ID: 1168267104

View in Genome Browser
Species Human (GRCh38)
Location 19:55229076-55229098
Sequence CCTCTCCCGCTTCCCATGAT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 126}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168267104_1168267111 -9 Left 1168267104 19:55229076-55229098 CCCATCATGGGAAGCGGGAGAGG 0: 1
1: 0
2: 2
3: 9
4: 126
Right 1168267111 19:55229090-55229112 CGGGAGAGGGGCTGGCTGGCAGG 0: 1
1: 0
2: 5
3: 59
4: 641
1168267104_1168267112 2 Left 1168267104 19:55229076-55229098 CCCATCATGGGAAGCGGGAGAGG 0: 1
1: 0
2: 2
3: 9
4: 126
Right 1168267112 19:55229101-55229123 CTGGCTGGCAGGAGTGCCCCTGG 0: 1
1: 0
2: 2
3: 41
4: 374
1168267104_1168267113 5 Left 1168267104 19:55229076-55229098 CCCATCATGGGAAGCGGGAGAGG 0: 1
1: 0
2: 2
3: 9
4: 126
Right 1168267113 19:55229104-55229126 GCTGGCAGGAGTGCCCCTGGAGG 0: 1
1: 0
2: 3
3: 46
4: 316
1168267104_1168267114 6 Left 1168267104 19:55229076-55229098 CCCATCATGGGAAGCGGGAGAGG 0: 1
1: 0
2: 2
3: 9
4: 126
Right 1168267114 19:55229105-55229127 CTGGCAGGAGTGCCCCTGGAGGG 0: 1
1: 1
2: 2
3: 26
4: 277
1168267104_1168267117 15 Left 1168267104 19:55229076-55229098 CCCATCATGGGAAGCGGGAGAGG 0: 1
1: 0
2: 2
3: 9
4: 126
Right 1168267117 19:55229114-55229136 GTGCCCCTGGAGGGATGGGAAGG 0: 1
1: 0
2: 3
3: 42
4: 407
1168267104_1168267115 10 Left 1168267104 19:55229076-55229098 CCCATCATGGGAAGCGGGAGAGG 0: 1
1: 0
2: 2
3: 9
4: 126
Right 1168267115 19:55229109-55229131 CAGGAGTGCCCCTGGAGGGATGG 0: 1
1: 0
2: 0
3: 27
4: 345
1168267104_1168267116 11 Left 1168267104 19:55229076-55229098 CCCATCATGGGAAGCGGGAGAGG 0: 1
1: 0
2: 2
3: 9
4: 126
Right 1168267116 19:55229110-55229132 AGGAGTGCCCCTGGAGGGATGGG 0: 1
1: 0
2: 0
3: 17
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168267104 Original CRISPR CCTCTCCCGCTTCCCATGAT GGG (reversed) Exonic
900303504 1:1989952-1989974 CCTCACTCTCTTCCCATGAGAGG + Intronic
900350532 1:2232383-2232405 CCTCTCCCACCTCCCACCATGGG - Intronic
901237463 1:7675127-7675149 CTTCTCCCACTTCCCATGACTGG - Intronic
905997642 1:42395459-42395481 CCTCTCCCTCTCCCCAAGTTAGG + Intronic
907809483 1:57854410-57854432 TCTCACCCCCTTCCCATGTTGGG - Intronic
910159730 1:84260117-84260139 CCCCTCCTGCTTCCCATAACTGG + Intergenic
911150481 1:94593301-94593323 CCTCTCCAGCTGATCATGATTGG + Intergenic
915810961 1:158910024-158910046 ACTCTCCCTCTTCCCAGGACAGG - Intergenic
917749307 1:178039944-178039966 CCTCTCCCCCTTCCCACAAGAGG + Intergenic
919026908 1:192183908-192183930 CCTCTGCCTTTTGCCATGATTGG - Intronic
919325805 1:196105327-196105349 CCTCTCCCCCATCCCACGACTGG - Intergenic
920827888 1:209438718-209438740 CCTCTCCCGTCTCCCCAGATTGG - Intergenic
923083927 1:230687293-230687315 TCTCTCCAGCTTCCCCTGACAGG + Intronic
923330713 1:232921845-232921867 CCTCTCCCCTTTCTCATGTTAGG - Intergenic
923994317 1:239475435-239475457 CCTCTCTCACTACTCATGATTGG - Intronic
