ID: 1168257416

View in Genome Browser
Species Human (GRCh38)
Location 19:55174301-55174323
Sequence GTGTCCTATCTGCTCTAAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 81}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168257416_1168257423 8 Left 1168257416 19:55174301-55174323 CCCGCTTAGAGCAGATAGGACAC 0: 1
1: 0
2: 0
3: 13
4: 81
Right 1168257423 19:55174332-55174354 AATTTTAAGGAGTCTCTTCCTGG 0: 1
1: 0
2: 3
3: 12
4: 190
1168257416_1168257427 27 Left 1168257416 19:55174301-55174323 CCCGCTTAGAGCAGATAGGACAC 0: 1
1: 0
2: 0
3: 13
4: 81
Right 1168257427 19:55174351-55174373 CTGGAGTGGAAGAGGCTTCCTGG 0: 1
1: 0
2: 2
3: 41
4: 416
1168257416_1168257418 -5 Left 1168257416 19:55174301-55174323 CCCGCTTAGAGCAGATAGGACAC 0: 1
1: 0
2: 0
3: 13
4: 81
Right 1168257418 19:55174319-55174341 GACACCCACACCCAATTTTAAGG 0: 1
1: 0
2: 1
3: 13
4: 127
1168257416_1168257424 13 Left 1168257416 19:55174301-55174323 CCCGCTTAGAGCAGATAGGACAC 0: 1
1: 0
2: 0
3: 13
4: 81
Right 1168257424 19:55174337-55174359 TAAGGAGTCTCTTCCTGGAGTGG 0: 1
1: 0
2: 1
3: 19
4: 178
1168257416_1168257425 19 Left 1168257416 19:55174301-55174323 CCCGCTTAGAGCAGATAGGACAC 0: 1
1: 0
2: 0
3: 13
4: 81
Right 1168257425 19:55174343-55174365 GTCTCTTCCTGGAGTGGAAGAGG 0: 1
1: 1
2: 3
3: 35
4: 265

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168257416 Original CRISPR GTGTCCTATCTGCTCTAAGC GGG (reversed) Intronic
901689638 1:10964348-10964370 GTGTCCTATTTGCTGTGAACAGG - Intronic
901848836 1:12002162-12002184 GTGTCCTAACTGCCCAAGGCAGG - Intronic
905294584 1:36946241-36946263 GTGTCCCATCTGCTCTGTCCTGG - Intronic
910229757 1:84974029-84974051 TTTTCCTTTCTGCTCTAACCGGG - Intronic
916997627 1:170317576-170317598 CTGTCCTATATGCTCTAACCAGG - Intergenic
917935080 1:179858703-179858725 GTGTCCTGTCTCTTCTCAGCTGG - Intronic
918291027 1:183107890-183107912 GTGCCCCATGAGCTCTAAGCTGG + Intronic
920067146 1:203277020-203277042 ATGTCCTACCTGCTCTAGGCTGG - Intergenic
920071707 1:203307053-203307075 ATGGCCTAGCTGCTCTAACCAGG + Intronic
1065164478 10:22960809-22960831 GGGTCCTATCTGGTCTCAGTGGG - Intronic
1066282175 10:33928065-33928087 GTGTCCTACCTCTTCTTAGCAGG - Intergenic
1073177507 10:101565417-101565439 GTGTCCTATGCCCTCTAGGCTGG - Intergenic
1076148839 10:128146866-128146888 ATGGCCTCTCTGCTCTAAGAAGG + Intergenic
1076929473 10:133520461-133520483 GTGTCCTGTCTCCTGTCAGCCGG - Exonic
1079149527 11:17884971-17884993 GTGACTTAACTGCTCTGAGCGGG - Intronic
1079184094 11:18221010-18221032 GTCTCCTCTCTGCTAAAAGCTGG - Intronic
1081886538 11:46502303-46502325 GATTCCTAACTGCTTTAAGCAGG + Intronic
1082943505 11:58733631-58733653 GTGTCCTTTCTTACCTAAGCAGG + Intergenic
