ID: 1168267422

View in Genome Browser
Species Human (GRCh38)
Location 19:55230421-55230443
Sequence GTCAGGGTGATGAGGGCAAT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 319
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 297}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168267408_1168267422 15 Left 1168267408 19:55230383-55230405 CCAGCCTCCTGGGGGTCCAGAGG 0: 1
1: 0
2: 1
3: 58
4: 388
Right 1168267422 19:55230421-55230443 GTCAGGGTGATGAGGGCAATGGG 0: 1
1: 0
2: 0
3: 21
4: 297
1168267405_1168267422 23 Left 1168267405 19:55230375-55230397 CCCTGGCACCAGCCTCCTGGGGG 0: 1
1: 1
2: 4
3: 41
4: 436
Right 1168267422 19:55230421-55230443 GTCAGGGTGATGAGGGCAATGGG 0: 1
1: 0
2: 0
3: 21
4: 297
1168267410_1168267422 11 Left 1168267410 19:55230387-55230409 CCTCCTGGGGGTCCAGAGGAGAG 0: 1
1: 0
2: 1
3: 30
4: 299
Right 1168267422 19:55230421-55230443 GTCAGGGTGATGAGGGCAATGGG 0: 1
1: 0
2: 0
3: 21
4: 297
1168267411_1168267422 8 Left 1168267411 19:55230390-55230412 CCTGGGGGTCCAGAGGAGAGAAT 0: 1
1: 0
2: 2
3: 30
4: 222
Right 1168267422 19:55230421-55230443 GTCAGGGTGATGAGGGCAATGGG 0: 1
1: 0
2: 0
3: 21
4: 297
1168267416_1168267422 -1 Left 1168267416 19:55230399-55230421 CCAGAGGAGAGAATGTGGGGGTG 0: 1
1: 1
2: 3
3: 37
4: 265
Right 1168267422 19:55230421-55230443 GTCAGGGTGATGAGGGCAATGGG 0: 1
1: 0
2: 0
3: 21
4: 297
1168267407_1168267422 22 Left 1168267407 19:55230376-55230398 CCTGGCACCAGCCTCCTGGGGGT 0: 1
1: 1
2: 2
3: 44
4: 363
Right 1168267422 19:55230421-55230443 GTCAGGGTGATGAGGGCAATGGG 0: 1
1: 0
2: 0
3: 21
4: 297
1168267401_1168267422 30 Left 1168267401 19:55230368-55230390 CCTGTCTCCCTGGCACCAGCCTC 0: 1
1: 0
2: 7
3: 91
4: 728
Right 1168267422 19:55230421-55230443 GTCAGGGTGATGAGGGCAATGGG 0: 1
1: 0
2: 0
3: 21
4: 297

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168267422 Original CRISPR GTCAGGGTGATGAGGGCAAT GGG Exonic
900008952 1:88735-88757 CTCTGGGTGCTGAGGGCAAGAGG - Intergenic
900566046 1:3332376-3332398 GTCGGGGTGGTGTGGGCAGTGGG + Intronic
903856981 1:26343445-26343467 GACAGGGTGATGAGGCCCTTGGG - Intronic
904696561 1:32334951-32334973 GCCAGGGTGCTGAGGCCAAGGGG - Exonic
907280733 1:53345638-53345660 TACAGGGTGATGAGGGCCATGGG - Intergenic
907481348 1:54747565-54747587 ATCAGGTTGATGTGGGCAGTTGG - Intergenic
907782939 1:57583743-57583765 GTGAGGCTCATGAGGGCAATTGG - Intronic
908421159 1:63959761-63959783 GGAAGGGTAAGGAGGGCAATGGG - Intronic
909377957 1:74961577-74961599 GCCAGTGTGATGTGGGCACTGGG - Intergenic
909740640 1:79025715-79025737 GTCATGGTGAAGAGGACAGTTGG + Intergenic
911410954 1:97505893-97505915 GGCAGGATGAAAAGGGCAATGGG + Intronic
911759322 1:101598380-101598402 GTCAGTGTCATGAGGGGAACAGG + Intergenic
914044761 1:144081984-144082006 GTCAGCGTGATGAGGACTAGAGG - Intergenic
914133349 1:144878702-144878724 GTCAGCGTGATGAGGACTAGAGG + Intergenic
914938925 1:152004773-152004795 CTCAGGCTGATGTGGGCTATAGG - Intergenic
918049007 1:180958265-180958287 GTGAGGATGATGATGGCAAATGG + Intergenic
919379945 1:196847659-196847681 TTCAGGGTGATGAGGGCCCCTGG + Intronic
