ID: 1168277978

View in Genome Browser
Species Human (GRCh38)
Location 19:55287518-55287540
Sequence CTGGGGACACGGTAGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 491
Summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 454}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168277978_1168277985 -2 Left 1168277978 19:55287518-55287540 CCATCCTCCTACCGTGTCCCCAG 0: 1
1: 0
2: 3
3: 33
4: 454
Right 1168277985 19:55287539-55287561 AGCTCCAGCTCCTCGCCCTGTGG 0: 1
1: 0
2: 5
3: 33
4: 320
1168277978_1168277988 8 Left 1168277978 19:55287518-55287540 CCATCCTCCTACCGTGTCCCCAG 0: 1
1: 0
2: 3
3: 33
4: 454
Right 1168277988 19:55287549-55287571 CCTCGCCCTGTGGCACTGCATGG 0: 1
1: 0
2: 1
3: 44
4: 382

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168277978 Original CRISPR CTGGGGACACGGTAGGAGGA TGG (reversed) Intronic
900638242 1:3676048-3676070 CTGGGGACAGGGGACAAGGAGGG + Intronic
900712406 1:4122660-4122682 CTGGGGAGGCGGGAGAAGGAGGG + Intergenic
900767773 1:4516784-4516806 CTGGGGACAAGGTGGGCAGAGGG + Intergenic
901855038 1:12039139-12039161 CTGAGGACAGGGAGGGAGGAGGG + Intergenic
902678209 1:18023755-18023777 TTGGGGAAAAGGTGGGAGGAAGG + Intergenic
903235301 1:21946530-21946552 TTGGGGACTTGGTAGGGGGAAGG + Intergenic
904011091 1:27391159-27391181 CAGGGAACATGGGAGGAGGAGGG - Intergenic
904236975 1:29122595-29122617 CTGGGGCCACGGCAGCAGGCGGG + Intronic
904340396 1:29830409-29830431 CTGGGGACATGGGGGCAGGATGG - Intergenic
904696421 1:32334310-32334332 GTGGGGACAGGGAAGGAGGTAGG + Exonic
904945961 1:34198914-34198936 CTGGAGAAGAGGTAGGAGGAAGG - Intronic
905456369 1:38090917-38090939 CTGGGACCACTGTAGGAGAAGGG + Intergenic
905780041 1:40700888-40700910 AAGGGGACACAGTGGGAGGATGG - Intronic
906112657 1:43334699-43334721 GTGGGGACATGATAGGAGGTAGG + Intergenic
906418650 1:45643635-45643657 CTGGTAACAGGGTAGGAGAATGG + Intronic
906484209 1:46221976-46221998 CTGGGGACAGGGTGGGGGAAGGG - Intergenic
906879752 1:49577110-49577132 TTGGGGACAAGGTATGTGGATGG + Intronic
907213415 1:52842603-52842625 CTGGGGAGGCGGGAGGAGAACGG + Intronic
909668870 1:78165852-78165874 CAGGGGTCACGGTAGGAGCATGG - Intergenic
910487997 1:87737172-87737194 ATGGGGACAGGGTTGGAGAAGGG + Intergenic
911666062 1:100554016-100554038 CTGGGGAAAGGGTGGGAGGGGGG - Intergenic
912048757 1:105495443-105495465 CTGGGGACACTGAAGAAGCAAGG - Intergenic
912084867 1:105987022-105987044 GAGGGTACACGGTGGGAGGAGGG - Intergenic
912446055 1:109737644-109737666 CCGGGGAAAAGGTAGGAAGAAGG - Exonic
912956518 1:114157432-114157454 CTGGGGACTTGGAGGGAGGAGGG - Intergenic
913260466 1:116993063-116993085 CTGGGGAAAGGGTAGGAGTGGGG + Intergenic
913533196 1:119747720-119747742 GTGGGGGCAGGGGAGGAGGAGGG - Intergenic
914089699 1:144485348-144485370 CTGGGCACACGAAAGAAGGAGGG + Intergenic
914308913 1:146448868-146448890 CTGGGCACACGAAAGAAGGAGGG - Intergenic
914593198 1:149124263-149124285 CTGGGCACACGAAAGAAGGAGGG + Intergenic
915098202 1:153478987-153479009 CTGGAGACTAGGGAGGAGGAAGG - Intergenic
915583492 1:156830433-156830455 CTGGGCACAAGGGTGGAGGAGGG - Intronic