1090622061 11:128568983-128569005 GTGTACAGACTGCTCTAAGCAGG - Intronic
1093417864 12:18941350-18941372 CTGTCCTCTCTGCTCTATTCTGG - Intergenic
1098365843 12:69702247-69702269 GTGGCTTGTCTCCTCTAAGCAGG - Intergenic
1106093679 13:26623003-26623025 GTGTCCTGTCTACTCTCAGATGG - Intronic
1107229092 13:38086595-38086617 GTCTCCTCTCTGCTGTGAGCTGG + Intergenic
1109683489 13:65783883-65783905 GTATCCTCTCTGCTGAAAGCTGG - Intergenic
1111202793 13:84961782-84961804 GTTTCCTATCTGCTGAGAGCTGG - Intergenic
1119995012 14:79243932-79243954 GTGGCATATCTGCTAAAAGCTGG - Intronic
1120634994 14:86940305-86940327 TTGTCATATCTGCCCTAGGCTGG - Intergenic
1126332562 15:47549239-47549261 GTTTCCTGTTTCCTCTAAGCAGG - Intronic
1135296126 16:21280797-21280819 GTTCCCTATCTTCTCTGAGCAGG - Intronic
1136624346 16:31452794-31452816 GTGTCCTATCAGGTCTGAGGAGG + Intergenic
1143254334 17:5544392-5544414 GTCTCCCATCTGCTTTAGGCTGG + Intronic
1147877505 17:43632171-43632193 GTGTCCTCTCTGCCCAAAGCAGG + Intergenic
1148147422 17:45374610-45374632 GTGTCTTTTCTCCTCAAAGCCGG + Intergenic
1154357465 18:13632885-13632907 GTCTCCTCTCTGATCTGAGCTGG - Intronic
1154357484 18:13633003-13633025 GTCTCCTCTCTGCTCTGAGCTGG - Intronic
1163089637 19:15010844-15010866 GTGTCCTGGCTGCGCTCAGCCGG - Exonic
1164310275 19:24040041-24040063 GTGTTCTATCTTTTCTAAGCTGG - Intronic
1168257416 19:55174301-55174323 GTGTCCTATCTGCTCTAAGCGGG - Intronic
925990170 2:9248440-9248462 GTGTTCTATCCTCTCTACGCTGG - Intronic
926258552 2:11233756-11233778 GTGTACTATATGTTCTTAGCTGG - Intronic
927059178 2:19397987-19398009 GAGTCCTGTCTCCTCTAAGTTGG - Intergenic
928823488 2:35391536-35391558 GTGTCCTGTCTGCTGAGAGCTGG - Intergenic
935678009 2:105612629-105612651 ATGTCCAATCTTTTCTAAGCTGG - Intergenic
937635048 2:124146052-124146074 TTGTCCTATCTGCTTTAAGTGGG - Intronic
938905956 2:135836447-135836469 ATGTCGAATCTGCTCTAAGGAGG + Intronic
943254410 2:185575679-185575701 GTATTTTATCTGCTCTAATCTGG - Intergenic
947080218 2:226387768-226387790 GTGTTCTTTCTGCTCTCAGCTGG - Intergenic
947646488 2:231745564-231745586 GAGCCCGATCTCCTCTAAGCAGG - Intronic
1178608345 21:34058352-34058374 GTGTTGTAGCTGCTCTAGGCAGG + Intergenic
1179513490 21:41890904-41890926 GTGTCCCATCTGCTCTGCCCAGG + Intronic
1184509992 22:44927739-44927761 CTGACCTTTCTGCTCCAAGCTGG + Intronic
1184875741 22:47274350-47274372 GTGTCTCATGTGCTCTCAGCTGG + Intergenic
952596593 3:35026386-35026408 GTGAAATAGCTGCTCTAAGCAGG + Intergenic
953603099 3:44387182-44387204 GTCTCCTCTCTGCTGAAAGCTGG + Intronic
954729432 3:52645760-52645782 CTGTCCTATCTGGTCTCACCTGG - Intronic
955432226 3:58858506-58858528 GGGTCCCATCTGCTCCAAGTAGG - Intronic
957508692 3:81158909-81158931 GTGTCCTATATGGTCTATGCTGG - Intergenic
