ID: 1168271868

View in Genome Browser
Species Human (GRCh38)
Location 19:55254532-55254554
Sequence CTCTGCCGCCAGGGAACCGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 116}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168271860_1168271868 8 Left 1168271860 19:55254501-55254523 CCCACTGCTGCACGTATCCGCCC 0: 1
1: 0
2: 0
3: 2
4: 42
Right 1168271868 19:55254532-55254554 CTCTGCCGCCAGGGAACCGGTGG 0: 1
1: 0
2: 0
3: 13
4: 116
1168271857_1168271868 21 Left 1168271857 19:55254488-55254510 CCACAGAGCCATCCCCACTGCTG 0: 1
1: 0
2: 7
3: 66
4: 666
Right 1168271868 19:55254532-55254554 CTCTGCCGCCAGGGAACCGGTGG 0: 1
1: 0
2: 0
3: 13
4: 116
1168271861_1168271868 7 Left 1168271861 19:55254502-55254524 CCACTGCTGCACGTATCCGCCCA 0: 1
1: 0
2: 0
3: 7
4: 69
Right 1168271868 19:55254532-55254554 CTCTGCCGCCAGGGAACCGGTGG 0: 1
1: 0
2: 0
3: 13
4: 116
1168271856_1168271868 22 Left 1168271856 19:55254487-55254509 CCCACAGAGCCATCCCCACTGCT 0: 1
1: 0
2: 13
3: 267
4: 843
Right 1168271868 19:55254532-55254554 CTCTGCCGCCAGGGAACCGGTGG 0: 1
1: 0
2: 0
3: 13
4: 116
1168271858_1168271868 13 Left 1168271858 19:55254496-55254518 CCATCCCCACTGCTGCACGTATC 0: 1
1: 0
2: 1
3: 16
4: 202
Right 1168271868 19:55254532-55254554 CTCTGCCGCCAGGGAACCGGTGG 0: 1
1: 0
2: 0
3: 13
4: 116
1168271859_1168271868 9 Left 1168271859 19:55254500-55254522 CCCCACTGCTGCACGTATCCGCC 0: 1
1: 0
2: 0
3: 3
4: 40
Right 1168271868 19:55254532-55254554 CTCTGCCGCCAGGGAACCGGTGG 0: 1
1: 0
2: 0
3: 13
4: 116
1168271862_1168271868 -9 Left 1168271862 19:55254518-55254540 CCGCCCAAGCACAGCTCTGCCGC 0: 1
1: 0
2: 0
3: 26
4: 194
Right 1168271868 19:55254532-55254554 CTCTGCCGCCAGGGAACCGGTGG 0: 1
1: 0
2: 0
3: 13
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168271868 Original CRISPR CTCTGCCGCCAGGGAACCGG TGG Intronic
900494073 1:2968481-2968503 CTCTGCAGCCTGGGGGCCGGCGG + Intergenic
904334422 1:29787568-29787590 CTGTGCCTCCAGGAGACCGGTGG - Intergenic
905125742 1:35715008-35715030 CTCTGTCTCCAGGGAACAGTGGG + Exonic
910766145 1:90784348-90784370 CTCTGCAGTCAGGCAGCCGGGGG - Intergenic
914437178 1:147670414-147670436 CGCTGCCGCCAGGGAACTCAGGG - Exonic
916651678 1:166839645-166839667 CCCAGCCGCCCGGGACCCGGGGG - Intronic
917748066 1:178029765-178029787 CTCTGGAGCCAGGGACCTGGGGG - Intergenic
920749019 1:208656584-208656606 CTCTGGCTCCAGGGATCCTGTGG + Intergenic
1072732174 10:97853595-97853617 CTCTGCTGCCAGTGAGCCAGGGG + Intronic
1076123191 10:127952636-127952658 CTCAGCCTATAGGGAACCGGGGG + Intronic
1079097940 11:17522952-17522974 CTCAGCCCCCGGGGAACCTGGGG + Intronic
1081873175 11:46392263-46392285 CTGCGCCGCCAGGGATCCGTCGG + Intergenic
1084460141 11:69292610-69292632 CTCTGCCTCCAGGGAATCAGGGG - Intergenic
