ID: 1168267410

View in Genome Browser
Species Human (GRCh38)
Location 19:55230387-55230409
Sequence CTCTCCTCTGGACCCCCAGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 331
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 299}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168267410_1168267422 11 Left 1168267410 19:55230387-55230409 CCTCCTGGGGGTCCAGAGGAGAG 0: 1
1: 0
2: 1
3: 30
4: 299
Right 1168267422 19:55230421-55230443 GTCAGGGTGATGAGGGCAATGGG 0: 1
1: 0
2: 0
3: 21
4: 297
1168267410_1168267424 13 Left 1168267410 19:55230387-55230409 CCTCCTGGGGGTCCAGAGGAGAG 0: 1
1: 0
2: 1
3: 30
4: 299
Right 1168267424 19:55230423-55230445 CAGGGTGATGAGGGCAATGGGGG 0: 1
1: 0
2: 3
3: 38
4: 419
1168267410_1168267417 -6 Left 1168267410 19:55230387-55230409 CCTCCTGGGGGTCCAGAGGAGAG 0: 1
1: 0
2: 1
3: 30
4: 299
Right 1168267417 19:55230404-55230426 GGAGAGAATGTGGGGGTGTCAGG 0: 1
1: 0
2: 0
3: 39
4: 446
1168267410_1168267420 4 Left 1168267410 19:55230387-55230409 CCTCCTGGGGGTCCAGAGGAGAG 0: 1
1: 0
2: 1
3: 30
4: 299
Right 1168267420 19:55230414-55230436 TGGGGGTGTCAGGGTGATGAGGG 0: 1
1: 0
2: 2
3: 49
4: 471
1168267410_1168267423 12 Left 1168267410 19:55230387-55230409 CCTCCTGGGGGTCCAGAGGAGAG 0: 1
1: 0
2: 1
3: 30
4: 299
Right 1168267423 19:55230422-55230444 TCAGGGTGATGAGGGCAATGGGG 0: 1
1: 0
2: 0
3: 24
4: 288
1168267410_1168267418 -5 Left 1168267410 19:55230387-55230409 CCTCCTGGGGGTCCAGAGGAGAG 0: 1
1: 0
2: 1
3: 30
4: 299
Right 1168267418 19:55230405-55230427 GAGAGAATGTGGGGGTGTCAGGG 0: 1
1: 0
2: 3
3: 32
4: 414
1168267410_1168267426 23 Left 1168267410 19:55230387-55230409 CCTCCTGGGGGTCCAGAGGAGAG 0: 1
1: 0
2: 1
3: 30
4: 299
Right 1168267426 19:55230433-55230455 AGGGCAATGGGGGCCATCGTGGG 0: 1
1: 0
2: 0
3: 14
4: 129
1168267410_1168267419 3 Left 1168267410 19:55230387-55230409 CCTCCTGGGGGTCCAGAGGAGAG 0: 1
1: 0
2: 1
3: 30
4: 299
Right 1168267419 19:55230413-55230435 GTGGGGGTGTCAGGGTGATGAGG 0: 1
1: 0
2: 2
3: 71
4: 611
1168267410_1168267421 10 Left 1168267410 19:55230387-55230409 CCTCCTGGGGGTCCAGAGGAGAG 0: 1
1: 0
2: 1
3: 30
4: 299
Right 1168267421 19:55230420-55230442 TGTCAGGGTGATGAGGGCAATGG 0: 1
1: 0
2: 8
3: 89
4: 671
1168267410_1168267425 22 Left 1168267410 19:55230387-55230409 CCTCCTGGGGGTCCAGAGGAGAG 0: 1
1: 0
2: 1
3: 30
4: 299
Right 1168267425 19:55230432-55230454 GAGGGCAATGGGGGCCATCGTGG 0: 1
1: 0
2: 1
3: 25
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168267410 Original CRISPR CTCTCCTCTGGACCCCCAGG AGG (reversed) Exonic
900300246 1:1973464-1973486 CTCTCCTCGGGACCCCCTTCTGG - Intronic
900411857 1:2516140-2516162 CCCACCTCTGGTCCTCCAGGTGG + Intronic
900462892 1:2809864-2809886 TGCTGCTCTGGACTCCCAGGAGG - Intergenic
900518927 1:3096344-3096366 CTGCCCGCAGGACCCCCAGGAGG + Intronic
900613373 1:3553724-3553746 CTCTCCTCTGGAGCCACTCGTGG - Intronic
900684993 1:3942624-3942646 CTCTCCCCTTGACTCCCAGATGG - Intergenic
900766807 1:4511443-4511465 CTCTTCTCTGCACCCCTAGAGGG + Intergenic
900900055 1:5510007-5510029 CTGTCCTCGGGGACCCCAGGAGG - Intergenic
902399238 1:16148931-16148953 CTCTCCTCGGTACACCCAGTTGG + Exonic
902408152 1:16197700-16197722 CTCTCCCCTCGAGCCCCGGGAGG + Intergenic