919579669 1:199355852-199355874 GTCAGGGGGTTGGGGGCAAGGGG + Intergenic
924618008 1:245630578-245630600 GTCAGGGGGTTGAGGGAAAGGGG + Intronic
924781832 1:247156947-247156969 TTCATGGTAATGAAGGCAATTGG + Exonic
1064280974 10:13951234-13951256 GTCAAGGTTATGAGGGCATATGG + Intronic
1064788929 10:18933705-18933727 GTCAGGGGGTGGAGGGCAAGGGG - Intergenic
1066220128 10:33329382-33329404 GTCAGAGAGATGAGGTCATTTGG - Intronic
1066956884 10:42181663-42181685 GTCAGCGTGATGAGGACTAGAGG - Intergenic
1068127691 10:52861905-52861927 GTCAGGGGGTGGGGGGCAATGGG - Intergenic
1070157518 10:73844767-73844789 GTGAGGGTGAGGAGGGGCATGGG - Intronic
1071296131 10:84221282-84221304 ATCAGGGTGATGAGAGCTGTTGG - Exonic
1075203746 10:120428585-120428607 GTCATGGTCATGAAGACAATCGG - Intergenic
1075983377 10:126761201-126761223 GTCAGGAGGTTGAGGGCAAGAGG - Intergenic
1077522768 11:3046064-3046086 GCCTGGGTGATGAGGGGATTTGG + Intronic
1077971314 11:7193970-7193992 GTCAGGGGGTCGAGGGCAAGGGG + Intergenic
1081484165 11:43515306-43515328 GTTAGGGGGATGAAGGCAAAGGG - Intergenic
1085045510 11:73350745-73350767 GTCAGGGTGGTCAGGGGAAGGGG - Intronic
1087650967 11:100866957-100866979 ATCAGGGTGATCAGGTAAATTGG + Intronic
1087706430 11:101497849-101497871 GTCAGGGGGTGGGGGGCAATGGG - Intronic
1088460078 11:110073727-110073749 GACAGAGTGATCAGGGAAATGGG - Intergenic
1089369721 11:117946896-117946918 CTCAGGGTGATGAGTGCCATTGG - Intergenic
1089706079 11:120278760-120278782 GTCAGGGGGTGGAGGGCAAGGGG + Intronic
1089827380 11:121291029-121291051 GTCAGGGGGTGGAGGGCAAGGGG + Intergenic
1089954043 11:122554364-122554386 GTCAGTGTCATGAGGGGAACAGG - Intergenic
1092096164 12:5843669-5843691 GTCAGGGTGAGGAGGGAACGCGG + Intronic
1093084653 12:14853099-14853121 GTCAGGGTAGTGAGGACAAAAGG - Intronic
1094723482 12:33089050-33089072 GTCAGTGTCATGAGGGGAACAGG + Intergenic
1095806061 12:46322446-46322468 GTCAGTGTTATGAGGGGAACAGG + Intergenic
1096535137 12:52267224-52267246 GCCAGGATGATGAAGGCAAGAGG + Intronic
1097948256 12:65397753-65397775 GTCAGGGTGTTGGGGGCTAGGGG - Intronic
1098726365 12:73972795-73972817 GTCAGGGGGTGGAGGGCTATGGG + Intergenic
1099052178 12:77793467-77793489 GTCAGGGTGTGGGGGGCAAGTGG - Intergenic
1099338369 12:81394650-81394672 GTCAGGGTGTTGGGGGCAAGGGG + Intronic
1099375887 12:81896100-81896122 GTCTGGGGGATGGGGGAAATGGG - Intergenic
1101245623 12:102881609-102881631 GGTAGGGTGATGAGAGAAATTGG - Intronic
1102373066 12:112398788-112398810 GTCAGGGAGTTGAGGGCAAGGGG + Intergenic
1102432918 12:112897655-112897677 GTCAGGCTGGTGAGAGCAAGGGG - Exonic
1102777294 12:115531669-115531691 GTGAGGGTGAGGATGGGAATTGG - Intergenic
1102833692 12:116032733-116032755 ATCAGTGTGATGAGTGCTATTGG - Intronic
1103612982 12:122135340-122135362 GCCAGGGTGAGGAGGGCCCTAGG + Exonic
1103889647 12:124228766-124228788 GTCTGGGTGACGAGGTGAATGGG + Intronic
1105672132 13:22631193-22631215 GTCAGGGGGTTGGGGGCTATGGG - Intergenic
1106654185 13:31724892-31724914 GTCAGGGGGTTGGGGGCAAAGGG + Intergenic
1106963259 13:35026899-35026921 GTTAGGGTTATGAGGGTAAGAGG - Intronic