1084492506 11:69486492-69486514 CTCTGCCGCAAGGGGCCCGTGGG + Intergenic
1089735406 11:120547230-120547252 CTCTGCCTCCAGGGTACCCTGGG + Intronic
1090974633 11:131670978-131671000 CTCTGCCGACAGTGAAGCAGAGG - Intronic
1092570899 12:9720213-9720235 CTCTGCCCTTAGGGAACTGGGGG - Intronic
1097167829 12:57094964-57094986 CTCTGCCTCCAGGGCATCTGGGG + Exonic
1102452835 12:113054619-113054641 CTCTGCTCCCAGGGAACTTGGGG - Intergenic
1102727790 12:115080776-115080798 CTCTGCAGCCAGCCAACCTGGGG + Intergenic
1103400545 12:120640571-120640593 CTGGGCCGCCAGGGAGCCGGGGG + Exonic
1103523161 12:121549628-121549650 TTCTGCCTCCAGGGAGCCGGCGG - Exonic
1105686998 13:22793585-22793607 TTCTGCTGCCAAGGAATCGGTGG + Intergenic
1109835943 13:67857800-67857822 CTCTGTCGCCAGGGAAGTGGGGG - Intergenic
1113228121 13:108180996-108181018 ATCTGCCCCCAGAGAACCTGGGG - Intergenic
1118186487 14:63542940-63542962 CTCCGCCGCCGCGGAACCGGAGG - Exonic
1118586476 14:67358582-67358604 CTCAGCCGCCAGGGAGGCTGAGG + Intronic
1119718203 14:76873608-76873630 TTTTGCAGCCAGGGAAACGGGGG + Intergenic
1122143360 14:99675211-99675233 CCCAGCAGCCAGGGAGCCGGAGG + Exonic
1122861730 14:104585521-104585543 CTCTGCCGCCAAAGACACGGGGG + Intronic
1123024791 14:105419618-105419640 CTCTACCCCCAGGGCACCAGGGG + Intronic
1128291624 15:66482624-66482646 CCCTGTCCCCAAGGAACCGGTGG - Intronic
1130907581 15:88251483-88251505 CTCTGCCACCAGCCAACTGGAGG + Intronic
1132403795 15:101530186-101530208 CTCTGCCACCTGGGAATGGGGGG - Intergenic
1132525947 16:414818-414840 CTCTGGTGCCAGGGAACCTGGGG + Intergenic
1132547513 16:540200-540222 CTCTGCGGCCAGGGAGGAGGCGG - Intronic
1133097582 16:3458002-3458024 CGCTGCCGGCAGGGAGCGGGAGG + Intronic
1133767887 16:8850453-8850475 CTCTCCCTCCAGGGAGCCAGAGG - Intergenic
1135376811 16:21954170-21954192 GAATGCCCCCAGGGAACCGGTGG + Intronic
1139520795 16:67481602-67481624 GTCTGGGGGCAGGGAACCGGAGG + Intergenic
1140565779 16:76040389-76040411 CTCTCTCGGCAGGGAACGGGAGG - Intergenic
1143940335 17:10534239-10534261 CTCTGCCTCCAGGAAACCCTGGG + Intronic
1144669377 17:17124314-17124336 CTGTGCCTCCAGGGGGCCGGTGG + Intronic
1144944019 17:18960661-18960683 CTATGCCAGCAGGGAGCCGGGGG - Intronic
1147268201 17:39247572-39247594 CTTTTCCACCAGGGCACCGGGGG + Intergenic
1147985992 17:44308256-44308278 CCCTGCCGCCAGGGGAAAGGAGG - Intergenic
1149596633 17:57868233-57868255 CTCTGCCCCCAGCCACCCGGAGG - Exonic
1151266716 17:72962280-72962302 CTCTGGCCCCATGGAAACGGTGG - Intronic
1152391966 17:80008656-80008678 GTCAGGCGCCAGGGAACCCGAGG - Intronic
1153894235 18:9544154-9544176 CTCATCCACCAGGGAACCGAAGG + Intergenic
1154199850 18:12291877-12291899 CTCTGCCACACGGGAACCTGGGG - Intergenic
1155056546 18:22188836-22188858 CTCTGCCTCCAGGGATCCTGGGG + Intronic
