ID: 1168256043

View in Genome Browser
Species Human (GRCh38)
Location 19:55165930-55165952
Sequence CAGAAGCAGCACATCTAGCT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 231}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168256037_1168256043 7 Left 1168256037 19:55165900-55165922 CCGCAGCAGGTGCCGTCCATCCA 0: 1
1: 0
2: 1
3: 13
4: 127
Right 1168256043 19:55165930-55165952 CAGAAGCAGCACATCTAGCTCGG 0: 1
1: 0
2: 1
3: 18
4: 231
1168256038_1168256043 -5 Left 1168256038 19:55165912-55165934 CCGTCCATCCACAGAGCCCAGAA 0: 1
1: 1
2: 2
3: 40
4: 306
Right 1168256043 19:55165930-55165952 CAGAAGCAGCACATCTAGCTCGG 0: 1
1: 0
2: 1
3: 18
4: 231
1168256039_1168256043 -9 Left 1168256039 19:55165916-55165938 CCATCCACAGAGCCCAGAAGCAG 0: 1
1: 1
2: 5
3: 34
4: 401
Right 1168256043 19:55165930-55165952 CAGAAGCAGCACATCTAGCTCGG 0: 1
1: 0
2: 1
3: 18
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168256043 Original CRISPR CAGAAGCAGCACATCTAGCT CGG Exonic
901679715 1:10906080-10906102 CAGAAGCAGCCCCTCTGGCCAGG + Intergenic
903571671 1:24310364-24310386 AAGGTGGAGCACATCTAGCTTGG - Intergenic
905654720 1:39678740-39678762 CAGAAGCAGCACATCTGGAGGGG + Exonic
907849827 1:58245520-58245542 CAGAGGCAGGGCATCTAACTCGG - Intronic
909678392 1:78263631-78263653 CAGAGGCAGCACAGCTTGCAGGG - Intergenic
911080504 1:93924854-93924876 CAGCAGCAGCACATCTGAATGGG + Intergenic
911136767 1:94449018-94449040 CAGAAGCAGAACAACTGGTTTGG + Intronic
911473691 1:98349958-98349980 CAAAAGCAGCACCTCTTTCTTGG + Intergenic
914384930 1:147159298-147159320 CAGAAACAATACTTCTAGCTGGG + Exonic
916660161 1:166916056-166916078 GAGAAGCAGCTCATCTACCAGGG + Exonic
917056172 1:170984336-170984358 CAGAAGCAATACATCTAACATGG + Intronic
917873508 1:179263975-179263997 CAGAAGCAGTATTTCTAGCTAGG - Intergenic
919082657 1:192885614-192885636 CAGAAGCAGCACAACTGTCAAGG + Intergenic
920383524 1:205550150-205550172 CAAAAGCAGCCCAACAAGCTGGG + Intergenic
920428029 1:205894365-205894387 CAGAAGCAGAACAACTGGTTTGG + Intergenic
920885778 1:209926641-209926663 CAGAAGCAGCACAGGTAGAATGG - Intergenic
921462069 1:215440841-215440863 CAGAAGCAGGAAATATTGCTTGG + Intergenic
923783284 1:237043693-237043715 CAGAAGCTGCAGTTCTAGGTTGG - Intronic
1065479046 10:26174022-26174044 CAAAAGCAGCATATCTAGAAAGG + Exonic
1067079330 10:43204466-43204488 CAGAACCAGCACATCTCTCAGGG + Intronic
1067133754 10:43590193-43590215 CAGAAGCAGGACAACTGGTTTGG + Intergenic
1067742656 10:48907640-48907662 CAGAGGCACCACAGTTAGCTGGG + Intronic
1074541781 10:114371144-114371166 CAGAAGGAGCAGCTCCAGCTTGG - Intronic
1074821533 10:117183045-117183067 CAGAAGCAGCAGTTCCAGTTTGG + Intergenic