916339976 1:163722381-163722403 CTTGAGACACTGTAAGAGGAAGG + Intergenic
917478318 1:175387750-175387772 CTGGAGACAGAGTAGGAGGTGGG - Intronic
917595985 1:176529532-176529554 CTGGGGCAAGGGGAGGAGGAGGG + Intronic
918125612 1:181580790-181580812 GTGGGGACCTGGAAGGAGGAGGG + Intronic
918158857 1:181878275-181878297 TGGGGGAAATGGTAGGAGGAGGG + Intergenic
918407191 1:184222919-184222941 CTGGGGACATGGAAAGAGAAAGG - Intergenic
918454123 1:184689440-184689462 CTGGGGACAGCAGAGGAGGAAGG - Intergenic
919592635 1:199523605-199523627 CAGGGGAAAGGGTAGGAGGGAGG - Intergenic
919854734 1:201697443-201697465 CTGGGGGCAAGGTATGAGCAAGG - Intronic
919920056 1:202162133-202162155 CTGGGGACACAGGAGGGGGCAGG + Intergenic
920290954 1:204922945-204922967 ATGGGGCCACTGTGGGAGGATGG - Intronic
920646703 1:207809065-207809087 CTGGGAAGAAGGTAGGAGGTGGG - Intergenic
920739813 1:208569867-208569889 CGGGGGAAAAGGTAGGAAGAGGG - Intergenic
920913329 1:210237395-210237417 CTGCGGAAACGAGAGGAGGAGGG + Intronic
921935101 1:220788390-220788412 CTGGGGAGCTGGTAGGAGAAAGG - Intronic
922367271 1:224877801-224877823 CTGGGGGAAAGGTAGGAGGGGGG + Intergenic
923035049 1:230279809-230279831 CTGAGGACAGGGCGGGAGGAGGG + Exonic
924119249 1:240779506-240779528 GTGAGGACACAGTAGGAAGATGG + Intronic
924142288 1:241037952-241037974 TTGGGGACATGGGAGGAGGTGGG + Intronic
1063716597 10:8533531-8533553 CTGAGGCCACAGTACGAGGAGGG + Intergenic
1063973108 10:11395336-11395358 ATGGGGACACGGTGCTAGGAGGG - Intergenic
1064408035 10:15081814-15081836 GTGGGAACTGGGTAGGAGGATGG - Intronic
1064463270 10:15555465-15555487 CTGCGGACAGGGAAGGAGGGAGG + Intronic
1065879190 10:30025124-30025146 CTGGAGACTGGGTAGGAAGAGGG + Intronic
1066340371 10:34526696-34526718 CTGGTGGCACAGCAGGAGGAGGG - Intronic
1067327205 10:45280975-45280997 CTGGGGGCAGGGTCGGAGGGGGG - Intergenic
1067437280 10:46287129-46287151 CTGGTGAAAGGGCAGGAGGAGGG + Exonic
1067828689 10:49597624-49597646 CTGAGGACCCTGCAGGAGGATGG - Intergenic
1068208839 10:53893790-53893812 CGGGGGACAGAGTGGGAGGAAGG + Intronic
1068891285 10:62150739-62150761 GAAGGGACAGGGTAGGAGGAGGG - Intergenic
1070505844 10:77112010-77112032 CTGGGGACAAGGTTGGAAGTTGG - Intronic
1070541533 10:77418714-77418736 GAGGGGACATGGTAGGAGGGAGG - Intronic
1071038763 10:81280949-81280971 CAGGGGAGACAGTAGGGGGATGG + Intergenic
1071527047 10:86365066-86365088 CTGGGGGCTGGGTAGGAGGAGGG + Intronic
1071895045 10:90057109-90057131 CAGGGGAAAAGGTGGGAGGAAGG + Intergenic
1072868350 10:99088355-99088377 CAGGGGAAAGGGTAGGAGGTAGG - Intronic
1073137301 10:101227145-101227167 CCGGGGACAGGGGAGGAGGCGGG + Exonic
1073318152 10:102597323-102597345 CTGGGGAAAAGGAAGGAGGAAGG - Intronic
1073398865 10:103240753-103240775 CGGGGCACATGGCAGGAGGAAGG + Intergenic
1075093709 10:119457608-119457630 CTGGGGACTCAGTAGGGAGAAGG - Intronic
1075177733 10:120181541-120181563 CTGGGGACATGGGAGAGGGAAGG - Intergenic
1075274607 10:121081859-121081881 CTGGGGACACTGGAGGAGAGAGG + Intergenic
1075660967 10:124195989-124196011 TTGGGGAAAGGGTAGGAGGTGGG + Intergenic
1075688595 10:124380375-124380397 CTGGGGAGTCGGGAGGAGCACGG - Intergenic