902572169 1:17353852-17353874 CTTTCCTCAGGGCCTCCAGGAGG + Intronic
904011668 1:27393515-27393537 CTCTCCTCTGGTCACACACGTGG + Intronic
904312128 1:29635690-29635712 TTCTCCTCTGGACCCCCTCAGGG - Intergenic
904353962 1:29926608-29926630 CTCTCCCCTGAACCTCCAGGGGG - Intergenic
904594566 1:31635311-31635333 TTCCCCTCTGGAACTCCAGGAGG - Exonic
904946448 1:34202278-34202300 CTCTCCTGTGGACATCCACGGGG + Intronic
909299001 1:73987101-73987123 CTCTCCTCAGAACCTCCACGAGG - Intergenic
910271199 1:85396608-85396630 CTCTCTTTTGGACTTCCAGGTGG - Intronic
912227468 1:107751376-107751398 CTGTCCTCTGTAATCCCAGGGGG + Intronic
912261609 1:108116305-108116327 TTCTCCACTGGACTCCAAGGGGG - Intergenic
913644142 1:120840554-120840576 CTCCCATCTGGAACACCAGGTGG - Exonic
914082599 1:144423030-144423052 CTCCCATCTGGAACACCAGGTGG + Exonic
914177501 1:145291543-145291565 CTCCCATCTGGAACACCAGGTGG + Exonic
914210472 1:145573982-145574004 CTCCCATCTGGAACACCAGGTGG + Intergenic
914269397 1:146066335-146066357 CTCCCATCTGGAACACCAGGTGG + Exonic
914448910 1:147773545-147773567 CCCTTCTCTGGCCCCCAAGGAGG + Intergenic
914532230 1:148533022-148533044 CTCCCATCTGGAACACCAGGTGG + Exonic
914673339 1:149888579-149888601 TCCTCCTCTTGACCTCCAGGAGG + Intronic
915631299 1:157155500-157155522 CTCTTCTCTGGAGCCACAGCTGG - Intergenic
915914013 1:159930565-159930587 CACCCCTCTGGACCCCAAGCTGG + Intronic
916039874 1:160952822-160952844 CTCTGCTCTGAAGTCCCAGGAGG + Intronic
917614505 1:176726244-176726266 CTCTTCTCCTGAGCCCCAGGTGG + Intronic
918074097 1:181156583-181156605 TTCCTCTCTGGACCCACAGGAGG - Intergenic
919900574 1:202041294-202041316 CTCTCCTGCTGACCCCCAGCTGG - Intergenic
920238919 1:204529458-204529480 TTCCCCTCTGGAACTCCAGGAGG - Intronic
920969494 1:210730915-210730937 CTCTCCTCTGGACACCAACCAGG + Intronic
922185027 1:223266790-223266812 CACCCCTCTGAGCCCCCAGGGGG - Intronic
922216829 1:223526650-223526672 CTCTCCTCTGGGGCCCCAGTAGG + Intergenic
922725686 1:227922064-227922086 CCCTGCCCTGGACCCCCAGAGGG + Intronic
923790025 1:237104084-237104106 TTCTCCTCTGGACCAGCAAGGGG + Intronic
1069300574 10:66902006-66902028 CTCAGCTCTGTACCCCCAAGCGG + Intronic
1069783101 10:70969244-70969266 CCCTCCCCTGGACCCCAGGGCGG + Intergenic
1069921044 10:71815750-71815772 CTCTCTGCTGGACGTCCAGGTGG + Exonic
1070760359 10:79020477-79020499 CTCTCCCCTAGACACCCAGAAGG + Intergenic
1071828232 10:89346939-89346961 CTCTCCTTTGGTCTCCCAGAGGG + Intronic
1073111172 10:101063803-101063825 CCCTCCTCAGTACCCCCTGGGGG - Intronic
1073206037 10:101769932-101769954 GACTCCACTGCACCCCCAGGTGG - Intergenic
1073439954 10:103546648-103546670 ATCTGCTCTGGGCCCCCAGAAGG - Intronic
1073632191 10:105160117-105160139 CTCTCCTCAAGACCTACAGGAGG + Intronic
1074851521 10:117443057-117443079 CTCTGCTCTCGGCCACCAGGGGG + Intergenic
1074901176 10:117817570-117817592 CTCTCCTCTGGGCCCAAAGCAGG - Intergenic
1075519632 10:123136022-123136044 CTCTCCTCCGGGTCCCCGGGAGG - Exonic
1075608206 10:123831600-123831622 CTCTCTTCAGGGCCCACAGGAGG - Intronic
1076233064 10:128838118-128838140 CTCTCCACTGGTTCCACAGGAGG + Intergenic
1076413153 10:130265866-130265888 CCCTCCTCTGGAGCTCCCGGTGG - Intergenic
1076460983 10:130647324-130647346 CTCTCCTGCTGATCCCCAGGAGG - Intergenic