1062874690 10:933468-933490 CCTCTCCGGCTTCCCATAGTGGG + Intergenic
1064334894 10:14430646-14430668 CCTCTACAGCTTGCAATGATTGG + Intronic
1064656177 10:17558396-17558418 CCTCTAACTCTTCCTATGATAGG + Intergenic
1067834275 10:49628568-49628590 CCTCTTCCTGTTCCCATCATGGG - Intronic
1070735620 10:78861823-78861845 CCCCTCGCCCTTCCCAGGATTGG - Intergenic
1070972488 10:80578996-80579018 CCTCCCCAGCTCCCCATGGTGGG - Intronic
1072105140 10:92266604-92266626 CCCCTCCCGCTTCCCATTGTAGG - Intronic
1074554157 10:114472797-114472819 GTTCTCCCACTTCTCATGATGGG + Intronic
1075046317 10:119149272-119149294 CACTTCCAGCTTCCCATGATTGG + Intronic
1076930234 10:133527501-133527523 CCTTTCCCGCTTCCCATCATCGG + Exonic
1078729712 11:13963627-13963649 CCACTCCGGCTTCCCTGGATAGG + Intronic
1080701652 11:34649459-34649481 TCTCTCCCTCCTCCCTTGATGGG + Intronic
1081143441 11:39532819-39532841 CCTGCCCCCCATCCCATGATAGG + Intergenic
1082089001 11:48073640-48073662 CCTTTCCCAATTCCCTTGATCGG + Intronic
1084041100 11:66543208-66543230 CCTCCCCAGCTTCCCATAACTGG + Intronic
1084111328 11:67015839-67015861 CCTCTCCCTCCTCCCTTGCTGGG + Intronic
1093779049 12:23112873-23112895 CCTCTCCTCTTCCCCATGATGGG + Intergenic
1096362487 12:51000122-51000144 CATCTTCCGTTTCCCATGGTGGG - Intronic
1096653574 12:53074643-53074665 ACTCACCCGCTTCCCATTTTTGG + Exonic
1099129679 12:78811485-78811507 CCTCCCCCGCCCCCCATGACAGG - Intergenic
1103361801 12:120358971-120358993 CCCCTCCCCCTTCCCAGGCTGGG - Intronic
1103580096 12:121908525-121908547 CCTCTTCCGCTGCACATGCTGGG + Intronic
1106385546 13:29282052-29282074 CCTCTCACTCTTCCCATGACTGG + Intronic
1107379167 13:39837267-39837289 GCACTCCCTCTTCCCATGTTGGG + Intergenic
1107481452 13:40789392-40789414 CCACTTCCGCTTCCCGTGCTGGG + Intronic
1110812764 13:79828771-79828793 CCCCTCCCCCATCCCATGACAGG - Intergenic
1112281386 13:98065776-98065798 CAGCTCCCCCTTCCCATCATGGG + Intergenic
1115513968 14:34166811-34166833 CCTCACCTTCTTCCCATGCTTGG - Intronic
1119433577 14:74583908-74583930 CCCCTGCCGGTTCCCATGGTGGG - Intronic
1119442863 14:74640492-74640514 CCTCTCCTGCCTCCCGTGATGGG + Intergenic
1120742378 14:88122353-88122375 CCACTCCCCCATCCCATGAGAGG + Intergenic
1122487032 14:102088304-102088326 TCTCTGGCGCCTCCCATGATTGG + Intronic
1124972663 15:34504490-34504512 CCTCTCCTTGTTCCCAGGATAGG + Intergenic
1125490939 15:40147890-40147912 CCTCAGCCGCATCCCATGAGGGG - Intergenic
1128083933 15:64873206-64873228 CCTCTCCCGCCTCCCCAGCTAGG - Intronic
1129247227 15:74286899-74286921 CCCCTCCCTCTTCCCCTCATAGG + Intronic
1131602516 15:93863750-93863772 CCTCTGCCGTTTGCCATGAGTGG + Intergenic
1132187740 15:99817172-99817194 CCTCTCCTTGTTCCCAGGATAGG - Intergenic
1138431238 16:56970539-56970561 ACTCTCCTGCTTCCCAGGGTGGG + Intronic
1138440821 16:57034090-57034112 CCCCTCCAGCTTCCAATGCTGGG - Intronic
1139264147 16:65623590-65623612 CCTCTCCCTCCTCCTATAATGGG + Intergenic
