ID: 1168258919

View in Genome Browser
Species Human (GRCh38)
Location 19:55181959-55181981
Sequence CAGTGGGACGAGGGACCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 202}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168258919_1168258927 0 Left 1168258919 19:55181959-55181981 CCCCAGGGTCCCTCGTCCCACTG 0: 1
1: 0
2: 1
3: 13
4: 202
Right 1168258927 19:55181982-55182004 CCTCCCGTCCTGTGTTGCTGAGG 0: 1
1: 0
2: 0
3: 14
4: 187
1168258919_1168258928 1 Left 1168258919 19:55181959-55181981 CCCCAGGGTCCCTCGTCCCACTG 0: 1
1: 0
2: 1
3: 13
4: 202
Right 1168258928 19:55181983-55182005 CTCCCGTCCTGTGTTGCTGAGGG 0: 1
1: 0
2: 0
3: 15
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168258919 Original CRISPR CAGTGGGACGAGGGACCCTG GGG (reversed) Intronic
902383425 1:16063381-16063403 CTGTGGGACCAGGGGCCCTAAGG - Intronic
902594976 1:17503197-17503219 CAGGGGGATGAGAGACCATGAGG + Intergenic
902659119 1:17889227-17889249 GGGAGGGACGAGGGACCCAGGGG - Intergenic
903339855 1:22647164-22647186 GACAGGGAGGAGGGACCCTGAGG - Intronic
903952694 1:27005412-27005434 CACTGGGAGGAGGGAAACTGAGG - Exonic
904923522 1:34027930-34027952 AAGTGGGGCGAGGGCTCCTGGGG + Intronic
906117437 1:43366123-43366145 CAGGGACAGGAGGGACCCTGGGG - Intronic
906942380 1:50266469-50266491 CACTGGAAAGAGGGACTCTGTGG + Intergenic
907046479 1:51303052-51303074 CAGGGGGACCTGGGGCCCTGGGG - Intronic
907213583 1:52843272-52843294 CACTGGGGCGAGGAATCCTGAGG - Intronic
907242064 1:53086362-53086384 CAGTGGGAGGAGGTGTCCTGGGG + Intergenic
912684772 1:111753859-111753881 TAGTGTGATGTGGGACCCTGGGG + Intronic
913375576 1:118148237-118148259 CAGTGAGACGAGGAACCCACTGG - Intronic
915281825 1:154828021-154828043 CAGTGGGAAGGGAGACTCTGGGG + Intronic
915861409 1:159449174-159449196 CAGTGGGCAGAGGGAGACTGTGG - Intergenic
916006917 1:160670681-160670703 CAGTAGGAAGAGGCAGCCTGAGG + Intergenic
916577836 1:166082858-166082880 CATTGGAACGAGTGTCCCTGGGG + Intronic
916712252 1:167422092-167422114 CAGTAGGTTCAGGGACCCTGAGG + Exonic
917655453 1:177121338-177121360 AAATGGAACGAGGGGCCCTGGGG + Intronic
918302504 1:183216810-183216832 GAGTGGGAAGAGGCACCTTGAGG + Intronic
922763850 1:228147757-228147779 CTGTGGCACCAGGGACCCTGTGG + Intronic
1066058766 10:31704299-31704321 CAGTGGGAAGGGGGAGCATGCGG + Intergenic
1066058979 10:31705956-31705978 CAGAGGGATGGGGGAGCCTGGGG - Intergenic
1066349557 10:34624801-34624823 CAGTGGGACGTGGGCCCTGGAGG - Intronic
1068757232 10:60669453-60669475 AAGTGGGATTAGGGACCCAGCGG - Intronic
1069908254 10:71744761-71744783 GATTAGGACCAGGGACCCTGAGG + Intronic
1069962410 10:72086976-72086998 GGGTCGGACGAGGGAACCTGGGG + Intronic