1076416700 10:130296017-130296039 CAGAAGCAGAACAACTGGTTTGG + Intergenic
1078921773 11:15837456-15837478 CAGGAGGAGCACTTCTGGCTGGG + Intergenic
1079004409 11:16781894-16781916 CAGAAGAAGCACACCTGGCCAGG + Intronic
1079417244 11:20250627-20250649 CAGAAGCAGGACATCTACTCTGG + Intergenic
1081331619 11:41807970-41807992 CAGAAGCAGCACATCTCTCAAGG + Intergenic
1086552775 11:88071373-88071395 CAGAAACAGTAGATCTTGCTGGG - Intergenic
1087275086 11:96153130-96153152 CAGAAGCAGAAAATCCAGATGGG - Intronic
1087963211 11:104377666-104377688 AAGAAGCAGCAAATCATGCTAGG - Intergenic
1090861079 11:130652951-130652973 CAGAATCTCCACATCTAGATGGG - Intergenic
1091848201 12:3673939-3673961 CAGAAGCAGCAGAGCGAGGTGGG - Intronic
1095498022 12:42806018-42806040 CAGAAGCTGATCATCTATCTGGG - Intergenic
1095719696 12:45386927-45386949 CAGAACCAGAACATTTAACTGGG - Intronic
1096539917 12:52301377-52301399 CAGAAACAGGTCATCTAGTTCGG + Intronic
1097167288 12:57092681-57092703 CAAAAGCAGGACATCCAGGTGGG - Intronic
1097455114 12:59790661-59790683 CTGAAGTAGGACATCTAGATTGG - Intergenic
1102089038 12:110170957-110170979 CAGCTGCAGCACATCTTGCCAGG - Intronic
1102094796 12:110229279-110229301 TAGAAGCAGAACATATTGCTGGG - Intergenic
1105352594 13:19629456-19629478 CAGAAGCAGAACAACTGGTTTGG + Intergenic
1105522789 13:21146045-21146067 AAGAAGAAACACATCTGGCTGGG + Intronic
1105711022 13:23009240-23009262 CAGAAGCAGAACAACTGGTTTGG + Intergenic
1105804571 13:23945741-23945763 GACAAGCAGCACAGGTAGCTGGG - Intergenic
1106385569 13:29282234-29282256 CAGAGGCAGCACTTCTCTCTGGG - Intronic
1106590262 13:31092465-31092487 CAGAAGCAGCCCATCTGACCTGG + Intergenic
1107296033 13:38908821-38908843 CAGAAGCAGTTCATCTATCCAGG + Intergenic
1107378960 13:39835018-39835040 CAGAAGAACCACATCTAACATGG + Intergenic
1108055952 13:46485319-46485341 CTGAATCAGCTCAGCTAGCTAGG + Intergenic
1109104975 13:58239411-58239433 CAGAAGCAGGACAGCTGGCCTGG - Intergenic
1109278982 13:60333965-60333987 CAGAAACAGCCCATCTGGTTGGG - Intergenic
1109285108 13:60399347-60399369 CAGAAGCAGCACAGACAGGTGGG - Intronic
1110522062 13:76491438-76491460 CAGAAGGAGCACATATTCCTCGG - Intergenic
1113680900 13:112244338-112244360 CGGAAGAAGCACAACTAGATGGG + Intergenic
1115529350 14:34312742-34312764 AAGAAGAAGAACAACTAGCTGGG - Intronic
1115589384 14:34849001-34849023 CAGAAACAGCACACGTGGCTAGG + Intronic
1116238239 14:42308825-42308847 CAGAAGCAGAACAACTGGTTTGG - Intergenic
1117083011 14:52170849-52170871 CAGAAGCAGAACAACTGGTTTGG + Intergenic
1117378798 14:55139405-55139427 CACTAGCAGCAAATCTAGGTGGG + Intronic
1119291403 14:73498178-73498200 CAGGAGCAGCACGTCTAGGAAGG + Exonic