1145036979 17:19548050-19548072 CCTCTGCTGCTTCCCCTGCTGGG + Exonic
1146339506 17:32007342-32007364 CCTCGCCCCCTTCCCAGGCTGGG + Intergenic
1147263800 17:39223541-39223563 CCTCTCCCTCTTCCCAGGCCAGG - Intronic
1148757224 17:49979829-49979851 CCCCTCCTGCTTCCCTGGATTGG - Intergenic
1149340532 17:55681437-55681459 GCTCTGCTACTTCCCATGATGGG - Intergenic
1152901155 17:82941816-82941838 CCTCATCTGCTTCCCATGAGTGG + Intronic
1153177939 18:2399969-2399991 CCTCTCCCCCACCCCATGACAGG - Intergenic
1153780396 18:8490502-8490524 CCACTCCCTCTCACCATGATTGG - Intergenic
1156179656 18:34587969-34587991 TCTCTCTCAGTTCCCATGATGGG - Intronic
1157065003 18:44339287-44339309 TCTCTACCCCTTCCCATAATGGG + Intergenic
1157276160 18:46312296-46312318 CCTCTCCTCCTTCCCTTGAATGG + Intergenic
1161380289 19:3961219-3961241 CCTCTCCGGCTGCCCACGACAGG + Intronic
1168267104 19:55229076-55229098 CCTCTCCCGCTTCCCATGATGGG - Exonic
929795414 2:45055184-45055206 CCTCTCCCGCTTCTCACAGTTGG + Intergenic
935632524 2:105223844-105223866 CCTTCCCCGCTTCCCCGGATTGG - Intergenic
936713811 2:115162091-115162113 CGCCTCCCGCTTCCCAGGCTGGG + Intronic
941720600 2:168808358-168808380 CCACTCCTGCTTCCCCTAATGGG + Intronic
942066001 2:172271992-172272014 CCTCTCCCCCAACCCCTGATAGG + Intergenic
943907350 2:193516360-193516382 ACTCCCCCCCTTCCCATGACAGG - Intergenic
946908420 2:224437766-224437788 CCTCTCCTGCTACCTATGAAGGG + Intergenic
947385586 2:229587322-229587344 CCTCTCCCGCCTCTCCGGATGGG + Intronic
948170111 2:235894492-235894514 GCTCTGCCTCTTCCCAAGATAGG + Intronic
948671561 2:239571776-239571798 CTTCTCCCTCTTCCCATCAGAGG - Intergenic
1169068179 20:2706187-2706209 CCTCTCCATCTTCCCATCCTAGG + Exonic
1174121970 20:48272540-48272562 CCTCTCCCTGTTCCCTTGAGAGG - Intergenic
1180076179 21:45464243-45464265 TCTCTTCCTCTTCCCAGGATGGG + Intronic
1184367857 22:44063915-44063937 CCTCCCCGGCTTCCCATTCTCGG + Intronic
1184986186 22:48137019-48137041 CCACCCCCACTTCCCATCATGGG + Intergenic
953349783 3:42206871-42206893 CCTCACCCGCTCCCAAGGATGGG - Intronic
954497612 3:50979559-50979581 CCTTTCCCATTTGCCATGATTGG + Intronic
955082427 3:55670428-55670450 CATCTTCCCCTTCCCATGAGGGG + Intronic
958540078 3:95459926-95459948 CCTCTCCCTTTTCCCTTCATTGG + Intergenic
959165231 3:102768670-102768692 CCTCACCCTCTCCCCTTGATAGG + Intergenic
960616111 3:119597608-119597630 CCTCTCCCACTTCCCGTGATAGG - Intergenic
965871256 3:173267872-173267894 CTTCTCCCACTTCCCATAACTGG - Intergenic
968636840 4:1685056-1685078 CCTCTCCAGCCTCCCGTGCTGGG + Intergenic
968843623 4:3026709-3026731 GCTCTCCCGCCTCCCAGGGTGGG + Intronic
971127923 4:23774779-23774801 ACTCTCCCTCTCCCCATGAAGGG - Intronic
973642573 4:52917899-52917921 CCACTCCTGCTTCCCTTGCTAGG - Intronic
974371672 4:61023993-61024015 CCTCTCCCCCATCCCACGACTGG - Intergenic
977364605 4:96052200-96052222 CCTCTCCCATTTCCCATTTTAGG + Intergenic