1070636297 10:78130863-78130885 CAGTGGGAAGAAGGAGCATGTGG - Intergenic
1071500825 10:86203265-86203287 CAGTGGGAGGAGGGGCCCTGAGG + Intronic
1076206895 10:128610851-128610873 CAGCGGGAGGAGGCACCGTGAGG - Intergenic
1077996429 11:7456384-7456406 CAGTGGGTGGAGGCACCCAGAGG + Intronic
1080846721 11:36033297-36033319 CAGCAGGACCAGGGATCCTGGGG - Intronic
1081881842 11:46459929-46459951 CAGTGAAAAGAGGGAACCTGAGG - Intronic
1083321210 11:61848153-61848175 CAGTTGGCAGAGGCACCCTGTGG - Exonic
1083992201 11:66253383-66253405 CAGTGGGACGAGGGCTTCTGAGG + Intergenic
1085865282 11:80283403-80283425 CAGTGGGAAGAGGGAGCAGGAGG - Intergenic
1086432275 11:86747424-86747446 CAGTTGTAGGAGAGACCCTGGGG + Intergenic
1089004991 11:115083866-115083888 CAGTGGGGTGGGGGATCCTGGGG - Intergenic
1089685184 11:120142139-120142161 GTGTGGGAGGAGGGACTCTGTGG - Intronic
1090113691 11:123943358-123943380 CAGTGGGGCAAAGGACCCAGAGG + Exonic
1090381569 11:126331235-126331257 CAGTGGCACAAGGCACTCTGTGG + Intronic
1090621803 11:128567206-128567228 CAGTGGGACATGGGTACCTGGGG - Intronic
1092163163 12:6327376-6327398 CAGTGGGGAGCGGGACCCCGTGG - Exonic
1092246669 12:6867803-6867825 CTGTGGGACGAGGGCCGCTGGGG + Intronic
1094855128 12:34399479-34399501 CGGTGGGTCGAGGCACTCTGTGG - Intergenic
1098134581 12:67388824-67388846 CAGTTGGAGGAGGGACTTTGAGG + Intergenic
1100051999 12:90460300-90460322 ATGTGGTAGGAGGGACCCTGTGG + Intergenic
1103621444 12:122189674-122189696 GAGTGGGAGGAGGGAGCCAGAGG - Intronic
1103910654 12:124350212-124350234 CAGTGGGGCGAGGGGCACTCTGG + Intronic
1107634691 13:42380540-42380562 GAGTGGGACAAGGGAACCTCTGG - Intergenic
1108570414 13:51744035-51744057 CAGTGGGCCAAGGATCCCTGAGG + Intronic
1108685166 13:52813209-52813231 CAGAGGGAAGCAGGACCCTGAGG - Intergenic
1111170263 13:84518099-84518121 CTGTTGGAGGTGGGACCCTGCGG + Intergenic
1112404170 13:99103423-99103445 CAGGGTGAAGAGGGACCCTAAGG + Intergenic
1117325589 14:54666209-54666231 CAGTGGAAGGAGGGACCCAGAGG + Intronic
1118745563 14:68770605-68770627 CAGTGTGATTAGGGACACTGTGG + Intergenic
1119195507 14:72714355-72714377 CACAGGGAAGAGGGGCCCTGGGG + Intronic
1119390576 14:74288691-74288713 AAGTGGGGAGAGGGACCCTCAGG - Intronic
1121092226 14:91190719-91190741 AAGTGGGACGAGGGACAGAGAGG + Intronic
1122203366 14:100136014-100136036 GAGTGGGAGGGGGGACCCTTCGG + Intronic
1122234282 14:100323214-100323236 CACTGGGACAAGGGTCCCGGGGG + Intergenic
1122372165 14:101234765-101234787 CAGTGAGCCCAGGGACCCGGGGG + Intergenic
1124879699 15:33630595-33630617 CTGTGGGACAAGGGACCTTACGG - Intronic
1125900098 15:43338021-43338043 AAGTGAGACCAGGGCCCCTGTGG - Intronic
1128657005 15:69469847-69469869 GAGTGGGACCAGGCAGCCTGAGG - Intergenic