1121464360 14:94104947-94104969 CAGAAGCAGCGAACCTGGCTGGG - Intronic
1122653123 14:103237684-103237706 CAGAAGCAGAACAACTGGTTTGG + Intergenic
1122866568 14:104607695-104607717 CAGATGCAGCACCTCAACCTTGG + Intergenic
1202843499 14_GL000009v2_random:145719-145741 CAGAAGCAGAACAACTGGTTTGG - Intergenic
1123457130 15:20436430-20436452 CAGAAGCAGCACAGAGAGCATGG + Intergenic
1123660932 15:22563929-22563951 CAGAAGCAGCACAGAGAGCATGG - Intergenic
1124263284 15:28211583-28211605 CAGAAGCAGCACAGAGAGCATGG + Intronic
1124314733 15:28658163-28658185 CAGAAGCAGCACAGAGAGCATGG - Intergenic
1124436134 15:29651404-29651426 CAGAAGCGGCCCATCTAGAATGG + Intergenic
1127732144 15:61811225-61811247 CAGAAGCAGTTCATAGAGCTTGG + Intergenic
1129419018 15:75408064-75408086 GAGAAGTAGCACATTTACCTTGG + Intronic
1129498216 15:76007723-76007745 CAGAAGAAGTACATTTAGGTTGG - Intronic
1130306528 15:82715372-82715394 CAGAAGAAGAACATCTAGCAAGG - Intergenic
1131037778 15:89235475-89235497 CAGAAGCAGAACAACTGGTTTGG - Intergenic
1131363991 15:91822015-91822037 CAGAAGGAGCTCAGCTAGTTAGG + Intergenic
1131759572 15:95605957-95605979 CAGAAGCATCAAATATAACTGGG + Intergenic
1131810430 15:96167766-96167788 GAGGAAGAGCACATCTAGCTTGG + Intergenic
1131867013 15:96721943-96721965 CAGAGGCAGCACAGCAGGCTGGG - Intergenic
1133044362 16:3078604-3078626 CAGAAGCAGAACAACTGGTTTGG - Intronic
1133953592 16:10419881-10419903 CAGAAGCAGAACAACTGGTTTGG - Intronic
1134114101 16:11535218-11535240 CAGCATCAGCACACCTGGCTTGG + Intergenic
1139311317 16:66030546-66030568 CAGAAGAACCACATCCAGCAAGG - Intergenic
1139503359 16:67386474-67386496 CAGAAGCAGCATATCTAGTCCGG - Intergenic
1143685420 17:8510823-8510845 CAGAAGCACCTCATCAAACTGGG + Intronic
1145772288 17:27502174-27502196 CAGAATCAGCAGACCTGGCTTGG - Intronic
1145936343 17:28717090-28717112 CAGAAGCACCAGGCCTAGCTGGG + Intronic
1146101558 17:29987475-29987497 CAGAAGCAGAACAACTGGTTTGG - Intronic
1146294298 17:31637293-31637315 CAGAAGCAGAACTTCTGGTTTGG + Intergenic
1146340714 17:32017575-32017597 CAGAAGGATCACTTCAAGCTAGG + Intronic
1147306650 17:39568798-39568820 CAGCAGCAGCCCAGGTAGCTGGG - Intergenic
1148639170 17:49172418-49172440 CAGAAGCAGAACAACTGGTTTGG - Intergenic
1149366148 17:55946885-55946907 CAGAAGCAAGACAGCTAGTTTGG - Intergenic
1150658213 17:67054301-67054323 CAGAAGCAGCACCTCCTGGTAGG + Intronic
1151361823 17:73593540-73593562 CAGAGGCAGAACACCTAGCTTGG + Intronic
1152817665 17:82418129-82418151 CAGCAGCAGCTCATCAGGCTGGG + Intronic
1152854273 17:82655271-82655293 CAGAAGCGGAACATGTAGCAAGG - Exonic
1153970456 18:10221682-10221704 CAGAAGCAGAACAACTGGTTTGG - Intergenic
1154218893 18:12434851-12434873 CAAAAGCAGGACATCTGCCTTGG - Intergenic