1075926951 10:126258953-126258975 CTGGGGACACGGTAGGGAACAGG - Intronic
1076859414 10:133133568-133133590 CAGGGGACGGGGTAGGGGGAGGG + Intergenic
1077544958 11:3165211-3165233 CTCGCGGCACGGTAGGAGGTAGG - Exonic
1078043715 11:7893574-7893596 GTGGGGAGAGGGTAGGAGAAAGG - Intergenic
1078574336 11:12485791-12485813 GTGGGGACAGGGTAGGGGGAGGG + Intronic
1079116600 11:17644063-17644085 CTGGGGGCAAGGGAGGGGGAGGG + Intronic
1079977511 11:27110234-27110256 CTGGGAAAAAGGTAGGAGGAGGG - Intronic
1080506823 11:32923268-32923290 CTGGGGACTTGGTGGTAGGATGG + Intronic
1081777465 11:45685334-45685356 CTGGAGACAGGGTGGGAGCAAGG - Intergenic
1081874194 11:46397580-46397602 ATGGGGACAGGGGAGGAAGAGGG + Exonic
1081983996 11:47288574-47288596 GTGGGGTCAGGGTATGAGGATGG - Intronic
1082849538 11:57753161-57753183 CCGAGGACTCGGGAGGAGGAGGG - Intronic
1082891040 11:58139043-58139065 CTGGGAAGATGGGAGGAGGAAGG + Intronic
1083470610 11:62881503-62881525 CTGGGGACAGGGGAGGGGGTCGG - Intronic
1083640296 11:64141769-64141791 CTGGGCACAGGGTAGGAGGCAGG + Intronic
1083869352 11:65477456-65477478 CTGGGGACACGGCAGGAAGAAGG + Intergenic
1084117570 11:67050902-67050924 CTGGGCACTCTGTAGCAGGAAGG - Intergenic
1085254502 11:75164770-75164792 CTGGGGACACTGCAGCTGGACGG - Intronic
1085311292 11:75518392-75518414 CTTGGGACACTGTGGGAGGTAGG + Intronic
1085328538 11:75627497-75627519 CTGGCCAAACAGTAGGAGGAGGG + Intronic
1085986061 11:81789932-81789954 CGGGGGAAAGGGTGGGAGGAGGG + Intergenic
1086399809 11:86451279-86451301 CTGGGGAAAAGGTAGGTGGATGG + Intronic
1087692585 11:101338796-101338818 ATGGGTTCAGGGTAGGAGGAAGG + Intergenic
1088573945 11:111251631-111251653 ATGTGGACAGGTTAGGAGGAAGG - Intergenic
1088691564 11:112333007-112333029 CTGGGGGAGCAGTAGGAGGAAGG - Intergenic
1089220828 11:116870058-116870080 CAGGGGACAAGGAAGAAGGAGGG + Intronic
1089677496 11:120099566-120099588 GTGGGCACACGGTTGGAGCAGGG + Intergenic
1090062362 11:123475162-123475184 CTGGGTACAGGGAGGGAGGAAGG + Intergenic
1091208369 11:133835841-133835863 CTGGGGGCACAGTTGGGGGATGG - Intergenic
1092117381 12:6019004-6019026 CGGGGGGCAGAGTAGGAGGAGGG + Exonic
1092232370 12:6783268-6783290 CTGGGGGCAGGGTTTGAGGATGG - Intergenic
1093672140 12:21889882-21889904 CTGGGGACATGGGAGGGGAAGGG - Intronic
1093838035 12:23860145-23860167 GGGGGGAAACGGTGGGAGGAGGG + Intronic
1094441924 12:30487064-30487086 CTGGGGATAAGGGAGGAGCAGGG + Intergenic
1096718685 12:53505781-53505803 CTGAGGACACGGCAGCAGGCAGG - Exonic
1096846065 12:54407792-54407814 CTGGGGCCAAGGGAGGGGGATGG - Intronic
1097065045 12:56314992-56315014 CAGGGGACAGGGTAGGGGGTAGG + Intronic
1097269597 12:57765908-57765930 CTGGGGGCATGGTGGGAGGTCGG - Intronic
1097680561 12:62645269-62645291 CTGAGAACACAGTAAGAGGAGGG + Exonic
1098478202 12:70930202-70930224 ATGGGGAAACGGTAGGAAGGAGG - Intergenic
1100263454 12:92954088-92954110 GAGGGGACACGGCAGGAGGTGGG + Intergenic
1100448966 12:94687093-94687115 CTGGGGATAAGGAAGGATGATGG + Intergenic
1100611018 12:96192721-96192743 GTGGGGGCACGGTAGGAGAGTGG - Intergenic