1107408680 13:40138778-40138800 GTCAGGGTGAGCAGGGTAGTAGG + Intergenic
1107425185 13:40285608-40285630 GGGAGGGTGATGATGGCAAGAGG + Intergenic
1108003687 13:45927042-45927064 GTGAGGGTGATGAGGTAAAGAGG + Intergenic
1109178278 13:59181984-59182006 GTCAGGGTGATGTTGGCAGTTGG - Intergenic
1109459881 13:62642998-62643020 GTCAGGGTGGAGTAGGCAATTGG - Intergenic
1110080255 13:71300431-71300453 GTCTGGGTGTGGAGGGCAACTGG + Intergenic
1111666746 13:91279034-91279056 GTCAGTGTGATGAGTCCAGTAGG + Intergenic
1113645658 13:111993540-111993562 GTCATGGTGCTGAGTGCTATGGG - Intergenic
1113669351 13:112164885-112164907 GTCAGGATTATGAGAGCAGTGGG - Intergenic
1114998282 14:28387791-28387813 TTCAGTGTGATGTGGGCTATGGG + Intergenic
1115162872 14:30415342-30415364 GTCAGGTTGATAAGGGGAAATGG - Intergenic
1118976435 14:70681406-70681428 GTCAGGGAGATGAGAGGACTGGG + Intergenic
1119447151 14:74675154-74675176 GTGATGGTAATGAGGGAAATGGG - Intronic
1119671916 14:76526503-76526525 GTCAGAATGATAAGGGCAAGTGG - Intergenic
1120714369 14:87824267-87824289 TTCAGTGTGATGAGGGGGATTGG - Intergenic
1120925804 14:89796135-89796157 AACAGGGTGATGAGGGTACTGGG - Exonic
1122256696 14:100483393-100483415 GACAGGGTGGTGTGGGCCATTGG - Intronic
1202936228 14_KI270725v1_random:90117-90139 GTCAGCGTGATGAGGACTAGAGG + Intergenic
1124463969 15:29919708-29919730 GCCAGGCTGATGAGGGCAGCTGG - Intronic
1124801149 15:32833982-32834004 GTCAGGGTGAAGATGACAAAGGG - Intronic
1128107580 15:65055929-65055951 TTCATGGTGAGGAGGGCAAAAGG + Intronic
1128328553 15:66741068-66741090 GGCAGAGGGATGAGGGCCATTGG - Intronic
1129091521 15:73156512-73156534 GCCAGGGTGGTATGGGCAATGGG + Intronic
1129581596 15:76817412-76817434 GTCAGGGGGAGGAAGGAAATAGG + Intronic
1130320163 15:82835003-82835025 GTGAGGGTGATGAGGTTAGTAGG - Exonic
1130877588 15:88028039-88028061 GTGAGGGTGAGGAGGGAAAATGG + Intronic
1130974858 15:88766334-88766356 GTGAGGGTGATGTGGACAACTGG - Intergenic
1132214998 15:100055958-100055980 GTCAGAGTGATAAGTGCAGTAGG - Intronic
1133545041 16:6797982-6798004 GTGATGGTGATGATGGGAATAGG + Intronic
1134610178 16:15601684-15601706 GTCAGGGCGGTCAGGGCAGTGGG - Intronic
1138850880 16:60627909-60627931 GTCAGGGGGTTGAGGGCAAGGGG + Intergenic
1141583967 16:85020655-85020677 GTCAGTGTGTGGAGGGCAAGGGG + Intergenic
1141585988 16:85033966-85033988 GTGAGGGGGATGATGGTAATTGG - Intronic
1141743818 16:85912817-85912839 TCCAGGGCGTTGAGGGCAATTGG + Intronic
1142455384 16:90218229-90218251 CTCTGGGTGCTGAGGGCAAGAGG + Intergenic
1145061818 17:19738598-19738620 GGCTGGGTGCTGAGGGCCATAGG - Intronic
1146166770 17:30595711-30595733 GACAGGGTGTTGAGATCAATTGG + Intergenic
1146749098 17:35361436-35361458 TTCAGGGTGATGAGGGTCACGGG - Intronic
1146797195 17:35790843-35790865 GTCAGTGTGAAGTGGGAAATGGG - Intronic
1147426550 17:40348490-40348512 GACAGCTTGATGAGGTCAATGGG + Intronic
1149407121 17:56363924-56363946 GTCAGGGGGTTGGGGACAATGGG + Intronic
1150410377 17:64936809-64936831 CTCAGGGAGATGAGGGGATTTGG + Intergenic