957788002 3:84905682-84905704 GTGTCCTCTCTGCTGAGAGCTGG + Intergenic
960541453 3:118866277-118866299 TTGTCCTTTCTGCTCTAACAGGG + Intergenic
960588596 3:119344313-119344335 GTGTCCTATCTGGTTTCAGACGG - Intronic
961406502 3:126683498-126683520 ATGCCCTCTCTGCTCTAAGCAGG + Intergenic
961867139 3:129961711-129961733 GTGCCCTACCTGCTCTTCGCTGG + Intergenic
964557203 3:157952757-157952779 GTGTGCTGTCTGCTTTCAGCTGG - Intergenic
965267342 3:166560857-166560879 GTGTCCCATCGGCTCTAAGAAGG - Intergenic
965782978 3:172307441-172307463 GTGTCCTTTCCCCCCTAAGCTGG + Exonic
968839249 4:2989635-2989657 GTGTCCTTTCTGCACTCAACTGG + Intronic
971714073 4:30153307-30153329 GTACCCTATCTGCTGAAAGCTGG - Intergenic
977851375 4:101833720-101833742 GTTTCCTATTTCCTCTAAGTAGG + Intronic
984203355 4:176755294-176755316 GTCTCCTGTCTGCTGTAAGTGGG - Intronic
984866468 4:184284403-184284425 GTTTCTTCTCTGCCCTAAGCAGG + Intergenic
992452699 5:76887847-76887869 CTGTCCTATCTGCTCAGAACTGG - Intronic
996167122 5:120237890-120237912 CTGTCGTTTCTGCTCTAAGGAGG + Intergenic
996923812 5:128799858-128799880 GTCTCCTATCTGCTAGGAGCTGG - Intronic
997209390 5:132068579-132068601 GTGGGCTTTCTGCTCTCAGCAGG - Intergenic
997379921 5:133428336-133428358 TTGCCCTAGCTGCCCTAAGCTGG + Intronic
998156060 5:139787905-139787927 GTCTCCTATCCGCTCCAACCCGG - Intergenic
1004217498 6:13716461-13716483 GGGTCCTGTCTTCTCTAGGCAGG + Intergenic
1007312829 6:40960415-40960437 GTGTCCTATGTGTCCTAAGATGG + Intergenic
1009243334 6:61204779-61204801 GTCTCCTCTCTGCTGTGAGCTGG - Intergenic
1013279285 6:108620453-108620475 GGGTCCTATCTGCAAAAAGCAGG - Intronic
1013318226 6:108961351-108961373 GTGTCCTCTCTGCTCTGGCCAGG + Intronic
1016189475 6:141245696-141245718 GTGTTGTATCTGCACTAAGCTGG - Intergenic
1017940490 6:159048525-159048547 AAGTCCTATCTCCTCTAAGAAGG + Intergenic
1019274770 7:170250-170272 GTGTTCTATGTGCACTAAGATGG - Intergenic
1026106984 7:67429215-67429237 GTCTCCTATTTGCCCAAAGCTGG + Intergenic
1028426795 7:90698561-90698583 ATGTCCTATCTGATCAAAGGAGG - Intronic
1029520752 7:101060383-101060405 GTGTCCTATTTGCTCTAAAGTGG + Intergenic
1031001314 7:116418462-116418484 CTGTTCTATCTGTTCTAAGGAGG - Intronic
1037980535 8:23250179-23250201 GTGTCCTCTTTGCTCTCTGCGGG + Intronic
1052240407 9:26265484-26265506 GGTTCCTCTCTGCTCTTAGCAGG - Intergenic
1059482599 9:114603139-114603161 GTGCCTTATCTTCTCTAATCTGG - Intergenic
1061019348 9:128004105-128004127 GTGTCCTAGCAGCTGTCAGCAGG + Intergenic
1186062146 X:5720360-5720382 GTATCCTACCTTCTCTAGGCAGG + Intergenic
1186573391 X:10739486-10739508 GTCTCCTATCTGCTCTCAGAAGG + Intronic
1198432098 X:136577673-136577695 GTCTCCTTTCTTCTCTAACCTGG - Intergenic