977910211 4:102525693-102525715 CCTCTCCAACTTCACATGAAAGG - Intronic
981986393 4:150862522-150862544 CCTCTCCCCCACCCCATGACAGG - Intronic
992086110 5:73279731-73279753 CCTCTCCCGCTTGCCATCTCTGG + Intergenic
997600016 5:135132649-135132671 CCTCTCCCCCTTGCCTGGATTGG - Intronic
1001641573 5:173247509-173247531 CCTCTCCCACTTCTAATGAACGG - Intergenic
1001983315 5:176051949-176051971 CCCCTCCCGCTTCCCAGGCGAGG - Intronic
1002021687 5:176367695-176367717 CCTCTGCCTCTTCCCATGGCTGG + Intronic
1002234150 5:177792103-177792125 CCCCTCCCGCTTCCCAGGCGAGG + Intronic
1004161176 6:13214263-13214285 CCACTCCTGCTTCCCCTGTTGGG + Intronic
1015049165 6:128818138-128818160 CGTCTCCTTCTTCACATGATGGG + Intergenic
1016363319 6:143290930-143290952 CCCCACCCTCTTCCCAAGATGGG + Intronic
1016624752 6:146153628-146153650 CCTGCACCGCTTCCCATGACAGG - Intronic
1019533212 7:1513951-1513973 CGCCTCCCGCTCCCCGTGATGGG - Intergenic
1020839722 7:13200505-13200527 CCTCTCCAGCATCCTATGTTAGG + Intergenic
1021794513 7:24240485-24240507 CCTCTCCTGCTTCCATTCATTGG - Intergenic
1026304291 7:69126594-69126616 CCTCTCCCCACTCTCATGATGGG - Intergenic
1026840047 7:73665446-73665468 CCTCTCCACCTTCCCAGGCTAGG - Intergenic
1029374243 7:100168384-100168406 CATCTCTCCCTTCCCATGATTGG + Intronic
1032013211 7:128360105-128360127 CCTCTTCCCTTTCCCAGGATCGG + Intronic
1032858832 7:135858904-135858926 CCTCTCCCACTTCCCATTCTGGG + Intergenic
1036629281 8:10499264-10499286 CCTCTCCCCCTCCCCAGGAGTGG + Intergenic
1039175089 8:34794386-34794408 CCTCTCCCCCTTCCTTTGTTTGG - Intergenic
1039843882 8:41311928-41311950 CCTCTCCCACATCCCAGGAATGG - Intergenic
1041333792 8:56757339-56757361 CATCTCCCTCTTCCCCTGAAAGG - Intergenic
1044935914 8:97293222-97293244 CCTCTCCTGCTTGCCAGGTTGGG + Intergenic
1047018100 8:120745245-120745267 CCTCTCCAGCCTCCCATGCTTGG + Intronic
1047758493 8:127936700-127936722 CCTCTCCTGCTTCCAGTGAGGGG + Intergenic
1049709705 8:144057983-144058005 GCTCTCCTGCTTCCCAGGCTGGG - Intronic
1051437063 9:17044232-17044254 CATCTCCTGCTTCTCATAATCGG - Intergenic
1056604931 9:88077822-88077844 CCTCTCCCCTCTCCCATGAGAGG - Intergenic
1059529630 9:115023921-115023943 CCCCTCCAGCTTCCCAAGCTTGG + Intronic
1060425428 9:123500654-123500676 CCTCTCCCTCTTAGCATGAAGGG + Intronic
1060665463 9:125429856-125429878 ACTCACACGGTTCCCATGATGGG + Intergenic
1060982535 9:127802196-127802218 CCTCTCCCTCTTCCCAGCATTGG - Intronic
1061238205 9:129354082-129354104 CCTCTGCCCATTCCCATGCTGGG + Intergenic
1190136527 X:47804265-47804287 CCACCCCCGCCTCCAATGATAGG + Intergenic
1190448800 X:50557434-50557456 CCTTTCCCACTTCCCCTGTTGGG - Intergenic
1191199925 X:57769619-57769641 CCTTACCCCCATCCCATGATAGG + Intergenic
1193087172 X:77457014-77457036 CATCTCCCACTTCCAATGACAGG - Intronic
1196304214 X:114082558-114082580 CCCCTCCCCCACCCCATGATAGG + Intergenic
1199998943 X:153046590-153046612 CCTTTTCCCCTTCCCATGAGGGG - Intergenic