1151003913 17:70411956-70411978 GTCAGGGGGTGGGGGGCAATGGG - Intergenic
1151475960 17:74344508-74344530 GTCAGCGTGGTGGGGGCATTGGG - Intronic
1152584787 17:81184108-81184130 GCCAGGGTGGTGCGGGCAGTGGG - Intergenic
1153129969 18:1844412-1844434 GTCAGGGTGCTGGGGGCTAAGGG - Intergenic
1155006014 18:21729816-21729838 GATTAGGTGATGAGGGCAATGGG - Intronic
1155115738 18:22764788-22764810 GTCAGGGGGTTGGGGGCAAGGGG + Intergenic
1156068694 18:33177202-33177224 GTCAGGGGGTTGAGGGAAAGGGG + Intronic
1156511234 18:37638390-37638412 TTGAGGGTGAGGAGGGAAATGGG + Intergenic
1156534384 18:37848696-37848718 CTCTGGGTAATGAGGGTAATAGG + Intergenic
1156916480 18:42468539-42468561 GTCAGTGTTATGAGGGGAACAGG - Intergenic
1158880114 18:61769920-61769942 GCCAGGGAGATGAAGGCAATTGG - Intergenic
1163809408 19:19421252-19421274 GCCAGGGAGGTGAGGGCAGTAGG + Intronic
1164046478 19:21547039-21547061 GTCAGGGTGTGGGGGGCAATGGG - Intronic
1164886768 19:31784873-31784895 GCCAGGGTGACAAGGGTAATGGG + Intergenic
1166775829 19:45311905-45311927 GTCAGGCTGTTGAGAGCTATGGG + Exonic
1168267422 19:55230421-55230443 GTCAGGGTGATGAGGGCAATGGG + Exonic
1202684319 1_KI270712v1_random:35389-35411 GTCAGCGTGATGAGGACTAGAGG - Intergenic
925005691 2:441463-441485 GTCAGGGTGGTGAGGGAAGCAGG - Intergenic
926585392 2:14680264-14680286 GTCAGGGGGTGGAGGGCAAAGGG + Intergenic
928787225 2:34903223-34903245 GTCAGGGGGTGGAGGGCAAGGGG + Intergenic
929581054 2:43082099-43082121 GTCAAGGTGGTGAGGTCAAGGGG + Intergenic
930352026 2:50268633-50268655 GTCTGGGTGATGTGTGCTATGGG - Intronic
931243763 2:60476121-60476143 GTCAAGGTCATGAGGGGAACAGG - Intronic
933246734 2:79984646-79984668 GTCAGTGTGCTGAGGGCAGAGGG + Intronic
934247399 2:90319458-90319480 GTCAGCGTGATGAGGACTAGAGG + Intergenic
934261926 2:91483145-91483167 GTCAGCGTGATGAGGACTAGAGG - Intergenic
934304966 2:91814133-91814155 GTCAGCGTGATGAGGACTAGAGG - Intergenic
934328291 2:92038615-92038637 GTCAGCGTGATGAGGACTAGAGG + Intergenic
934466670 2:94269156-94269178 GTCAGCGTGATGAGGACTAGAGG + Intergenic
934658903 2:96132723-96132745 TGCAGGGTGATGAGAGCAAGTGG + Intronic
934785294 2:97000781-97000803 GTCAGGGGGTGGAGGGCAAGGGG - Intronic
935092069 2:99904943-99904965 GTCAGGATGATGGGGCCACTGGG - Intronic
935648743 2:105363920-105363942 GTGAGGGTGATGAGGTTAATTGG + Intronic
936822177 2:116535533-116535555 GTCGGGGTCACAAGGGCAATTGG - Intergenic
940745674 2:157564953-157564975 GTCAGGGGGTGGAGGGTAATGGG + Intronic
941267278 2:163378299-163378321 GTCAGGGGGTTGGGGGCAAGGGG - Intergenic
941288318 2:163643154-163643176 GTCAGGGTGATGCTGGCATAAGG + Intronic
943240761 2:185380498-185380520 GTCAGGGGGTTGGGGGCAAGGGG + Intergenic
943865826 2:192923641-192923663 GTCAGTGTCATGAGGGGAACAGG - Intergenic
943881256 2:193147347-193147369 GTCTGGGGGATGAAGGAAATAGG + Intergenic
945830879 2:214783558-214783580 GTCAGGGGGTTGGGGGCAAGGGG + Intronic
946028342 2:216686105-216686127 GACTGGATGATGAGGGCTATAGG + Intronic
946096864 2:217281938-217281960 GTCAGGGTAATGTGGGACATAGG + Intergenic
946420261 2:219560830-219560852 GGGAAGGTGATGAGGGCAGTGGG + Intronic