1101075899 12:101129598-101129620 CAGGGGAAACGGTGGAAGGAGGG + Intergenic
1101658989 12:106749344-106749366 TGGGGGACATGGGAGGAGGAGGG + Intronic
1101843972 12:108346825-108346847 CTGGGCACATGGTAGCAAGAGGG - Intergenic
1102167835 12:110820676-110820698 CTGGGGAGAGGGGAGGAGGAGGG - Intergenic
1102259583 12:111436042-111436064 CTGGGGACAGGGCAGGTGGATGG + Intronic
1102474084 12:113177380-113177402 CTGGGGGCACTGTGGGTGGAAGG - Intronic
1102839530 12:116103355-116103377 GTGGGGCCAAGGCAGGAGGATGG - Intronic
1103247877 12:119473600-119473622 CTGGGGGAAGGGTGGGAGGAGGG - Intronic
1104667198 12:130656059-130656081 CTGGGGACACGGTGGAGGGTGGG + Intronic
1105264960 13:18807880-18807902 CTGGAGACAGGGCAAGAGGAAGG - Intergenic
1106097329 13:26659645-26659667 CTTGGGACAGGGTAGGATCAGGG + Intronic
1106570663 13:30924493-30924515 CTGGGGGGAGGGTAGGAGGTGGG + Exonic
1107555437 13:41513480-41513502 CTGAGGACACAGCATGAGGACGG + Intergenic
1110418828 13:75281434-75281456 CTTGGGAAAGGGTAGGAGGAGGG - Intergenic
1111908942 13:94288417-94288439 CTGGGGACATGGAGGGAGGTGGG - Intronic
1112509531 13:99997497-99997519 CTGCGGACCCGGTGGGAGGAAGG - Intergenic
1112563003 13:100530120-100530142 CTGGAGACACAGTTGGAGAAGGG + Exonic
1112655638 13:101449951-101449973 CTGGGGACACAGCAGTAGGTTGG - Intergenic
1113390267 13:109889776-109889798 CAGGGTAGAGGGTAGGAGGAGGG + Intergenic
1113536886 13:111075206-111075228 GTGAGGACAAGGCAGGAGGATGG - Intergenic
1113767936 13:112892672-112892694 CTGGGCTCAGGGAAGGAGGAGGG - Intergenic
1113972450 13:114200302-114200324 CTGGGGACAGAGAAGGAGGCTGG - Intergenic
1114416920 14:22551109-22551131 CTGGGGACCCTGGGGGAGGAGGG - Intergenic
1114482268 14:23043160-23043182 CTGGGGAGTGGGTGGGAGGATGG + Exonic
1116995159 14:51315811-51315833 CAGAGGACAAGGTTGGAGGAAGG - Intergenic
1117944792 14:61007388-61007410 GTGAGGCCAAGGTAGGAGGATGG + Intronic
1120736614 14:88060160-88060182 ATGGAGACAGAGTAGGAGGATGG + Intergenic
1120994393 14:90405645-90405667 ATGGGGACAAGGCAGGTGGAGGG + Exonic
1122599585 14:102914654-102914676 CTGGGCACAGGGCAGGAAGAGGG + Intergenic
1122968057 14:105140687-105140709 TTGGGGCCACGGCAGGAGGTGGG + Intergenic
1202833504 14_GL000009v2_random:60234-60256 CTGGAGACAGGGCAAGAGGAAGG + Intergenic
1123952388 15:25293307-25293329 GTGGGGTCAGGGTAGGGGGAGGG + Intergenic
1125535814 15:40440904-40440926 CTGGGGACGAGGAAGCAGGAAGG + Intronic
1125612333 15:40980014-40980036 CTGGGGTGCCTGTAGGAGGAAGG - Exonic
1125768117 15:42148517-42148539 CTGGGGAAAGGGGAGGTGGAGGG - Intronic
1126165359 15:45650242-45650264 TTCCGGACACAGTAGGAGGACGG - Intronic
1128320604 15:66691259-66691281 GTGGGGTCAGGGGAGGAGGAGGG + Intergenic
1128396198 15:67228979-67229001 GAGGGGAGACAGTAGGAGGAGGG + Intronic
1130107802 15:80942178-80942200 CTGGGGATACGGGAAGAGGAGGG + Intronic
1130407739 15:83617318-83617340 CTGGGGAGAGGGTAGTAGGGAGG - Intronic
1130959923 15:88652611-88652633 GAGGGGACAGGGGAGGAGGAAGG - Intronic
1131175890 15:90209630-90209652 CTGGTGACACTGTCGGATGATGG - Intronic
1132322237 15:100934427-100934449 CTGGGGACACAGCAGGAGTGTGG + Intronic
1132672121 16:1106295-1106317 GCTGGGACACGGAAGGAGGAGGG - Intergenic