1076902868 10:133348267-133348289 TTCTCCTCAGGACCCCCAGCTGG - Intronic
1081383697 11:42446159-42446181 CTCTTCACTCCACCCCCAGGAGG + Intergenic
1082104953 11:48211475-48211497 CACCCCTTTGGACCCCCAAGTGG - Intergenic
1083227867 11:61295712-61295734 GGCTCCTCTGGGCACCCAGGGGG + Intergenic
1084432048 11:69116557-69116579 CTCTCCTCTGAGCCTTCAGGAGG + Intergenic
1084681381 11:70668455-70668477 CTCTCCCCTGGAGCCCCCGGAGG + Intronic
1086818607 11:91406139-91406161 CTCAGCTCTGGGCCCCCAGCTGG + Intergenic
1087322829 11:96684075-96684097 CCCTCCTCTTGACCCCCAACAGG - Intergenic
1087828631 11:102794620-102794642 TTCTTCTCTGGGCCTCCAGGGGG + Intronic
1088812298 11:113399958-113399980 TGCTCCTCTGGACCGCCAGGTGG - Exonic
1089377620 11:118005744-118005766 CTCTCCCCTGGACCACCATGAGG + Intergenic
1089395690 11:118135411-118135433 CTGTCTTCTGGGCCCCTAGGAGG - Exonic
1089541063 11:119189188-119189210 CTCACCTCTGCAGCCCCAGGGGG - Exonic
1090644675 11:128758096-128758118 CTCTTCTCTGGCCCTGCAGGAGG + Exonic
1091280024 11:134376429-134376451 TCCCCATCTGGACCCCCAGGCGG - Intronic
1091626098 12:2122075-2122097 CTCAACTCTGGACCTCCTGGAGG + Intronic
1096156481 12:49344235-49344257 CTCTGCTCTGTAAACCCAGGAGG - Intergenic
1096738683 12:53676238-53676260 TTCTCCTCTCGAACGCCAGGTGG - Exonic
1099113063 12:78586947-78586969 CTGTCCTCAGGCCCCCCAGTGGG + Intergenic
1101018282 12:100524969-100524991 CCCTCCTCTTGTCTCCCAGGTGG + Intronic
1101814939 12:108138918-108138940 GTCTCCTCTGTCCTCCCAGGGGG - Intronic
1101954789 12:109203667-109203689 CTGTCCTCAGGACCACCAGGGGG + Intronic
1103936386 12:124479773-124479795 CTCCCCTCTGGTCTCCCTGGTGG - Intronic
1104272237 12:127292954-127292976 CTCTCTTCTGGAGACCCTGGGGG - Intergenic
1104280277 12:127370572-127370594 TTCTTCCCTGGACCTCCAGGAGG - Intergenic
1104792331 12:131491768-131491790 CTCTCCTCTGGGCTCTCAGATGG - Intergenic
1105205715 13:18221822-18221844 CCCTCCTCTGCACCCCCTGCAGG + Intergenic
1105296494 13:19091244-19091266 TCCTCCTCTGGACACCCTGGGGG - Intergenic
1106920879 13:34562053-34562075 CTCTTCCCTGGAGCCCCAGAAGG + Intergenic
1109726869 13:66352537-66352559 CTCTCCACTGGAACTCCAAGAGG - Intronic
1112327971 13:98456418-98456440 CTGTCCTCCACACCCCCAGGAGG - Intronic
1113530468 13:111020728-111020750 CCCTCCTCCTGTCCCCCAGGTGG + Intergenic
1113955604 13:114098665-114098687 CTCTCCTCTGGACTCTCAGCCGG - Intronic
1113983006 13:114292016-114292038 CTCCCCACTGCACACCCAGGAGG - Intronic
1117912367 14:60648207-60648229 CTCTCCTCTTGCTCCCCAGAGGG - Intronic
1119170112 14:72528537-72528559 CTCTCCACTGCATCCCAAGGTGG + Intronic
1119749459 14:77067123-77067145 CCCTGCTCTGCACCCCCAGGAGG + Intergenic
1119903673 14:78282604-78282626 CTGTCTGCTGGGCCCCCAGGAGG + Intronic
1121600992 14:95202888-95202910 CGCTCCACTGGCCCCCCATGAGG - Exonic
1122659838 14:103287842-103287864 CTCTACCCTAGACCCCCAGGAGG + Intergenic
1122775122 14:104113624-104113646 CTCTGGACTGGAGCCCCAGGAGG + Exonic
1123017605 14:105382857-105382879 CTCTCCTGCGGACGTCCAGGCGG + Exonic
1123024548 14:105418626-105418648 CTCTCCTTGGGACCCCCACCTGG + Intronic
1124651280 15:31476174-31476196 GTCTTCCCTGGGCCCCCAGGTGG - Exonic
1125724407 15:41861014-41861036 CCCTCCTCTGCACTCCCTGGAGG + Intronic