948755196 2:240155373-240155395 GTCAGAGGGAGGAGGGCGATGGG - Intergenic
949009798 2:241671972-241671994 GGCAGGGTGAGGAGGGCAGGGGG - Intronic
949064591 2:241982100-241982122 GTGAGAGTGATGAGGGGAAAAGG - Intergenic
949086883 2:242163026-242163048 CTCTGGGTGCTGAGGGCAAGAGG + Intergenic
1170963319 20:21044467-21044489 GCAAGGGTGGTGAGGGCAAGGGG + Intergenic
1173220815 20:41131692-41131714 TTCAGTGTGATGGGGGCCATTGG - Intergenic
1173905737 20:46627389-46627411 TTCAGTGTCATGAGTGCAATAGG + Intronic
1174197466 20:48783651-48783673 GTCAGGGTGCTGTGGGCTCTCGG - Intronic
1175156947 20:56977625-56977647 GGCAGGGTGATGATGGGAATGGG - Intergenic
1175190799 20:57211098-57211120 GTCAGGGTGCTGAGGGCCCCCGG - Intronic
1176331543 21:5553321-5553343 GTTAGGGTGTTGAGGTCAAGGGG + Intergenic
1176396214 21:6267630-6267652 GTTAGGGTGTTGAGGTCAAGGGG - Intergenic
1176440943 21:6721474-6721496 GTTAGGGTGTTGAGGTCAAGGGG + Intergenic
1176465205 21:7048543-7048565 GTTAGGGTGTTGAGGTCAAGGGG + Intergenic
1176488766 21:7430321-7430343 GTTAGGGTGTTGAGGTCAAGGGG + Intergenic
1176587273 21:8599487-8599509 GTCAGCGTGATGAGGACTAGAGG - Intergenic
1178714116 21:34948035-34948057 GTGGGGATGATGAGGGTAATGGG - Intronic
1179433419 21:41342246-41342268 GTGACGGGGACGAGGGCAATGGG - Intronic
1179464810 21:41564539-41564561 CTCAGAGAGATGAAGGCAATGGG - Intergenic
1180270104 22:10576484-10576506 GTCAGCGTGATGAGGACTAGAGG - Intergenic
1180280579 22:10689793-10689815 GTCAGCGTGATGAGGACTAGAGG + Intergenic
1180968192 22:19801363-19801385 GTCAGGCTGGTGGGGGCAAGGGG - Intronic
1181186272 22:21107196-21107218 GTCAGGGGGTTGGGGGCAAGGGG - Intergenic
1181685737 22:24526755-24526777 GTCAGGGTAAAGAGGGTAGTTGG + Intronic
1182415850 22:30221097-30221119 GTTGGAGTGATGAGGGCAAAGGG + Intergenic
1183929545 22:41228105-41228127 GTCAGGGTGCTGAGGAAAAGAGG + Intronic
1184281552 22:43440406-43440428 GCCAGGGTGCTGAGGGCAGGAGG + Intronic
1184327617 22:43802190-43802212 GGCATGGTGATGATGGCAGTGGG - Intronic
1184959007 22:47915211-47915233 GTCAGGGCGATGAGGGAAAGTGG + Intergenic
950613186 3:14139135-14139157 GTCAGGATGCTGAGGGCCAGTGG - Intronic
950623965 3:14230773-14230795 GTGACTGTGATGAGAGCAATAGG - Intergenic
951415302 3:22415900-22415922 ATCAGGGTGGTAAAGGCAATGGG + Intergenic
951652454 3:24965807-24965829 GTCAGGGGGATGAGGAAACTGGG - Intergenic
951656380 3:25013573-25013595 GTCAATGAGATGAGGGCAAATGG - Intergenic
953661575 3:44894822-44894844 GTGAGGGTGGAGAGGGCACTCGG - Intronic
954608281 3:51930443-51930465 ATCAGGGAGGTGAAGGCAATAGG - Intergenic
954812699 3:53257726-53257748 GTCTGGCTGGTGAGGGCTATGGG + Intergenic
955690571 3:61586621-61586643 GTCATAGTGATGAGACCAATAGG + Intronic
957866941 3:86037981-86038003 GTCAGGGGGTTGGGGGCAAATGG - Intronic
959454299 3:106539887-106539909 GTCAGGGGGTTGGGGGCAAGGGG + Intergenic
961581965 3:127890764-127890786 GTCAGGGTGGAGCGGGTAATCGG - Intergenic
962064917 3:131969202-131969224 GTCAGGGAGTTGGGGGCAAGGGG + Intronic
963590690 3:147254342-147254364 GTCAGAGTCAGGAGGGCAATGGG - Intergenic
