CAGGAGGTCCAAGCTGAGGTGGG + Intergenic
1196734347 X:118971767-118971789 CAGGAGGTTGACCGTGAACTTGG - Intergenic
1200794188 Y:7325784-7325806 CAGGGGGTACACCGTCAGCTAGG - Intergenic