1132804155 16:1768046-1768068 CTGGGGACATGGGAGGAGCATGG - Intronic
1132942798 16:2516530-2516552 CTGGGGACACAGCTGGAGGTTGG - Intronic
1133772574 16:8875899-8875921 CTGGGGACAGGTGAGGAGGTGGG + Intergenic
1134244900 16:12532748-12532770 CTGGGGACAGGGCAGGAGCCTGG + Intronic
1134247634 16:12551841-12551863 CTGGGGACACAGGAGCAGGCAGG + Intronic
1134353422 16:13459323-13459345 CTGGTGACATGGGGGGAGGAGGG + Intergenic
1134659412 16:15972514-15972536 CTGGGTTCAAGGTAGGAAGAGGG + Intronic
1134829980 16:17315096-17315118 CTGGGGAAAAGGCAGAAGGAGGG + Intronic
1135238586 16:20782390-20782412 CTGGGGAAAGGGTGGGAGGTGGG - Intronic
1136062819 16:27738261-27738283 CTGGAGCCAGGGAAGGAGGAAGG + Intronic
1136869910 16:33797351-33797373 CTGGGGAAATGGTAGAAGAAGGG + Intergenic
1137836446 16:51597028-51597050 CTGGGGACAATGTTGGAGGTGGG + Intergenic
1138345929 16:56320211-56320233 TTGGGCACACGGGAGGAGGATGG - Intronic
1138462001 16:57154663-57154685 ATGGGGAAACTGAAGGAGGAAGG + Intronic
1139236314 16:65343300-65343322 CTGGGGACAGGGGAACAGGATGG + Intergenic
1140780855 16:78295066-78295088 GTGGGGCCGCTGTAGGAGGATGG + Intronic
1141780679 16:86158439-86158461 CTGGGGACACAGCATGAGGATGG + Intergenic
1142171338 16:88624294-88624316 CTGGGGACACGGCAGCAGCCGGG + Intronic
1142434225 16:90046945-90046967 CTGAGGACAAGGTAGGAGAGAGG - Intergenic
1203102262 16_KI270728v1_random:1318704-1318726 CTGGGGAAATGGTAGAAGAAGGG - Intergenic
1142471896 17:169341-169363 CAGGGGCCAGGGGAGGAGGAAGG + Intronic
1143155336 17:4833032-4833054 CTGGGCACACGAAAGAAGGAGGG + Intergenic
1143211399 17:5190892-5190914 CTGGGGACGCGCTCGGTGGATGG + Intronic
1144079829 17:11753956-11753978 GAGGGTACAAGGTAGGAGGAGGG - Intronic
1144125050 17:12195711-12195733 CTGGTGGCAGGGCAGGAGGAAGG - Intergenic
1144196951 17:12903743-12903765 CAGGGGAAAGGGTGGGAGGAGGG - Intronic
1144575974 17:16429727-16429749 CTGGGGAGATGGCAGGAGGGTGG + Intronic
1144579236 17:16448764-16448786 TTGAGGACACAGGAGGAGGAGGG + Intronic
1145031380 17:19507571-19507593 GTGGGGACGCGGGTGGAGGAGGG - Intronic
1146551150 17:33781419-33781441 CTGGGGACAGCGCAGGATGATGG + Intronic
1146916222 17:36680082-36680104 CTGGGGACCCGGCAGCAGAAAGG + Intergenic
1147924584 17:43938688-43938710 CTGGGGCCCCGGGAGGAGGTCGG - Exonic
1149558303 17:57589897-57589919 TTGGGGACCAGGTAGGACGATGG + Intronic
1150381877 17:64727265-64727287 CAGGGGTTATGGTAGGAGGAAGG + Intergenic
1150632682 17:66891009-66891031 GTGGGGAGACAGTTGGAGGAAGG + Intergenic
1150893287 17:69179588-69179610 CTGGGGAAAAGAAAGGAGGAAGG + Intronic
1151502361 17:74499244-74499266 CTAGGGGTAGGGTAGGAGGAAGG - Intergenic
1151663389 17:75531639-75531661 CTGGGGACAGGGCAGGAGACGGG + Intronic
1151720827 17:75855086-75855108 CTGGGGGCGGGGTTGGAGGAAGG - Intronic
1152073152 17:78143985-78144007 CTGGGGACACAGTATGGGGGAGG + Intergenic
1152257989 17:79251491-79251513 CTGGAGACAAGGGAGGGGGAAGG - Intronic
1152348945 17:79772501-79772523 CTGGGGACAGGGAAGGAGGAAGG + Intergenic
1152583720 17:81180093-81180115 CTGGAGACAGGGTGGGAGGCAGG - Intergenic