964143242 3:153427887-153427909 GTCAGGGTGTGGGGGGCAAGGGG - Intergenic
964905377 3:161713029-161713051 GTCAGGGGGTGGAGGGCAAGGGG + Intergenic
965219135 3:165903806-165903828 GTCATGGTCCTGAGAGCAATGGG - Intergenic
965618127 3:170615457-170615479 GTCAGGGGGTTGGGGGCAAGGGG - Intronic
966873275 3:184306323-184306345 GTCAGGGTGGTGAGGGAGAATGG - Intronic
967597898 3:191349452-191349474 GTTAGAGAGATGAGGGCAAGTGG + Intronic
968347966 3:198027199-198027221 GGCCGGGTGACGAGGGTAATGGG - Intronic
969164270 4:5292936-5292958 GTCAGGGAGTAGGGGGCAATGGG - Intronic
969234569 4:5856595-5856617 GTCATGGTGATGATGGTGATGGG - Intronic
969393757 4:6907832-6907854 GTCTGGGCGCTGAGGGCAACAGG + Intergenic
971859680 4:32087861-32087883 GTCAGGGGGAACAGGGCACTAGG - Intergenic
972032343 4:34477443-34477465 GTTCGGGTCATGAGGGCTATTGG + Intergenic
974864225 4:67560971-67560993 GTCAGGGAGAAGAGAGCAAGAGG + Intronic
975098875 4:70489423-70489445 GTCAGGGGGTGGAGGGCAAGGGG + Intergenic
977426100 4:96868851-96868873 GTCAGGGGGTAGAGGGCAAGGGG + Intergenic
977586849 4:98783743-98783765 TTCAGGGGGATTTGGGCAATGGG - Intergenic
978476598 4:109138131-109138153 GTCAGGGGGATGGGAGCAAAGGG - Intronic
981238417 4:142445010-142445032 GTCAGGGTGTGGAGGCCAAGGGG + Intronic
982047927 4:151467825-151467847 GTCAGGGGGTGGAGGGCAAGGGG + Intronic
982814908 4:159872565-159872587 GTCGGGGGGTTGAGGGCAAGGGG - Intergenic
982957682 4:161792377-161792399 GGCAGGTTGATGACGGCAAAAGG + Intronic
983838290 4:172420999-172421021 GTCAGGGGGTTGGGGGCAAGGGG + Intronic
984230949 4:177097870-177097892 GTCAGGGAGATCAAGGCCATTGG - Intergenic
985535627 5:464427-464449 GTCAAGGTGATGAGGGAACTAGG - Intronic
985758601 5:1733458-1733480 GTCAGGGAGGAGAGGGCAAGCGG - Intergenic
988377464 5:30455777-30455799 GTCAGGGCGTTGGGGGCAAGGGG - Intergenic
990195577 5:53311335-53311357 CTCAGGCTGCTCAGGGCAATGGG - Intergenic
991110187 5:62891017-62891039 GTCAGGGTGTGGGGGGCAAGGGG - Intergenic
992825086 5:80541287-80541309 GTCAGGGTGAAAAGCACAATGGG - Intronic
993866438 5:93202216-93202238 GACAGGGTGATGAGGGGAAAGGG - Intergenic
993959387 5:94278108-94278130 GTCAGGGGGTTGGGGGCAAGTGG + Intronic
995062055 5:107821885-107821907 CTCAAGATGATGATGGCAATTGG - Intergenic
995183838 5:109252079-109252101 GTCAGGGGTATGAGGGGAAGAGG + Intergenic
996358026 5:122618117-122618139 GTCAGTGTCATGAGGGGAACAGG + Intergenic
996457248 5:123698962-123698984 GTCAGGGAGGTGAGGGCAGGGGG - Intergenic
997369148 5:133346238-133346260 GTCAGGGGGTTGGGGGCAAGGGG + Intronic
999460672 5:151755486-151755508 GTCAGGGTTATGAGGGCTGGCGG - Intronic
999508156 5:152219919-152219941 GTCATGGGGAGGAGGGCAAGGGG - Intergenic
1000171061 5:158703786-158703808 GCCAGGGAGATGGGGGCAAGGGG - Intronic
1000911176 5:167024475-167024497 GTCAGGGTGATGAAGAAAAATGG + Intergenic
1003985578 6:11431490-11431512 GTGAGGGAGAGGAGGGCATTGGG - Intergenic
1004234776 6:13864839-13864861 GTCAGGGGGTGGAGGGCAAGGGG - Intergenic
1004829488 6:19462151-19462173 GTCAGGGGGTGGAGGGCAAGGGG + Intergenic
1006228488 6:32561405-32561427 GTCAGCACGATTAGGGCAATTGG + Intronic