1154309464 18:13255804-13255826 CAGACGCACCACATCTCCCTCGG - Intronic
1155055010 18:22174703-22174725 AAGAAACAGGAAATCTAGCTAGG - Intronic
1156065836 18:33141428-33141450 CAGAAGCAGAAGAGCTGGCTGGG + Intronic
1156498862 18:37544256-37544278 CACAAGCAGCTCATCTAGGCAGG + Intronic
1157541484 18:48513764-48513786 CAGAAGCATGGCATTTAGCTGGG - Intergenic
1159961105 18:74556345-74556367 CAGCAGCAGCACAGCCAGCAGGG - Exonic
1160022725 18:75192885-75192907 CAGAAAAAGCACATCAAGCCTGG + Intergenic
1162642863 19:12026092-12026114 CAGAAGCAGAACAACTGGTTTGG + Intronic
1162754959 19:12852319-12852341 CAGATGCACCACATCTAGGGAGG - Exonic
1163817724 19:19477123-19477145 CAAAGGCAGCAGATCCAGCTTGG - Intronic
1164257131 19:23538042-23538064 CAGAAGCAGAACAACTGGTTTGG + Intronic
1164261801 19:23574312-23574334 CAGAAGCAGAACAACTGGTTTGG - Intronic
1165865787 19:38936932-38936954 CAGAAGCAGAACAACTAGTTTGG - Intronic
1166031824 19:40136993-40137015 CTGAAGCAGCAAATCCTGCTTGG - Intergenic
1167501845 19:49852587-49852609 CAGGAGCAGCACATCAAGATGGG - Intronic
1168256043 19:55165930-55165952 CAGAAGCAGCACATCTAGCTCGG + Exonic
927118303 2:19926707-19926729 CAGAAGCAGAACAACTAGTTTGG + Intronic
927271988 2:21221179-21221201 CAGAGGCAGCACAGCTATGTGGG + Intergenic
928084416 2:28336936-28336958 CAGAAGCAGCAAATCTGGAGTGG - Intronic
928893990 2:36240150-36240172 CAGAGGCAGGACAGCAAGCTAGG - Intergenic
929021803 2:37560698-37560720 AAGAAACAGCACATTCAGCTGGG - Intergenic
929101458 2:38318622-38318644 CATAAGCAGCACAGCAACCTAGG + Exonic
930183605 2:48388897-48388919 CAGAAGCAGAACAACTTGTTTGG + Intergenic
930799232 2:55425242-55425264 CAGAAGCAGCATATTTGGCTGGG - Intergenic
931228362 2:60352953-60352975 CAGGTGCAGCACAGCTGGCTAGG + Intergenic
933697395 2:85229890-85229912 CCGCAGCAGCCCATGTAGCTGGG - Intronic
935933048 2:108150635-108150657 AAGAAGCAGAACATCTACATGGG + Intergenic
937378636 2:121355489-121355511 CAGAAGCTGCACATTAAGATGGG + Intronic
938379331 2:130827798-130827820 CAGCACCAGCACAACCAGCTCGG - Intergenic
943002289 2:182343431-182343453 CATAAGCAGCAGACCTAACTAGG + Intronic
943092289 2:183389777-183389799 CAGAGGCAGCACAGCTTGCAGGG + Intergenic
945788805 2:214277925-214277947 CAGAGGCAGCCCACCTTGCTGGG + Intronic
947316560 2:228865914-228865936 CAGCAGCAGCCCATCTAGAGTGG + Intronic
947873659 2:233453794-233453816 CAGGAGCAGGACTTCCAGCTGGG + Intronic
948211923 2:236200526-236200548 CAGAAGCAGCAGTCCTCGCTTGG + Intronic
1172611793 20:36257929-36257951 CTGAAGCAGCAAATCCAGATGGG + Intronic
1176458396 21:6932847-6932869 AGGAAGCAGCTGATCTAGCTTGG + Intergenic
1176836569 21:13797941-13797963 AGGAAGCAGCTGATCTAGCTTGG + Intergenic