1154423433 18:14253663-14253685 CTGGAGACAGGGCAAGAGGAAGG + Intergenic
1155492255 18:26410671-26410693 CTGGGGAGGTGGTAGGGGGAGGG + Intergenic
1157076410 18:44472409-44472431 CTTGGGACACCTTTGGAGGAAGG - Intergenic
1157112347 18:44833015-44833037 CTGGGGACAGTGGAGGTGGATGG + Intronic
1157158118 18:45287502-45287524 ATGGGGACAGGGTAGGAGTGGGG + Intronic
1157495188 18:48151990-48152012 GGGAGGACACTGTAGGAGGATGG + Intronic
1157702387 18:49770395-49770417 CTGGGGAAAAGGTGGGAGGGGGG - Intergenic
1157779752 18:50427768-50427790 CTGGGGACATAGTGGGAGGCAGG + Intergenic
1157810083 18:50688731-50688753 CTGGGGAAAGGGTGGGAGGGGGG + Intronic
1157934198 18:51855823-51855845 CTTGGGTCAAGGTAGGATGAGGG - Intergenic
1158015689 18:52780763-52780785 CAGGGGAGAAGGGAGGAGGAAGG + Intronic
1159453564 18:68633036-68633058 CAGGGGAAAGGGTGGGAGGAGGG - Intergenic
1160007357 18:75077052-75077074 CTGGGGACACGGCAGAGTGAAGG + Intergenic
1160534684 18:79585718-79585740 GTGGGGACACAGTGGGAGCATGG - Intergenic
1160563889 18:79775052-79775074 CTGGGGAGAGGGTTGGTGGAAGG + Intergenic
1160583014 18:79898428-79898450 GTGGGGACTGGGCAGGAGGAGGG + Intronic
1160743566 19:699292-699314 ATGGGGACACAGTAGGGAGAGGG + Intergenic
1160767888 19:816517-816539 CTGGGGGCATGGGTGGAGGATGG - Intronic
1160955898 19:1691610-1691632 CAGAGGACACGGCAGGTGGACGG - Intergenic
1161012613 19:1967850-1967872 CTGGGGAGAAGGGAGGAGGGAGG - Intronic
1161012634 19:1967911-1967933 CTGGGGAGAAGGGAGGAGGGAGG - Intronic
1161153977 19:2722832-2722854 CTGGGGTCAGGGTGGGAGGGAGG - Intronic
1161258362 19:3322108-3322130 ATGGGGACATGGAAGGAGGAGGG + Intergenic
1163159462 19:15456307-15456329 CTGAAGACAAGGTTGGAGGATGG - Intronic
1163672039 19:18635384-18635406 CTGGAGACCCCATAGGAGGAAGG - Intergenic
1164554708 19:29242713-29242735 CTGGGGACACTGTAGCAGTCAGG - Intergenic
1164659487 19:29949922-29949944 GTGGGGAGACGGGAGGGGGAGGG + Intronic
1164823478 19:31267468-31267490 CTGGGGACACGGGTAGGGGAAGG - Intergenic
1165412877 19:35673209-35673231 CTGGGGAGACAGAGGGAGGACGG - Intronic
1165705768 19:37975275-37975297 CCGGGGACCAGGAAGGAGGATGG + Intronic
1165723395 19:38095634-38095656 CTGGGGACAGGGCAGGGGCAGGG + Intronic
1165776922 19:38410089-38410111 CAGGGGACCTGGAAGGAGGAAGG + Exonic
1165930745 19:39356861-39356883 CTGGGGCCAGGGTCGGGGGACGG - Exonic
1166541831 19:43610843-43610865 CTGGGGACCCAGCAGGAGGGTGG - Intronic
1166851581 19:45763948-45763970 CTGGGGAGACGGTGGCAGGATGG - Intronic
1166853387 19:45770860-45770882 CTGGGCCCACGGCAGGAGGGCGG - Intronic
1167209318 19:48123103-48123125 CTGGGGACAGGCTGGGAGGCCGG + Intronic
1167611208 19:50508496-50508518 CTGGGGACAGGGGACCAGGAAGG - Intronic
1167901025 19:52622388-52622410 CTGGGGAAAGGGTAGAAGGTAGG - Intronic
1168072002 19:53958581-53958603 CTGGGGACGCGGGAGGGGGCGGG + Intergenic
1168277978 19:55287518-55287540 CTGGGGACACGGTAGGAGGATGG - Intronic
1168293486 19:55368441-55368463 CTGGGGACAAGGTGGGAGGCAGG - Intronic
1202639166 1_KI270706v1_random:67461-67483 CTGGAGACAGGGCAAGAGGAAGG - Intergenic
925637112 2:5951165-5951187 CTGGGGAGAGAGAAGGAGGAAGG - Intergenic