1127581064 15:60339850-60339872 CTGTCCTATGGCCCCACAGGTGG + Intergenic
1129690411 15:77710119-77710141 CAGGCCTCTGGAACCCCAGGGGG + Intronic
1129761165 15:78130182-78130204 CTCTCCCCTGACTCCCCAGGCGG - Intronic
1129920191 15:79312946-79312968 ATCTCCACTGCAACCCCAGGGGG + Intronic
1130510197 15:84582835-84582857 CTCTCCTCTTGACCTGTAGGTGG + Intergenic
1131184308 15:90262207-90262229 TTCTCCTCTGCACACCTAGGTGG + Intronic
1131587872 15:93715741-93715763 CTCTCATCTGGACCCACAGCAGG - Intergenic
1131599301 15:93830290-93830312 CCCTGCTCTGTGCCCCCAGGAGG - Intergenic
1132565017 16:618101-618123 CTCCCCTCAGGACATCCAGGTGG + Intronic
1132661027 16:1061603-1061625 CCCTTCTCTGGGGCCCCAGGTGG + Intergenic
1133215364 16:4288843-4288865 CTCTCATCTGGCCTCCCAGAGGG - Intergenic
1134070349 16:11256358-11256380 CTCTCTTCTGGACCCTCCCGCGG + Intronic
1136045255 16:27610176-27610198 CTCTCATCAGGCCCCCCAGGTGG + Intronic
1136073432 16:27802609-27802631 GGCTCCCCTGAACCCCCAGGAGG + Intronic
1138206983 16:55132578-55132600 CTCTCCTCCAGACCCCAAAGAGG + Intergenic
1138584508 16:57961144-57961166 CTCTCCCCTGCTGCCCCAGGAGG - Intronic
1139234314 16:65318468-65318490 TTCTCCTCTGGAAGCCCAGCAGG + Intergenic
1139511342 16:67430232-67430254 TGCTCCCCTGAACCCCCAGGGGG - Intergenic
1141434903 16:83994452-83994474 AACTCCTCGGGACCCCCAGCTGG - Intronic
1142069523 16:88083561-88083583 CTTTCCTGTTGACCCCGAGGAGG - Intronic
1142228937 16:88890377-88890399 CTGTCCTCTGGACCCCCGAGGGG + Intronic
1142287077 16:89175842-89175864 CTACTCTCTGGACTCCCAGGAGG + Intronic
1145289998 17:21535385-21535407 CTCTCCTCTGGTTGCCCAGCTGG - Exonic
1147428534 17:40357489-40357511 CTCACCCCTGCACCCCCAGCTGG + Intronic
1147998772 17:44375713-44375735 CACTCCTTTGCCCCCCCAGGTGG - Exonic
1148850223 17:50550988-50551010 TTCTCCTCAGGACCCCAAGGGGG + Exonic
1149612390 17:57967130-57967152 CTCTGCTCTGGATCCCCTGCGGG + Intergenic
1150127636 17:62648623-62648645 CCCTCCTCAGGTCTCCCAGGAGG - Intronic
1151350259 17:73527671-73527693 CGCTCCTCTGCACTGCCAGGAGG - Intronic
1151557764 17:74855095-74855117 CTCTCCGCAGGACCCTCCGGTGG - Exonic
1151977950 17:77492908-77492930 CCCTCCCCTGGGCCCCCGGGAGG - Intronic
1152119489 17:78409521-78409543 CTCTCCCCTGGGCACCCAGTGGG + Intronic
1152662240 17:81547900-81547922 CTCTCCTCTTGGGCCACAGGAGG + Intronic
1153685938 18:7545407-7545429 CTCTCCCCTAGAGCCCCTGGAGG - Intergenic
1153945808 18:10016238-10016260 CTCTGCTCTGCCTCCCCAGGTGG - Intergenic
1153948177 18:10035134-10035156 CTTCCCTCAGGAGCCCCAGGAGG + Intergenic
1156453398 18:37279326-37279348 CACATCTCTGGGCCCCCAGGGGG - Intronic
1156499063 18:37545432-37545454 CTCATCTCTGGGCCCCCTGGAGG - Intronic
1156791138 18:40976230-40976252 CTGTCCTCAGGACTCCCAGTGGG + Intergenic
1158538077 18:58326251-58326273 GTCTTCTCTGAGCCCCCAGGTGG + Intronic
1158649817 18:59274427-59274449 TTCTCCTTTGGACCCCCTCGAGG + Intergenic
1159941649 18:74413054-74413076 CTTCACCCTGGACCCCCAGGAGG + Intergenic
1160029841 18:75249288-75249310 CTCTCCCCAGGACCCCGTGGGGG - Intronic
1160363851 18:78307802-78307824 CTCTACCATGGAGCCCCAGGAGG - Intergenic
1160411560 18:78678513-78678535 TTCTCCCCTGGAGCCCCAGAGGG - Intergenic
1160535653 18:79590012-79590034 CTCCCCTGTGGGGCCCCAGGAGG - Intergenic