1178411217 21:32365147-32365169 CAGAGGAGGCACATCTGGCTGGG + Intronic
1180350071 22:11793568-11793590 CAGAAGCAGAACAACTGGTTTGG + Intergenic
1180374355 22:12077013-12077035 CAGAAGCAGAACAACTGGTTTGG + Intergenic
1180388135 22:12198684-12198706 CAGAAGCAGAACAACTGGTTTGG - Intergenic
1181978604 22:26750537-26750559 CACAAGCAGCAAATCAATCTTGG - Intergenic
1182337076 22:29591103-29591125 CAGAAGCAGCACTTGAACCTGGG + Intergenic
1182342305 22:29633295-29633317 GAGAAGCAGCAAATCTGGCAGGG - Intronic
1183014034 22:34971328-34971350 CAGAAGCAGCATCTCTGGGTGGG + Intergenic
1185271488 22:49931317-49931339 CAAAGGCGCCACATCTAGCTGGG + Intergenic
949572122 3:5303466-5303488 CAGAAACAGCACACCTAGCTAGG - Intergenic
950296521 3:11837214-11837236 CAGAAGCAGCACATCACTGTTGG + Intronic
951171003 3:19541501-19541523 CAGAAGCACCACAGGTTGCTGGG - Intergenic
952153657 3:30619862-30619884 CAGAGACAGCACAGGTAGCTTGG - Intronic
952631010 3:35467178-35467200 GGGAAGCAGCAGAGCTAGCTGGG + Intergenic
952906026 3:38139566-38139588 CAGAAGAAGCAGACCTACCTTGG + Intronic
953682078 3:45047015-45047037 CAGAAGCAACACAGCTTGCCAGG - Intergenic
953683411 3:45057368-45057390 CAGAAGCAGGCCATCATGCTGGG - Intergenic
954232922 3:49232409-49232431 CAGAAGCAGAACAACTGGTTTGG + Intronic
954338652 3:49935979-49936001 GAGAAGCAGAACAGCTAGTTGGG + Intergenic
955405490 3:58623134-58623156 CAGAAGGTACACATCTGGCTGGG - Intronic
957099104 3:75806377-75806399 CAGAAGCAGAACAACTGGTTTGG - Intergenic
959276486 3:104283193-104283215 CAGAAGCAGAACAACTGGTTTGG - Intergenic
961859656 3:129905525-129905547 CAGAAGCAGAACAACTGGTTTGG + Intergenic
963112463 3:141698789-141698811 CAGAAGCAGGGCATCTAGGGAGG + Intergenic
963995656 3:151705533-151705555 CAGAAGCAGAACAACTGGTTTGG + Intergenic
964246611 3:154661167-154661189 CAGAAGCAGCACACAAAGATGGG - Intergenic
966356355 3:179083428-179083450 CATAATCAGTACATCTACCTAGG - Intergenic
969662254 4:8537127-8537149 CAGAGGCAGCACAGCTGCCTGGG + Intergenic
970016767 4:11520671-11520693 CAGCAGCAGCACATTCAGCCTGG - Intergenic
970332807 4:15002948-15002970 CAGAAGCAGCTCATCCTGCATGG - Exonic
973008880 4:45047290-45047312 CAGAAGCAGAACAACTGGTTCGG + Intergenic
974636293 4:64567848-64567870 CAGAAGCAGAACAACTGGTTTGG + Intergenic
974804120 4:66857820-66857842 CAAGAGCTGCACATCTAGCCAGG - Intergenic
975353150 4:73368490-73368512 CAGAAGCAGAACAACTAGTTTGG + Intergenic
977652683 4:99488153-99488175 CAGAAGCAGAACAACTGGTTTGG - Intergenic
979982418 4:127273168-127273190 CAGAAGCAGAACAACTGGTTAGG - Intergenic
980208035 4:129747704-129747726 CAGAAGTAGCAAATTTAGATAGG + Intergenic
981540378 4:145840296-145840318 CAAAAGCACCACATCTAGAGGGG + Intronic