925691123 2:6524544-6524566 CTGGGGACCAGGTTGGAGGCTGG + Intergenic
927688612 2:25191189-25191211 CTGAGGACAAGGTCGGAGGTTGG + Intergenic
927917188 2:26944834-26944856 AGGGGGCCACGGGAGGAGGATGG + Intronic
928242728 2:29600752-29600774 CTGGGGACACGTTAAGAGTTGGG + Intronic
928285578 2:29987406-29987428 CTGGGGAGAGGAGAGGAGGAAGG - Intergenic
929561154 2:42957500-42957522 CAGGGGCCAAGGTAGGAGAAGGG - Intergenic
932361810 2:71115149-71115171 GTGGGGCCAAGGTGGGAGGATGG + Intronic
932654866 2:73601658-73601680 CTGGGGACAAGGCCGCAGGAGGG + Intronic
933109002 2:78373397-78373419 GGGGGGACAAGGTAGGCGGAAGG + Intergenic
933789647 2:85873463-85873485 GTGGGGACAAGGGAGGAGGGAGG + Intronic
934578985 2:95423221-95423243 CGGGGGAAAGGGTGGGAGGAGGG + Intergenic
934600462 2:95653482-95653504 CGGGGGAAAGGGTGGGAGGAGGG - Intergenic
934762801 2:96865633-96865655 CTGGGGACACCGAGGTAGGAGGG + Intronic
936020050 2:108988041-108988063 CTGGGGACTGGGGAAGAGGACGG + Intronic
936480341 2:112879789-112879811 CTGGGGACAGGGTCACAGGATGG - Intergenic
936533820 2:113295543-113295565 CGGGGGAAAGGGTGGGAGGAGGG - Intergenic
937093847 2:119223614-119223636 CTGGGGCCAGGGGAGGAGGGTGG + Intergenic
937100940 2:119267859-119267881 CTGAGAACAGGGGAGGAGGAAGG + Intergenic
937384333 2:121413863-121413885 CTGGGGACAGAGTGGCAGGAAGG + Intronic
937983112 2:127626446-127626468 GTGGGGACCCTTTAGGAGGAGGG - Intronic
937984964 2:127634306-127634328 CTGGGCAGACGGTGGGCGGACGG + Intronic
938015856 2:127866680-127866702 CTGGGGGCACAGTTGGAGCAGGG - Intronic
938240910 2:129741733-129741755 CTGGGGAACAGGCAGGAGGAAGG - Intergenic
938692865 2:133808271-133808293 CTGGGGACAAGGGACCAGGAAGG + Intergenic
938945192 2:136206049-136206071 CTGGGGAAAGGGTAGAAGAATGG - Intergenic
939044980 2:137239424-137239446 TTGGGGACAGGGAAGGAGGACGG - Intronic
940453721 2:153871830-153871852 CTGGGGCTACGAGAGGAGGAGGG + Intergenic
940830154 2:158457330-158457352 CTGGGGACGCGGCAGCGGGAGGG - Intronic
941670105 2:168283961-168283983 CTGGAGGGACGGAAGGAGGAGGG + Intergenic
942871222 2:180736795-180736817 GTAGGGACACTGAAGGAGGAAGG + Intergenic
944148982 2:196537298-196537320 ATGGGGACAGGGTGGGAGGTGGG + Intronic
948768129 2:240233743-240233765 CTGTGGGCAGGGTCGGAGGAGGG - Intergenic
1169975218 20:11317994-11318016 TTGGGGAAAGGGTGGGAGGAGGG - Intergenic
1170488985 20:16851917-16851939 CTGGGGACTCGGGGGAAGGATGG - Intergenic
1170828098 20:19814369-19814391 CTGGGGAGGGGGTGGGAGGAGGG - Intergenic
1171036986 20:21721956-21721978 CTGAGGTCAAGGTGGGAGGATGG - Intergenic
1171392218 20:24808959-24808981 CTGGGGACAGGGTGGGGTGAGGG + Intergenic
1171885758 20:30651576-30651598 CTGGAGACAGGGCAAGAGGAAGG - Intergenic
1172523163 20:35582318-35582340 CTGGGCACACGTTGGGTGGAAGG + Intergenic
1172588301 20:36100328-36100350 CTGGGGACAAGGTGGGGAGAGGG - Intronic
1172664063 20:36587055-36587077 TTGGGGAGATGGTAGGAAGAAGG - Intronic
1172779073 20:37425087-37425109 CTGGGTAAAGGGGAGGAGGAGGG - Intergenic
1174503002 20:50999379-50999401 CTGGGGACATGGTGGGAGTGTGG + Intergenic
1175834473 20:61984858-61984880 ACGGGGACAGGGCAGGAGGAGGG + Intronic