1129060651 15:72857953-72857975 TATTGGGAGGTGGGACCCTGGGG + Intergenic
1129114429 15:73357428-73357450 CTGTGGGTGGAGGGGCCCTGTGG - Intronic
1129740841 15:77988837-77988859 CAGTGGGTGGTGGGGCCCTGGGG + Intronic
1129844883 15:78763703-78763725 CAGTGGGTGGTGGGGCCCTGGGG - Exonic
1130062327 15:80578894-80578916 CTGTGGGATGAAGGACTCTGGGG + Intronic
1130256942 15:82330137-82330159 CAGTGGGTGGTGGGGCCCTGGGG + Intergenic
1130598006 15:85259851-85259873 CAGTGGGTGGTGGGGCCCTGGGG - Intergenic
1132622825 16:875794-875816 CAGGGGCAGGCGGGACCCTGGGG + Intronic
1133218969 16:4310276-4310298 CAGTGGTAATAGGTACCCTGAGG + Intergenic
1138532076 16:57639881-57639903 TGGTGGCACTAGGGACCCTGGGG + Intronic
1138686893 16:58733922-58733944 CAGAGGGATGTGGGATCCTGAGG + Intronic
1140745361 16:77975925-77975947 CAGTGGAAAGGGAGACCCTGAGG - Intronic
1141229311 16:82149953-82149975 GAGTTGGAGGAGAGACCCTGTGG - Intronic
1141920912 16:87134729-87134751 CTGGGGGACCAGGGAGCCTGCGG - Intronic
1143914063 17:10275878-10275900 GAGAGGGACCAGGGACCCTTTGG + Intergenic
1144118216 17:12122284-12122306 CAGGGGGACGAGGGAGGGTGTGG - Intronic
1145813365 17:27778323-27778345 CAGTGGCTGGAGGGAGCCTGAGG + Intronic
1148192968 17:45692696-45692718 CAGGAGGAAGATGGACCCTGAGG + Intergenic
1148615477 17:48997285-48997307 CGGAGGGCCGAGGGGCCCTGTGG + Intergenic
1151653047 17:75481696-75481718 CAGTGAGACGAGGCAGCCAGGGG + Intronic
1151833811 17:76570508-76570530 CAGAGGGGCAAGGGACACTGTGG - Intronic
1152594109 17:81229897-81229919 CAGAGCGACGAGTGAGCCTGGGG - Intronic
1152742677 17:82025197-82025219 CAGAGGGATGAGGGAGCCTGAGG - Intronic
1153364762 18:4242986-4243008 CAGTGTGATGAGGGCCACTGAGG - Intronic
1160495506 18:79372145-79372167 CAGTGGGACAAGCAACCCCGTGG + Intronic
1161045186 19:2130771-2130793 CTGTGGGACCCAGGACCCTGGGG - Intronic
1161186734 19:2926494-2926516 CAGTGGGTCGGGGGAACCTAGGG - Intergenic
1162736887 19:12751875-12751897 CTGAGGGAAGAGGGAACCTGCGG + Exonic
1163288889 19:16365726-16365748 CAGAGTGGTGAGGGACCCTGGGG - Intronic
1164818395 19:31224959-31224981 CAGGGGGAACAGGGGCCCTGGGG - Intergenic
1167077927 19:47260433-47260455 CACTGGGGTGTGGGACCCTGAGG + Intronic
1167674169 19:50874384-50874406 CACTGGGAGAAGGGACACTGTGG - Intronic
1167716128 19:51143820-51143842 CAGTGGGGCCTGGGACGCTGTGG - Intronic
1168048445 19:53810721-53810743 CAGAGGCACCAGGGTCCCTGAGG + Exonic
1168258919 19:55181959-55181981 CAGTGGGACGAGGGACCCTGGGG - Intronic
1168349773 19:55669195-55669217 CATTGGCTTGAGGGACCCTGGGG + Intronic
1168635236 19:57991029-57991051 CAGTGGGACGAGGGTGCAGGAGG - Intronic
925135091 2:1521483-1521505 CTGGGGGAGGAGGGTCCCTGGGG - Intronic