1160576388 18:79856656-79856678 CTGTCCTCTGCAGTCCCAGGCGG - Intergenic
1160757916 19:767362-767384 CTCTCCTCTGGACAGCAGGGTGG - Intergenic
1160763952 19:798800-798822 CCCTCCTCGGGACACCCCGGGGG - Intronic
1160783833 19:890788-890810 CCACCCTCTGTACCCCCAGGAGG + Intronic
1161202768 19:3025132-3025154 CCCAGCTCTGGACTCCCAGGCGG + Intronic
1161483807 19:4524109-4524131 TTCCCCTATGGACGCCCAGGAGG + Intronic
1161620311 19:5293778-5293800 CATTCCCCTGGACCCCCAGCGGG - Intronic
1161722085 19:5908744-5908766 CCCTGCTCTGGACCCGCAAGAGG - Intronic
1162241731 19:9360625-9360647 CTCTGCTCTGGATCCATAGGTGG + Intronic
1163681435 19:18684522-18684544 CCCCCCTCTGGACCCCCTGGGGG - Intronic
1164854491 19:31510565-31510587 TGCTCCTCTGGACTCCCGGGTGG + Intergenic
1165427548 19:35754374-35754396 CTCCCCTCTGCCTCCCCAGGTGG + Exonic
1166269937 19:41707656-41707678 GTCTCCTCTTGCCCTCCAGGGGG + Intronic
1166500015 19:43333292-43333314 GTCTCCTCTTGCCCTCCAGGGGG - Intergenic
1166659615 19:44637772-44637794 CTCTCCTCTGGGAGGCCAGGGGG + Intergenic
1167341884 19:48921291-48921313 CTCTCTTCTGGGCCTCCAGGCGG - Exonic
1168267410 19:55230387-55230409 CTCTCCTCTGGACCCCCAGGAGG - Exonic
1168277906 19:55287195-55287217 CACCCCTCTTGACCCTCAGGTGG + Exonic
925130112 2:1488583-1488605 CCCTCCTCTGGGCTCCTAGGTGG + Intronic
925182803 2:1827801-1827823 CCTGCCTCTGGATCCCCAGGAGG - Intronic
925409150 2:3628829-3628851 CTGTCCTCTGGACACGCATGAGG - Intronic
926588831 2:14718385-14718407 CCCTCCTCTGGACCCCACGAAGG - Intergenic
928456578 2:31428152-31428174 CTCTTGTCTGGGCCTCCAGGTGG - Intergenic
932835030 2:75028119-75028141 CTGTCCTCTGGGTCCACAGGTGG - Intergenic
935175345 2:100643986-100644008 CTCTCCTCTGTCCCTTCAGGAGG + Intergenic
935256303 2:101313101-101313123 CTGGCCTCTGGACCCCATGGGGG - Intergenic
936513682 2:113168359-113168381 CTCTCCCCTCGCCTCCCAGGAGG + Intronic
938870745 2:135473754-135473776 CTTTCTTTTAGACCCCCAGGTGG + Intronic
939102721 2:137914087-137914109 CTCTCCCCTGTAGCCCCAGATGG - Intergenic
940883358 2:158968671-158968693 CTCTCCTCCGGCTCCCGAGGCGG - Exonic
941890545 2:170576506-170576528 CTCTCCACTGGACTCCCAACAGG - Intronic
942235882 2:173904453-173904475 CTATCTTGTGGAACCCCAGGAGG + Intergenic
942311788 2:174663278-174663300 TTCTCCTCTGCACCCCTTGGAGG - Intronic
944101940 2:196036611-196036633 CTGGTCCCTGGACCCCCAGGTGG - Intronic
946308721 2:218871287-218871309 CTCTCCTCGGGTCCCACAGCAGG - Intronic
947172498 2:227325410-227325432 CTCACCCCTGGGCCCACAGGAGG - Exonic
948623276 2:239250267-239250289 CTCTCCTCTCGGACCCCTGGGGG - Intronic
948887027 2:240889610-240889632 CTCTCCTGGGAACCCCCAGAGGG + Intronic
1169315641 20:4588335-4588357 CACCCCTCTGCACCCCCAGGAGG + Intergenic
1169336831 20:4763648-4763670 CCATCCTGTGGACCCCGAGGTGG - Intergenic
1169515463 20:6311817-6311839 CTCTCTTCTACACTCCCAGGTGG + Intergenic
1171192608 20:23169998-23170020 CCCTCCTCTGGATCCCCCTGGGG + Intergenic
1171965104 20:31523895-31523917 CTCCCCTCTGGAGCCACTGGAGG - Intronic
1173609423 20:44355823-44355845 CTCTCCACTGGAGCCCCGAGGGG - Intronic
1175257327 20:57655291-57655313 CTCTCCGTTAGCCCCCCAGGCGG + Intronic
1175545133 20:59773166-59773188 CGCTCCCCTGCACCTCCAGGAGG - Intronic
1175633434 20:60560796-60560818 CTCTTCTCGGGACCCTCAGTGGG - Intergenic