981584329 4:146284924-146284946 GAGAAGGATCACCTCTAGCTTGG + Intronic
981738283 4:147975509-147975531 CAGATGCAGCTCATCAACCTTGG - Intronic
982281734 4:153690135-153690157 CAGAAGCAGAACAACTGGCTTGG - Intergenic
984170090 4:176348977-176348999 CAGAAGCAGAACAACTGGTTTGG + Intergenic
1202755938 4_GL000008v2_random:62452-62474 CAGAAGCAGAACAACTGGTTTGG + Intergenic
985501238 5:248073-248095 CAGAAGCAGAACAACTGGTTTGG + Intronic
985622603 5:963312-963334 CCGAGGCAGCACCTCTGGCTTGG + Intergenic
985735650 5:1579564-1579586 CAGAAGCAGAACAACTGGTTTGG - Intergenic
988157927 5:27478509-27478531 AAGAATCAGCACATGTAGCTTGG + Intergenic
988800025 5:34687961-34687983 CATAAGCATCTCATCTAGCCTGG - Intronic
988810830 5:34783529-34783551 CAGAAGCAGAACAACTGGTTTGG - Intronic
989513208 5:42312227-42312249 CAGAAGCAGCACAGCTTAGTGGG - Intergenic
989662756 5:43816810-43816832 GAGAAGCAGCACATCTTACATGG - Intergenic
993307218 5:86288324-86288346 CTGAAGAAGAAAATCTAGCTTGG - Intergenic
994247071 5:97489673-97489695 CAGCAGCAGCACATCTGGAGAGG - Intergenic
995711227 5:115037831-115037853 CAGAAGCAGAACAACTGGTTTGG - Intergenic
999302698 5:150500937-150500959 CAGTGGCAGATCATCTAGCTGGG + Intronic
999321163 5:150615969-150615991 CAGAAGCACCTCTTCTATCTTGG - Intronic
1000654739 5:163862849-163862871 CAGAGAAAGCACATCTAGTTCGG + Intergenic
1001728181 5:173925815-173925837 TAGGAGCAGCACTTCTAGTTAGG + Intronic
1002806955 6:586546-586568 CAGAAGCACTTCATCGAGCTTGG + Intronic
1003190861 6:3873193-3873215 CAGGAGCAGCACATTCAGCCTGG - Intergenic
1007886867 6:45239998-45240020 CAGAAGCAGAACAACTGGTTTGG + Intronic
1008082234 6:47206574-47206596 CAGAAGCAGCAGTTCCAGCAAGG + Intergenic
1011076745 6:83446530-83446552 CAGAATCAGAACATGTAGATTGG + Intergenic
1011493359 6:87915239-87915261 CAGAAGAAGCAGAACAAGCTGGG - Intergenic
1013519634 6:110921305-110921327 CAGAAGCAGAACAACTGGTTTGG + Intergenic
1016097163 6:140052480-140052502 GACAAGCAGCACATGTGGCTAGG + Intergenic
1017301383 6:152863545-152863567 TAGATGGAGCACATTTAGCTTGG + Intergenic
1019178638 6:170174164-170174186 CAGAAGCAGCAGAAGCAGCTAGG - Intergenic
1019466485 7:1192347-1192369 CAGAAGCAGGAAGTCCAGCTGGG - Intergenic
1020508080 7:9018775-9018797 CAGAAGCAGAACATGGAGATTGG + Intergenic
1020678529 7:11208245-11208267 CAGAAGCAGCAAACCTGGCTTGG - Intergenic
1021425689 7:20496507-20496529 CAGAACCAGCACAGCTTGTTGGG - Intergenic
1022100002 7:27163873-27163895 CAGAAGACGCACATCCCGCTGGG + Intronic
1023009240 7:35910834-35910856 CAGAAGCAGAACAACTGGTTTGG + Intergenic
1024309354 7:47954886-47954908 CATAACCAGCATATGTAGCTTGG - Intronic
1024688787 7:51777315-51777337 CAGAGCCAGCACTTCTAGCTAGG + Intergenic