1006251659 6:32792319-32792341 GTCAGAGTGATGAATGCCATGGG - Intergenic
1008207915 6:48685926-48685948 GTCAGGGGGTGGAGGGCAAGGGG + Intergenic
1008352297 6:50506165-50506187 CTCAAGGTGATGAGGGTAACTGG + Intergenic
1008632518 6:53376776-53376798 CTCAGGATTAGGAGGGCAATTGG + Intergenic
1008801334 6:55372151-55372173 TTCAGGGTGATCAGAGGAATAGG - Intronic
1008860210 6:56139824-56139846 GTCTGGATGCTGAGGACAATGGG + Intronic
1011450335 6:87484745-87484767 GTCAGAGTGGAGAGGGTAATCGG + Intronic
1011772631 6:90691857-90691879 GTCAGAGAAATGAGGGCAGTGGG + Intergenic
1013046954 6:106496040-106496062 GACAGGCTGATGAGGGCAGAAGG - Intergenic
1013827246 6:114229087-114229109 GTCAGGTTGATGAGGTCTCTTGG + Intronic
1013832125 6:114285665-114285687 GTCAGGGTGGGGAGGGCGGTGGG + Intronic
1014137267 6:117904903-117904925 GGAAGGGAGATGAAGGCAATGGG - Intergenic
1015602944 6:134928197-134928219 GTCAGGGTGAGGAGGGGAAAAGG - Intronic
1015935414 6:138403336-138403358 GCCAGGGTGCTGAGGCCAAAGGG - Intergenic
1016169800 6:140998040-140998062 GTCTGGGTGGTGTGGGGAATGGG - Intergenic
1016991506 6:149932655-149932677 GTCAGGGGGTTGGGGGCAAGGGG + Intergenic
1018181174 6:161225059-161225081 GTCAGGGTGAAGCAGGTAATCGG - Intronic
1018191821 6:161315519-161315541 GTCAGGGTGAAGCAGGTAATCGG + Intergenic
1018644993 6:165940033-165940055 ATCTGTGTGATGGGGGCAATGGG + Intronic
1019331602 7:463214-463236 ACCAGTGTGATGAGGGCAAGGGG - Intergenic
1021208425 7:17812962-17812984 GTCAGGGGGTTGAGGGCTAGGGG + Intronic
1022210158 7:28200804-28200826 GTCAGGGTGGTGGGGGCAGAGGG + Intergenic
1022440312 7:30427646-30427668 GTCAGGGTGGAGAGGGGAACTGG - Intronic
1022792184 7:33700019-33700041 CTCAGGGTGTTGAGTGCAATTGG + Intergenic
1025210381 7:57016834-57016856 GTCGGGGTTATGAGGGGAGTGGG - Intergenic
1025888584 7:65623031-65623053 GTCAGGGGGTTGAGGGCAAAAGG + Intergenic
1026669980 7:72381696-72381718 GTCAGGGGCATGGGGGCAAGGGG + Intronic
1026901142 7:74038180-74038202 GTCAGGGTGATCTGGGGTATTGG - Intronic
1027583420 7:80026052-80026074 GTCAGGGGGTTGGGGGCAAGGGG + Intergenic
1028730224 7:94139016-94139038 GGCAGGGCGATGAGGTCAGTAGG + Intergenic
1030992216 7:116314323-116314345 GTAAGGTTGGTGAGGGGAATGGG + Intronic
1031784247 7:126008901-126008923 GTCAGTGTGTTGGGGGCAAGAGG - Intergenic
1031900227 7:127401255-127401277 GTCAGGGAGTGGAGGGCAAGGGG - Intronic
1033096445 7:138435722-138435744 GTCAGGGTGAAGCAGGTAATTGG + Intergenic
1035263805 7:157677736-157677758 GCCAGGATGATGAGGGTAAAGGG - Intronic
1035497843 8:68314-68336 CTCTGGGTGCTGAGGGCAAGAGG - Intergenic
1036069208 8:5421278-5421300 ATAAGGGCGATGAGGGCATTGGG - Intergenic
1038944883 8:32347786-32347808 GTGAGGGTGATGAGGGTGATGGG + Intronic
1041755120 8:61305082-61305104 GTAGGGGTGATGAGGGTCATAGG + Intronic
1042148918 8:65760693-65760715 GTCTGTGTGATGAGGGGAGTGGG - Intronic
1043072560 8:75657289-75657311 GAAAGGGTGATGAAGGCAAGTGG + Intergenic
1043478822 8:80631969-80631991 CTCAGGCAGATGAGGGCAAAGGG + Exonic
1044393581 8:91682349-91682371 GTCAGGGAGATAAGTGCAAGGGG - Intergenic