926733421 2:16054739-16054761 CTGTGTGATGAGGTACCCTGAGG - Intergenic
927773530 2:25884291-25884313 CTGTTGGAGGAGGGACCTTGTGG + Intergenic
930104060 2:47626426-47626448 CAGTTGGAGGTGGGACCTTGTGG + Intergenic
930336748 2:50058685-50058707 AAGTGGCAGGAGGGACCCAGTGG + Intronic
933899537 2:86839760-86839782 CAGTGGGACAAGAGGCCTTGTGG + Intronic
934504296 2:94879235-94879257 CAGTGGGCGCAGGGACCCTCAGG - Intergenic
934962414 2:98688351-98688373 CAGAAGGACGAGGGTCACTGGGG - Intronic
935781021 2:106509466-106509488 CAGTGGGACAAGGGGCCTTGTGG - Intergenic
936637020 2:114270555-114270577 CAGTGAGTCAAAGGACCCTGAGG + Intergenic
947723001 2:232380600-232380622 CTGTGGGACAAGGGGTCCTGTGG - Intronic
947727351 2:232408681-232408703 CTGTGGGACAAGGGGTCCTGTGG - Intronic
948010040 2:234645412-234645434 CAGTGGGAGTAGGGAGGCTGTGG - Intergenic
1168804279 20:663459-663481 AAGTGGGTCGGGGGACGCTGGGG + Exonic
1171475734 20:25407484-25407506 CAGTGGGCCGGGGGACTCTACGG - Intergenic
1172887665 20:38241913-38241935 CAGTGTGAGTAGGGAGCCTGTGG + Exonic
1172952488 20:38730860-38730882 CAGCGGGTCCACGGACCCTGGGG + Intergenic
1173158181 20:40632583-40632605 CCGGAGGACAAGGGACCCTGGGG - Intergenic
1174238600 20:49114765-49114787 CAGTGGGCCGAGAGACACGGTGG - Exonic
1174507108 20:51023753-51023775 TAGGGGGGCGAGGGACCCAGAGG - Intergenic
1174870131 20:54174088-54174110 CCGAGGGACGCGGGACCCAGGGG + Intergenic
1175754007 20:61517896-61517918 CATTTGGGGGAGGGACCCTGAGG - Intronic
1175912662 20:62412206-62412228 CAGGTGGACAAGGGGCCCTGGGG + Intronic
1176042435 20:63072526-63072548 CACTGGGACCCGGGAGCCTGGGG - Intergenic
1177278173 21:18943166-18943188 CAGTAAGACAAGGGGCCCTGAGG + Intergenic
1177642312 21:23859069-23859091 CACTGGCACCAGGGTCCCTGAGG + Intergenic
1179376393 21:40853297-40853319 CAGTGGGAGGGTGGCCCCTGGGG - Intergenic
1179456592 21:41504962-41504984 CTGTGGGATGAGGGACACTCAGG + Intronic
1179615778 21:42582316-42582338 CAGAGGGAAGAGGTGCCCTGTGG - Intergenic
1179800930 21:43811211-43811233 CAGTGGGAACAGGCACCCTGGGG + Intergenic
1179875250 21:44263576-44263598 CAGGGGGCGGGGGGACCCTGAGG + Intergenic
1179885451 21:44312371-44312393 CAGAGGGACGAGGGATCCCTGGG + Intronic
1179903501 21:44407007-44407029 GAGTGGGCCGAGGGCACCTGGGG + Intronic
1180084613 21:45502193-45502215 CTGTGGGATGGGGGGCCCTGGGG + Intronic
1180694672 22:17744116-17744138 CAGAGAGCTGAGGGACCCTGTGG + Intronic
1182300643 22:29335016-29335038 CACTGGGGCGAGGGAACCTGGGG - Intronic
1184476723 22:44726178-44726200 CAGTGCGTCCAGGGTCCCTGAGG + Intronic
1184806306 22:46796843-46796865 CCTTGGGATGAGGGTCCCTGTGG + Intronic
1185093086 22:48786767-48786789 GAGTGAGACCAGGGACCCTGTGG + Intronic