1025122910 7:56320986-56321008 CAGAAGCAGAACAACTGGTTTGG + Intergenic
1025819517 7:64949014-64949036 CAGAAGCAGAACAACTGGTTTGG + Intergenic
1026059315 7:67011888-67011910 AAGAAGCAGCACATAGAGCTGGG + Intronic
1028779886 7:94724052-94724074 CAGAAGCAGAACAACTGGTTTGG - Intergenic
1029703768 7:102264722-102264744 GAGAAGCAGCTCATCTGGCATGG - Intronic
1031141039 7:117943972-117943994 CAGAATCAGAACATCTGGGTAGG + Intergenic
1032288564 7:130564974-130564996 CAGAAGCAGCAATTTTAGCAGGG + Intronic
1032482667 7:132259273-132259295 GAAAACCAGCCCATCTAGCTGGG + Intronic
1037917775 8:22783056-22783078 CAGAAGCTGCACACCTGGCTGGG + Intronic
1038465263 8:27756485-27756507 GATAAGCAGTGCATCTAGCTGGG + Intronic
1038643725 8:29347549-29347571 CAGAAGCTGAACTTCTGGCTAGG + Intronic
1039618749 8:38977478-38977500 CTGAGTCAGCACATCTATCTGGG - Intronic
1040956037 8:52980819-52980841 CAGAAGCAGAACAACTGGTTTGG - Intergenic
1041019297 8:53622304-53622326 CAGAAGCAGAACAACTGGTTTGG + Intergenic
1042271538 8:66961487-66961509 CAGCAGCAGCACGTCCAGCTTGG + Exonic
1044726983 8:95202030-95202052 AAGAAGCAGAACAACTTGCTGGG + Intergenic
1047104821 8:121720489-121720511 CAGCAGCAGCCCATCTAGAGTGG - Intergenic
1048291314 8:133183719-133183741 CAGGAGCCTCACATCCAGCTGGG + Intergenic
1048948740 8:139475279-139475301 CAGAAGCAGCACAACTAAAAAGG - Intergenic
1049563301 8:143324264-143324286 CTGGGGCAGCAAATCTAGCTGGG + Intronic
1049744034 8:144255576-144255598 CAGAAGCACCACAAACAGCTGGG - Exonic
1051401110 9:16683755-16683777 CAGAAGAAGCACATTTAGGAAGG + Intronic
1052939871 9:34124777-34124799 TAGAAGCAGCACATCCAGAGAGG + Intronic
1053134211 9:35639495-35639517 CAGAAGCAGCACAACTGTCAAGG + Intronic
1054817346 9:69487758-69487780 CAGAAGCAGCCCCTCCAACTTGG + Intronic
1056183962 9:84113449-84113471 CAGAAGGAGGACCTCTATCTAGG - Intergenic
1059456668 9:114404099-114404121 GAGAAGCAGCTTATATAGCTGGG + Intronic
1059625844 9:116065152-116065174 CAGAGGCAGGACAGCTATCTGGG + Intergenic
1062670706 9:137707289-137707311 CAGAAGCAGCATCCCTTGCTGGG + Intronic
1203536743 Un_KI270743v1:47289-47311 CAGAAGCAGAACAACTGGTTTGG + Intergenic
1192885052 X:75328081-75328103 CAGAAGCAGAACAACTGGTTTGG + Intergenic
1193314324 X:80046496-80046518 CAGAAGCAGAATAACTAGTTTGG + Intergenic
1194749965 X:97673165-97673187 TAGATGCAGCCCATGTAGCTGGG + Intergenic
1196472020 X:116039479-116039501 CAGAAGCAGAACAACTGGTTTGG + Intergenic
1198146952 X:133867512-133867534 CAGCAGCTGCATATCTAGGTGGG - Intronic
1199287283 X:146067693-146067715 GAAAAGCAGCACATATAACTTGG - Intergenic
1201168708 Y:11235865-11235887 CAGAAGCAGAACAACTGGTTTGG - Intergenic
1201362788 Y:13171479-13171501 CAGAAGCAGAACAACTCGTTTGG - Intergenic