1045313027 8:101019775-101019797 GTCAGGGGGTTGGGGGCAAGGGG - Intergenic
1045652497 8:104354072-104354094 GTCAGTCTGCTGAGGGCAACTGG + Intronic
1046254066 8:111673414-111673436 GTCAGGGTGTTGGGGGCAAGGGG - Intergenic
1046291232 8:112164586-112164608 GTCAGGGTGTGGGGGGCAAGGGG - Intergenic
1047903453 8:129448603-129448625 GTGAGGATGAAGAGGGCTATGGG + Intergenic
1048397498 8:134028213-134028235 GTCAGGGAGTTGGGGGCAAGAGG - Intergenic
1049248748 8:141577058-141577080 GTCAGGGTGATGAGATCATGAGG - Intergenic
1049292710 8:141812980-141813002 GTCAGGGAGATGAGGGTGCTGGG - Intergenic
1049292718 8:141813004-141813026 GTCAGGGAGATGAGGGTGCTGGG - Intergenic
1049292775 8:141813165-141813187 GTCAGGGAGATGAGGGTGCTGGG - Intergenic
1049292799 8:141813235-141813257 GTCAGGGAGATGAGGGTGCTGGG - Intergenic
1049292863 8:141813417-141813439 GTCAGGGAGATGAGGGTGCTGGG - Intergenic
1049292949 8:141813644-141813666 GTCAGGGAGATGAGGGTGCTGGG - Intergenic
1049316707 8:141973032-141973054 GCCAGGGTGTTCTGGGCAATGGG + Intergenic
1051549904 9:18316287-18316309 GACAGGGTTTTGAGGGCAACTGG + Intergenic
1051746182 9:20297376-20297398 GTCAGGGTGAGGTGGCCAACAGG + Intergenic
1052654028 9:31333462-31333484 GTCAGTGTCATGAGGGGAACAGG - Intergenic
1053943141 9:43276139-43276161 GTCAGCGTGATGAGGACTAGAGG + Intergenic
1056244369 9:84679580-84679602 GTCAGGCTGGTGAGGTCAAGTGG - Intronic
1059354856 9:113690784-113690806 TTCAGGGAGATGAGGGGAAGGGG - Intergenic
1059674314 9:116523386-116523408 CTCAGGAGGATTAGGGCAATAGG - Intronic
1062004342 9:134231787-134231809 GCCAGGGTTATGGGGGCAGTGGG + Intergenic
1062246656 9:135571901-135571923 GTCAGGGTGGAGCAGGCAATCGG + Intergenic
1203430556 Un_GL000195v1:87013-87035 GTTAGGGTGTTGAGGTCAAGGGG - Intergenic
1203586236 Un_KI270747v1:5998-6020 GTCAGCGTGATGAGGACTAGAGG + Intergenic
1203617231 Un_KI270749v1:77199-77221 GTCAGCGTGATGAGGACTAGAGG - Intergenic
1185717030 X:2351076-2351098 GTCAGGGAGCTGGGGGCAAGGGG + Intronic
1185917671 X:4053890-4053912 GTCAGGGGGTGGAGGGCAAAGGG - Intergenic
1186401755 X:9266842-9266864 ATCAGGGAGAGGAGGCCAATAGG - Intergenic
1187504651 X:19869056-19869078 GTCAGGGTGATGTGAGGAAGAGG + Intronic
1187946749 X:24433582-24433604 GTCAGGGGGTTGGGGGCAAAGGG + Intergenic
1188989289 X:36798206-36798228 GGCTGGGAGAAGAGGGCAATAGG + Intergenic
1189382287 X:40510628-40510650 GGGTGGGTGATGAGGGCAAGAGG - Intergenic
1189742807 X:44138248-44138270 GCCAGGGGGCTGAGGGCAAGAGG + Intergenic
1191762023 X:64656373-64656395 GTCAGTGTCATGAGGGGAACAGG - Intergenic
1192539280 X:71954650-71954672 GTCAGGGCGCAGAAGGCAATGGG - Intergenic
1192723384 X:73723807-73723829 GTCAGGGGGTGGGGGGCAATGGG + Intergenic
1193605400 X:83561912-83561934 GTCAGGGTGTGGAGGGTAATGGG - Intergenic
1194125260 X:90008623-90008645 CCCAGGGTGATGAGGGCAGAGGG + Intergenic
1195549746 X:106154012-106154034 GTCAGGGTGTAGGGGGCAAGGGG + Intergenic
1196553680 X:117061391-117061413 GTCAGGGTGTGGAGGGCTAGGGG - Intergenic
1200163487 X:154020608-154020630 GTCAGGATCAAGAGGGCAAGGGG - Intergenic
1201194451 Y:11477902-11477924 GTCAGCGTGATGAGGACTAGAGG + Intergenic