953071977 3:39529889-39529911 CACTGGGACAACGCACCCTGGGG + Intergenic
953213384 3:40896061-40896083 CGGTGGGAGGTGGGATCCTGAGG - Intergenic
953358779 3:42276955-42276977 GAGTGGGTGGAGGGGCCCTGGGG + Intergenic
954975144 3:54686589-54686611 CTGTGGGCCGAGGTACCCTTTGG + Intronic
955847954 3:63187348-63187370 CAGTGTGAGGAGGTAACCTGTGG - Intergenic
959421596 3:106135704-106135726 CAGTGTGCGGAGGGAGCCTGAGG - Intergenic
959669738 3:108962620-108962642 CAGTGAGCCTAGGGAGCCTGTGG - Intronic
960060662 3:113317326-113317348 GAGAGGGACGAGGAACTCTGGGG - Intronic
960950649 3:122996524-122996546 CAGTGGAAGGAGGGACTGTGGGG + Intronic
961391651 3:126555839-126555861 CAGTGGGGCTGGGGAGCCTGCGG - Intronic
961552044 3:127674975-127674997 CAGTGGGAGGGCAGACCCTGTGG - Intronic
968085283 3:195871372-195871394 GAGTGGGACTGGGGACCTTGGGG - Intronic
969307149 4:6332352-6332374 CAGTGTGAGGAGGGGGCCTGAGG + Intronic
971467930 4:26984795-26984817 CAGTGGTACAGGGGACACTGAGG - Intronic
974541500 4:63244611-63244633 AAGTTGTAGGAGGGACCCTGGGG - Intergenic
979205629 4:118033831-118033853 CACCCGGACGAGGGGCCCTGGGG + Intronic
980476863 4:133329350-133329372 CAGTTGGAGGTGGGACCTTGTGG - Intergenic
985669716 5:1201147-1201169 CAGCGGGAGCAGGGGCCCTGGGG - Intergenic
985762281 5:1755689-1755711 TATGGGGACCAGGGACCCTGGGG + Intergenic
992126719 5:73649916-73649938 GTGTGGGAAGAGGGACTCTGAGG - Intronic
993160600 5:84285847-84285869 CAGTGGCAGGAGGGATCCAGTGG + Intronic
997516259 5:134491953-134491975 CAGTGGGTCGGTGGACACTGTGG + Intergenic
1002040827 5:176512957-176512979 CACAGGCATGAGGGACCCTGGGG - Intergenic
1002048126 5:176553406-176553428 GACTGGGAGGAGGGACCCTGAGG + Intronic
1002518000 5:179773776-179773798 CACTGGGAAGAGGGCCCCGGGGG - Intronic
1003103558 6:3195913-3195935 GTGTTGGACGAGGGGCCCTGTGG - Intergenic
1005889442 6:30124677-30124699 CAGTGGGATGCGGTACCCAGGGG + Intergenic
1006369054 6:33633298-33633320 CCGTGGGTGGAGGGACCTTGTGG + Intronic
1007571102 6:42891411-42891433 CTGAGGCACTAGGGACCCTGTGG - Intergenic
1007593142 6:43035601-43035623 CAGTGGGCCCAGGTACACTGGGG - Intergenic
1009276329 6:61685796-61685818 CAGTGGGACCAGGTACCTTGGGG + Intronic
1013309965 6:108884619-108884641 CAGTGGCAGGAGGCATCCTGAGG + Intronic
1016118742 6:140321369-140321391 GAGTGGGAAGAGGGATGCTGTGG + Intergenic
1018044222 6:159951891-159951913 AAGTGTGATGAGGGATCCTGAGG - Intergenic
1019328152 7:449514-449536 CAGTAGGAGGGGGGACCTTGAGG - Intergenic
1019793655 7:3033823-3033845 CAGTGGGAGGAGGGCCTCCGAGG + Intronic
1022704650 7:32790950-32790972 CAGTGGGACGACTCACCCTGGGG + Intergenic
1023632569 7:42178790-42178812 CAGTGGGACCAGGCAACCGGGGG + Intronic