1175914279 20:62418565-62418587 CTGTCCCCTGCACCCCCTGGGGG + Intronic
1176429502 21:6567286-6567308 ATCTCCTCTGCTCCCCCAGTTGG + Intergenic
1176455242 21:6902373-6902395 CTCTCCCCAGTAGCCCCAGGTGG - Intergenic
1176833414 21:13767421-13767443 CTCTCCCCAGTAGCCCCAGGTGG - Intergenic
1178949454 21:36974324-36974346 CTCTCCTCTGGTCCACAAGGAGG - Intronic
1179704896 21:43174748-43174770 ATCTCCTCTGCTCCCCCAGTTGG + Intergenic
1179935947 21:44603348-44603370 CTCCCCTCTGGTTCTCCAGGAGG + Intronic
1179965303 21:44801560-44801582 CACTCCGCGGGACCCACAGGGGG + Intronic
1180717446 22:17881451-17881473 GTCTCCCGTGGGCCCCCAGGTGG + Intronic
1180760253 22:18196894-18196916 CCCTCCTCTGCACCCCCTGCAGG - Intergenic
1180770565 22:18381192-18381214 CCCTCCTCTGCACCCCCTGCAGG - Intergenic
1180775415 22:18427802-18427824 CCCTCCTCTGCACCCCCTGCAGG + Intergenic
1180808485 22:18738857-18738879 CCCTCCTCTGCACCCCCTGCAGG + Intergenic
1180828508 22:18884150-18884172 CCCTCCTCTGCACCCCCTGCAGG - Intergenic
1181071415 22:20343821-20343843 CCCTCCTCTGCACCCCCTGCAGG + Intergenic
1181194487 22:21172771-21172793 CCCTCCTCTGCACCCCCTGCAGG + Intergenic
1181214955 22:21320007-21320029 CCCTCCTCTGCACCCCCTGCAGG - Intergenic
1181388814 22:22564384-22564406 CTGCCCTCTGTACACCCAGGAGG - Exonic
1181818749 22:25459397-25459419 CTCCCCTCTGGCCCTGCAGGTGG + Intergenic
1182143216 22:27980569-27980591 CTGACCTCAGGATCCCCAGGTGG - Exonic
1182316919 22:29453887-29453909 CTCTCCTCTGCCCCCCGGGGAGG - Intergenic
1182516074 22:30859857-30859879 CTCTCCTTTGGTTACCCAGGAGG + Intronic
1183415776 22:37681058-37681080 CCCTACTCTGTACCCCAAGGAGG - Intergenic
1183541823 22:38433834-38433856 GCCTCCTCTGGACCCCCAGGAGG - Intronic
1184152308 22:42646248-42646270 CTGTCTCCTGGGCCCCCAGGTGG - Intronic
1184433512 22:44455761-44455783 GTCTCCACTTGACACCCAGGAGG + Intergenic
1185118237 22:48950188-48950210 CTGTCCTATGTGCCCCCAGGAGG - Intergenic
1203232400 22_KI270731v1_random:122364-122386 CCCTCCTCTGCACCCCCTGCAGG - Intergenic
949518002 3:4824664-4824686 CTCTCCTCTCTACCCGCAGAGGG - Intronic
950023684 3:9806638-9806660 CTCTCCTATGCCACCCCAGGTGG + Intronic
950673970 3:14543674-14543696 CTGTCCTCAGGAGCCCCTGGTGG - Intergenic
951791077 3:26485333-26485355 CTCTCCTCTAGGCCCCCCAGAGG + Intergenic
953546086 3:43864514-43864536 CTATTCTCTGGACCCAGAGGTGG + Intergenic
953705509 3:45226914-45226936 GTGTCCTCGGGACCCCCAGGCGG - Intergenic
955042284 3:55329345-55329367 CTCTCCTTTGGGCCTCCTGGAGG - Intergenic
956467804 3:69536256-69536278 CTCTCCTGGGGACCATCAGGGGG + Intronic
957283627 3:78186602-78186624 CTCTCCTCTTGTCCTCCAGCAGG + Intergenic
958682047 3:97343777-97343799 CTGCCCTCTTGACACCCAGGTGG - Intronic
958752871 3:98213312-98213334 CTCTACACTGGTCCCCCCGGGGG + Intergenic
961450186 3:126999160-126999182 CTCTTCTCAGGACCCCCACAGGG - Intronic
961451525 3:127004409-127004431 CTCTGCCCTGGAAACCCAGGGGG - Intronic
961452099 3:127006856-127006878 CTCTCCTCTGGGCTCACAGTGGG - Intronic
961653714 3:128430000-128430022 CTCCCCTCTGGCTGCCCAGGTGG - Intergenic
963040260 3:141065135-141065157 CTTTCCTGTGGACCCACAGTAGG + Intronic
966729486 3:183138708-183138730 CTCTCCCCTAGACCCCTCGGTGG + Intronic