1155162597 18:23207978-23208000 ATCTGGAGCCAGGGAACTGGGGG - Intronic
1157875557 18:51270226-51270248 CTCTGCAGCCTGGGAAACAGAGG - Intergenic
1158658195 18:59359501-59359523 CTCTGCCGCGCGGGAAGCGAAGG - Exonic
1160825271 19:1077294-1077316 CTCTGCAGCCCGGGAAGCTGAGG - Intronic
1166531028 19:43543677-43543699 CTCTCCCGCCAGGGAGCTCGAGG - Exonic
1168271868 19:55254532-55254554 CTCTGCCGCCAGGGAACCGGTGG + Intronic
927582137 2:24260818-24260840 CTCTTCAACCAGGGAGCCGGAGG + Intronic
927685528 2:25168245-25168267 CGCTGTCTCCAGGGAGCCGGCGG - Intronic
928186371 2:29115080-29115102 CGCTGCCAGCAGGGAACTGGTGG + Intronic
929594890 2:43169806-43169828 CTCTGCAGGCAGGGCACCGGCGG + Intergenic
937076384 2:119110287-119110309 CTCTGCCCTCAGGGAACTGATGG - Intergenic
937410414 2:121670051-121670073 CTCTGTCACCAGGGAAGTGGGGG - Intergenic
938178917 2:129162412-129162434 CTCTGCTTCCAGGGAACCCATGG - Intergenic
942305635 2:174604912-174604934 CACTGCAGCCAGGGAACCCAAGG - Intronic
945338297 2:208618527-208618549 CTCTGTCACCAGGGAACTGGGGG + Intronic
948729844 2:239955955-239955977 CTCTGCAGCCAGGGAGGCAGGGG + Intronic
948826483 2:240575628-240575650 CCCTGCAGCCAGGGAGCCGTGGG + Intronic
1168888359 20:1276097-1276119 CTCTGCAGTCAGGGAACAGGAGG - Intronic
1170865289 20:20150109-20150131 CTCTGTCACCAGGGAAGTGGGGG - Intronic
1174380597 20:50153311-50153333 CTCTGCAGCCAGGAAACCCCGGG + Intronic
1178710119 21:34909687-34909709 CTCTGTAGCCAGAGACCCGGGGG - Intronic
1179320310 21:40285260-40285282 CTCTTGCTCCAGGGAAACGGTGG - Intronic
1184381143 22:44145559-44145581 CTCTGCCCCCAGGAACCTGGAGG + Intronic
1184381358 22:44146877-44146899 CTCTGCCTCCAGGAACCTGGAGG + Intronic
1185395207 22:50583176-50583198 CTCTGCCCCGTGGGAGCCGGCGG + Intronic
950025274 3:9815887-9815909 CTCTTCCTCCAGGGCACAGGTGG - Intronic
952187566 3:30986713-30986735 CTCAGCGGCCAAGGAACAGGTGG + Intergenic
952866836 3:37860861-37860883 CTGTGCAGCAAGGGGACCGGGGG - Intergenic
953195804 3:40731960-40731982 CTCTGTCACCAGGGAAGTGGGGG + Intergenic
954213551 3:49111705-49111727 CCCAGCCTCCAGGGAACCTGTGG + Exonic
954834979 3:53458426-53458448 CTCTGCCACCAGGGAGCCTCTGG + Intergenic
958790423 3:98645083-98645105 CTCTGTCACCAGGGAAGTGGGGG + Intergenic
960998989 3:123359663-123359685 CTCTGCCCCCAGGGTCCCTGAGG - Intronic
961523981 3:127484871-127484893 CTCTGCCACCAGGGCTCAGGGGG - Intergenic
962191833 3:133319083-133319105 CTCTGTCACCAGGGAAGTGGGGG - Intronic
962793837 3:138834434-138834456 CTCTGCCGCCCAGGGGCCGGGGG + Intronic
964720608 3:159764727-159764749 CTCTCCGGCCCGGGAACCGGGGG + Exonic
967939974 3:194758109-194758131 CTCTGCCTTCAGAGAACCTGTGG + Intergenic
968955025 4:3713983-3714005 CTGTGCAGCCAGGGAAACTGAGG - Intergenic