1023939253 7:44759507-44759529 CTGTGGGACAGGGGACCTTGGGG + Intronic
1023962406 7:44937839-44937861 CAGGTGGATGAGAGACCCTGAGG + Intergenic
1025615522 7:63113637-63113659 CAGTGGGACGTGGGCGCCTCTGG - Intergenic
1027441041 7:78219503-78219525 CAGTAGTACGAGAGGCCCTGAGG - Intronic
1029457330 7:100677867-100677889 CACTGGGACGGTGGCCCCTGAGG - Intronic
1032529678 7:132609790-132609812 CAGTGGGAGGGGGAAGCCTGTGG + Intronic
1033659796 7:143395470-143395492 AAGTGTATCGAGGGACCCTGAGG - Exonic
1033980282 7:147155847-147155869 AAATTGGAAGAGGGACCCTGAGG + Intronic
1034069060 7:148164977-148164999 CAGTGAGAAGAGGGACCCCAAGG + Intronic
1034272990 7:149812283-149812305 CAGTGGGACCAGGGCCCCCATGG - Intergenic
1034422409 7:150996571-150996593 CAGTGGGACAAGGGAGGCTGTGG - Intronic
1034807045 7:154098113-154098135 ATGTTGGAGGAGGGACCCTGTGG + Intronic
1037618672 8:20543920-20543942 CAGTGGCACGAGGAGCCGTGGGG + Intergenic
1040515129 8:48128310-48128332 CAGTGGGGCGGGGGCCACTGAGG - Intergenic
1044619309 8:94173260-94173282 CAGTGGGAGGTGGGATCATGGGG + Intronic
1045332764 8:101169974-101169996 CAGTGGGATGAATGACCATGGGG + Intergenic
1046699469 8:117383637-117383659 CAGTGGGTCACGTGACCCTGAGG - Intergenic
1047308885 8:123676044-123676066 GACTGGGACCAGGGACCATGTGG - Intergenic
1049482455 8:142833176-142833198 CTGTGGTGGGAGGGACCCTGGGG + Intergenic
1049483257 8:142837845-142837867 CTGTGGTGGGAGGGACCCTGGGG - Intronic
1049504571 8:142989111-142989133 CAGAGGGAGGTGGCACCCTGGGG - Intergenic
1049513179 8:143039898-143039920 CAGTGGAAGGGAGGACCCTGTGG + Intronic
1053072116 9:35107759-35107781 CAGGGGGACAGGGGTCCCTGGGG - Exonic
1054793558 9:69277844-69277866 CAGTGAGAGGAAGGACGCTGAGG - Intergenic
1055910463 9:81344752-81344774 GAGTGGTGCCAGGGACCCTGAGG - Intergenic
1059529398 9:115022105-115022127 CAGTGGGGCAAGGGGCCATGTGG - Intronic
1060529065 9:124337300-124337322 CGGGGAGAAGAGGGACCCTGAGG + Intronic
1061188778 9:129070111-129070133 CAGTGGGAGGGAGGAGCCTGGGG + Intronic
1061248740 9:129414425-129414447 CTGCGGGATGAGGGAGCCTGCGG - Intergenic
1062661938 9:137641208-137641230 CAGTAGGAAGAGGCATCCTGAGG - Intronic
1188393730 X:29654626-29654648 TCGTGGGAGGAGGGACCCAGTGG - Intronic
1189286249 X:39854371-39854393 AAGTGGGATGAGGAAGCCTGAGG - Intergenic
1189424986 X:40891558-40891580 CAGTGGCAAGTGGGTCCCTGTGG - Intergenic
1194253095 X:91602508-91602530 CAGTGGGACAAAGTACTCTGGGG + Intergenic
1197972063 X:132125072-132125094 CAGTGGGATTGGGGACACTGGGG - Intronic
1198609185 X:138378791-138378813 CAGTGGGAGGAGGCACCTTCAGG + Intergenic
1200572031 Y:4843752-4843774 CAGTGGGACAAAGTACTCTGGGG + Intergenic
1201158264 Y:11151389-11151411 CAGTGGGCACAGGGACCCTCAGG + Intergenic