968938961 4:3628117-3628139 CTCTCATCAGGACCCCCACGGGG - Intergenic
969711892 4:8849477-8849499 CTCTCCTCTAGAGCCTCTGGAGG + Intronic
970143705 4:13010665-13010687 TTCTTCTCTGGAACCCCAGAGGG - Intergenic
972426951 4:38942469-38942491 CTCTCCCCTGGCCACCCAGAAGG + Intronic
977474573 4:97489434-97489456 CTCTCATCTGGTCACCTAGGTGG - Intronic
978529953 4:109703109-109703131 CGCTACTCGGGACCGCCAGGAGG + Intronic
978697731 4:111602914-111602936 CTCTCTTCTCGACTCTCAGGTGG + Intergenic
980521024 4:133934645-133934667 CTTTCCTCTGGACTCACAGCTGG + Intergenic
980878299 4:138684305-138684327 TTCTCCTCTAGAGCCCCAGAAGG + Intergenic
981559272 4:146029221-146029243 CTCTCATCTGGAGCCTGAGGTGG + Intergenic
981635250 4:146870091-146870113 TTGTCCTCTGGACCCCCACTTGG - Intronic
982225877 4:153165983-153166005 CTCTCTTCTGGAACTCCAGTTGG + Intronic
984482423 4:180323018-180323040 CTCTGCTCCTGACCCCCAGCAGG + Intergenic
985331483 4:188841579-188841601 CTCTCTTCTGGACCCTGATGTGG - Intergenic
985892498 5:2726545-2726567 CTCCCCTCAGAACCCCCTGGAGG + Intergenic
989581052 5:43033792-43033814 ATCTGATTTGGACCCCCAGGAGG + Intergenic
993558209 5:89368090-89368112 CTCTTCTCTGGAGCCTCTGGAGG - Intergenic
993707735 5:91190432-91190454 CTCTCTCCTGCACCTCCAGGGGG - Intergenic
995490868 5:112690466-112690488 CTCTTCTCTGGAACCCTGGGAGG - Intergenic
997210741 5:132075286-132075308 CTTTCCTCTGGCCCCACATGGGG + Intronic
997413513 5:133707928-133707950 CTCCCATCTGTACTCCCAGGAGG + Intergenic
997586876 5:135048606-135048628 CTGGCCCCTGGACCCCCAGCTGG + Intronic
998292220 5:140926600-140926622 CTCGTCTCTGCACCCCTAGGCGG + Intronic
1002073721 5:176696013-176696035 CTCTCCCCTAGTCCCCCAGCAGG + Intergenic
1002317895 5:178356192-178356214 CTCCCCTCCGCAACCCCAGGCGG - Intronic
1002319562 5:178366855-178366877 CCCTCCTCTGCAGCCCCACGTGG + Intronic
1002419488 5:179138182-179138204 CTCCCCACAGGAACCCCAGGAGG - Intronic
1004470665 6:15926349-15926371 CTCAACACTGGAACCCCAGGAGG - Intergenic
1004473300 6:15947954-15947976 CCCTCCTTGGGACCCCCAGTGGG - Intergenic
1006058865 6:31404687-31404709 CTCCCCTCCAGACCCCCAAGGGG + Intronic
1008626929 6:53326225-53326247 CTTTCCTGTGGACTCCCAGCTGG + Intronic
1009972471 6:70639408-70639430 CTCTCCTCTGGAACCACATGTGG - Intergenic
1012226128 6:96705101-96705123 CTCTCTTCTGGACCCACATAGGG + Intergenic
1017934728 6:158995420-158995442 TTCTCCCCAGGACCTCCAGGAGG - Intronic
1019340165 7:505192-505214 ATGTCCTCAGGACCCCCACGGGG + Intronic
1019501866 7:1368805-1368827 CTCTCCCCAGGACACCCAGCCGG + Intergenic
1019717627 7:2547285-2547307 CTCTCCACGGGACACTCAGGTGG + Intronic
1019937893 7:4268291-4268313 CTCTGCCCTGGCACCCCAGGAGG - Exonic
1021979924 7:26044393-26044415 TTCTCGTCTTGACCCCAAGGCGG + Intergenic
1022067523 7:26874844-26874866 CTCTTCTCTGGAGATCCAGGTGG - Intronic
1023888908 7:44379037-44379059 GTCTCCTCTGCTCCCCTAGGTGG - Intergenic
1024841828 7:53595860-53595882 ATCTCCCCTGGCACCCCAGGAGG + Intergenic
1025271860 7:57529146-57529168 CTCTCCTTCGGACCTCCAGTTGG - Intergenic
1032001360 7:128267566-128267588 CTCTTCCCCGGACCCCCTGGCGG - Intergenic
1032021104 7:128407458-128407480 CGCTCCCCTGGTCCCCCATGTGG - Intronic
1033607111 7:142935754-142935776 CACTCCTCAAGACCCCCAGAGGG - Intergenic