969704257 4:8783512-8783534 CTCTGCAGCCCGGGAACTGGGGG - Intergenic
985932326 5:3068220-3068242 CTCTCCAGCCAGGGAACCATGGG - Intergenic
986682807 5:10249468-10249490 CTTTGCAGACAGGGAACCCGAGG + Intronic
995650408 5:114362360-114362382 CCCCGCCGCCGGGGCACCGGAGG - Exonic
999147705 5:149406874-149406896 CTCTGTGGCCAGGGAGCCGCAGG + Intergenic
999753485 5:154647404-154647426 CTCTGCCGCCGGGGATCCTGGGG - Intergenic
1002457043 5:179351175-179351197 CCCTGCAGCCAGGGACCCAGGGG + Intergenic
1003816984 6:9851965-9851987 CTCTGCTGCCAAGGAGCTGGAGG - Intronic
1007227263 6:40324016-40324038 CTCTGCCGCTAGGGAACTCAGGG - Intergenic
1007760434 6:44130137-44130159 CACTTCCACCAGGGAGCCGGAGG - Intronic
1008375530 6:50787063-50787085 CCCTGCATCCATGGAACCGGAGG + Intergenic
1016910238 6:149191815-149191837 CTCTGCCCCCAGGCAACCACTGG - Intergenic
1017296137 6:152796832-152796854 CTCTTCCCCCAGGGAGCAGGGGG - Intergenic
1019672029 7:2285514-2285536 CTCTGTGGCCAGGGAACAGCAGG + Intronic
1029403675 7:100360272-100360294 CTCTGCTCTCAGGGAACTGGGGG + Intronic
1031966910 7:128033051-128033073 CGCTGCCCCCAGAGAACTGGGGG + Intronic
1034450322 7:151133811-151133833 GACTGCCGCCAGGGAATTGGTGG + Intronic
1036789494 8:11708650-11708672 GGCGGCCGCCAGGGACCCGGTGG - Exonic
1037815804 8:22111170-22111192 CCCTGCCTCCAGGGAGCCTGTGG - Intergenic
1048023073 8:130558743-130558765 CTCTGCCTCTAGGAAACCAGAGG - Intergenic
1048444272 8:134481644-134481666 CTGTGCTGCCAGGGGACAGGAGG - Intronic
1049623220 8:143608398-143608420 CTCTGCCTCCAGGGAAGGGAAGG + Intronic
1049961367 9:741404-741426 CACTGCAACCAGGGAGCCGGGGG - Intronic
1051936391 9:22447288-22447310 CTCTCCAGCCCGGGAGCCGGCGG - Exonic
1054785081 9:69202730-69202752 CTCTGCCGCCTGGGCACAGCAGG - Intronic
1056488656 9:87084154-87084176 CTCAGCCGCCAGTCACCCGGGGG + Intergenic
1059430821 9:114249362-114249384 CTCTGAACCCAGGGAACCAGGGG + Intronic
1061484497 9:130913520-130913542 CTCTGACGTCAGGGAGCTGGAGG + Intronic
1061540849 9:131277309-131277331 CCCTGCGCCCAGGGAGCCGGAGG - Intergenic
1061629755 9:131864745-131864767 CTCTGCAGCCAGGCAAGCCGGGG + Intronic
1062105762 9:134753940-134753962 CGCTGCCGCCGGAGAACGGGAGG - Intronic
1187181533 X:16947213-16947235 GGCTGCCCCCAGGGACCCGGAGG + Intronic
1187438469 X:19294559-19294581 CTCCTCTGCCAGGGAACCAGAGG - Intergenic
1187921704 X:24209658-24209680 CTCTGCCCCCTGGGTACAGGTGG + Intronic
1191933860 X:66405028-66405050 CTGTGCCCCTAGGGAACCGAAGG + Intergenic
1192543877 X:71996884-71996906 CTCAGCCCTCAGGGAACCAGTGG - Intergenic
1193076721 X:77363217-77363239 CTCTGTCACCAGGGAAGTGGGGG + Intergenic
1196339745 X:114583157-114583179 CGCTGCCGCCAGGACACCGCAGG + Intergenic
1196654221 X:118200175-118200197 CTCTGCCGCAAGGGACCCACAGG + Intergenic