1034184066 7:149160962-149160984 CTCTGCTCTGCACCCCAAGGAGG + Intronic
1035601793 8:901592-901614 CTCTCCTCTGAACCCCTACCCGG - Intergenic
1035777763 8:2202840-2202862 CTCTCCTCTTGAGCCCTGGGAGG - Intergenic
1036202191 8:6778993-6779015 CCCTCCTGTGGCTCCCCAGGTGG + Intergenic
1036236646 8:7044724-7044746 CTCTCCTCTGATGCCCCTGGAGG + Intergenic
1036648245 8:10625477-10625499 CTCCCCACTTGACCCCCAGCTGG - Intronic
1037494761 8:19428040-19428062 TTCTCCTCTGGATCCCCTGCAGG + Intronic
1037560082 8:20065738-20065760 ATCTCCCCTGGAACCCCGGGAGG + Intergenic
1037745965 8:21644342-21644364 CTCTCCCCAGGAGCCCCACGTGG - Intergenic
1037903321 8:22700987-22701009 CTCTCCTTGGGGCCCCCAGGGGG - Intergenic
1040599489 8:48870157-48870179 CTTTCATGGGGACCCCCAGGCGG - Intergenic
1041129410 8:54681682-54681704 CCCTCCCCTGGACCCCCAACAGG + Intergenic
1042358896 8:67860020-67860042 CTCTCCTCTTGTCTCCCAGGTGG - Intergenic
1042651910 8:71052453-71052475 CTCTTCACAGCACCCCCAGGAGG + Intergenic
1044310441 8:90686424-90686446 CACTCCTCTTGACCCACAGCAGG + Intronic
1045063082 8:98425131-98425153 CTCTCCACAGCACCCCCATGGGG + Intronic
1045317752 8:101058041-101058063 GGCTCCTGTGGACCCCCTGGGGG + Intergenic
1046211306 8:111080672-111080694 GTCTCCTCTTGAACCTCAGGTGG - Intergenic
1048422834 8:134294376-134294398 CTCTCATCTGGACCACATGGGGG - Intergenic
1049156872 8:141072748-141072770 CTCCCCTCTGGACCCCCCTGTGG - Intergenic
1049382006 8:142320831-142320853 CACTCCTCTAGACTCCCATGTGG + Intronic
1049396775 8:142404567-142404589 GTCTCCCCTGGGCTCCCAGGAGG + Intergenic
1049962806 9:752789-752811 GTCTCCTCTGGAAACCCAGGTGG + Intergenic
1052977386 9:34421288-34421310 CTTACCTCTGTACCCCCAGCTGG - Intronic
1053206602 9:36191258-36191280 CTCTCACCCGGACCCCCCGGCGG - Exonic
1054451783 9:65407203-65407225 CTCTCATTAGGACCCCCACGGGG + Intergenic
1057447497 9:95127572-95127594 CTCTCCGCTGTGCGCCCAGGGGG + Intronic
1057788255 9:98104813-98104835 CTCTCCACAGGACCCAGAGGTGG - Intronic
1057937886 9:99256285-99256307 CTGTCCTCTGGAGCCCCACAGGG + Intergenic
1058045337 9:100352330-100352352 CCGTCCTCTGGTCGCCCAGGCGG - Intronic
1058879537 9:109274438-109274460 CTCTCCTCCAGACCCACAGAGGG + Intronic
1060031617 9:120219128-120219150 ACATCCTCTGGACCCCTAGGTGG - Intergenic
1061199915 9:129131841-129131863 CTCTGCTGTGGTCCACCAGGGGG + Intronic
1061401127 9:130369031-130369053 TTCTCCTCTGGACCACTGGGGGG - Intronic
1061446448 9:130640853-130640875 CTCTCCTCTGAAGCCCCAGACGG - Intergenic
1062367738 9:136219336-136219358 GTCTCCTCTTATCCCCCAGGTGG - Intronic
1062396430 9:136354689-136354711 GTCTCCTGTGGCCCCCCAAGGGG - Intronic
1062399560 9:136366457-136366479 CTCACCTCTGCACCCCGTGGGGG + Intronic
1062436472 9:136548596-136548618 CTCCCCTCAGCACCCGCAGGGGG - Intergenic
1062496955 9:136836432-136836454 CCCTCCTGAGGCCCCCCAGGAGG + Intronic
1062583056 9:137236770-137236792 CTCTCCCCTGCGCCCCCAGGAGG - Intergenic
1190108787 X:47576403-47576425 CTGTCCCCTTGTCCCCCAGGAGG - Exonic
1193359927 X:80569980-80570002 CTCCCCTCTGTGCTCCCAGGAGG + Intergenic
1195720628 X:107864341-107864363 CTCTCCTCTGTACCCCATGAAGG - Intronic
1195974882 X:110515760-110515782 CTCTGCTCTGGACCCCCAAATGG - Intergenic
1199854997 X:151752741-151752763 CTATCCTCTGACTCCCCAGGAGG - Intergenic