1176000328 20:62828741-62828763 CTGGGGACAAGGGATGAGTAAGG - Intronic
1176164970 20:63668049-63668071 CTGGGCACACACTGGGAGGAGGG - Intronic
1176203690 20:63876753-63876775 CTGGTGTCACGGTGGGAGGCTGG + Intronic
1176647489 21:9365070-9365092 CTGGAGACAGGGCAAGAGGAAGG - Intergenic
1176850036 21:13906346-13906368 CTGGAGACAGGGCAAGAGGAAGG - Intergenic
1179905412 21:44420249-44420271 ATGGGGACAGGGTGGGTGGAGGG - Intronic
1180044029 21:45294563-45294585 CTGGGGCCGCTGTCGGAGGAAGG + Intergenic
1180177549 21:46097988-46098010 CCGGGGGCACGGGAGGGGGATGG - Intergenic
1180362784 22:11914403-11914425 CTGGAGACAGGGCAAGAGGAAGG + Intergenic
1180749130 22:18111957-18111979 CTGGGAGCCCGCTAGGAGGAGGG - Intronic
1182082450 22:27538899-27538921 ATGTGGACAGGGAAGGAGGAAGG - Intergenic
1182373462 22:29828736-29828758 ATGGGGAAAGGGTGGGAGGAAGG + Intronic
1182630058 22:31678199-31678221 CTGTGGATAAGGAAGGAGGAGGG + Intronic
1183034860 22:35133921-35133943 ATGGAGACAAGGGAGGAGGAAGG + Intergenic
1183041046 22:35178270-35178292 CTGGGGACACGGCAGTAGAGGGG - Intergenic
1183406001 22:37630993-37631015 CTGGGGACACGGTGTGGAGAAGG - Exonic
1183411985 22:37660264-37660286 GTGGGGACACAGGAGGTGGAGGG - Intronic
1183516385 22:38269198-38269220 CTAGGAGCACGGGAGGAGGAGGG - Intronic
1183951285 22:41354481-41354503 CTGGGGACACGGTGGGGAGTAGG + Intronic
1185176905 22:49333025-49333047 CTGGGGGCAAGGGAGGAGGCAGG + Intergenic
950625735 3:14245345-14245367 CTGGGGACGGGGGTGGAGGAGGG - Intergenic
950791196 3:15473820-15473842 CTGGGGAGAGGGTGGCAGGATGG - Intronic
953383672 3:42492708-42492730 CTGGGGACCCAGGAGGAGAAGGG + Intronic
953545542 3:43861520-43861542 CTGGGAACACAGTAAGAGGAAGG + Intergenic
953664731 3:44917681-44917703 CTGGGGACATCAGAGGAGGATGG - Intronic
953839404 3:46377033-46377055 CTGGGGTTAGGGTAGAAGGAAGG + Intergenic
953879370 3:46683722-46683744 CAGAGGACAGGGTAGGAAGAGGG - Intronic
954479277 3:50782793-50782815 TTGGGGACTCGGTGGGGGGAAGG - Intronic
954618944 3:51984977-51984999 CTGGACACAGGGTTGGAGGAAGG - Intronic
954710260 3:52501946-52501968 CTGGGGTCAGGGTAAGCGGAGGG + Intronic
954795170 3:53157703-53157725 CTGGGGACAGTGTAGTAGGAAGG - Intronic
955003543 3:54949065-54949087 CTGGGGGCACTGGATGAGGAAGG - Intronic
955103986 3:55878396-55878418 ATGGGGAGATGGTGGGAGGAAGG - Intronic
955947057 3:64205493-64205515 CTGGGGACAGGGTTGGTGGCAGG + Intronic
956985376 3:74693218-74693240 CTAGGGAGAAGGTAGGTGGAAGG + Intergenic
959667395 3:108937046-108937068 CTGGGTACACTGTAGGCTGAGGG - Intronic
961014072 3:123454036-123454058 CTGGGGGCAGAGGAGGAGGAGGG - Intergenic
961333989 3:126159277-126159299 CTGGTGACGGGGCAGGAGGAGGG - Intronic
961346041 3:126263974-126263996 CTGGGGAAGCGGTAGGATGTTGG + Intergenic
962047732 3:131778290-131778312 AAGGGTACACGATAGGAGGAGGG - Intronic
962588201 3:136862752-136862774 GTAGGGACGTGGTAGGAGGAAGG + Intronic
962925804 3:139992384-139992406 CCTGAGACATGGTAGGAGGAGGG + Intronic
964178932 3:153859949-153859971 CTGGGGAGACTGAAGCAGGAGGG - Intergenic
964342162 3:155719162-155719184 CAGGGGAAAGGGTAGAAGGAGGG - Intronic
966008459 3:175047012-175047034 CTGAGGACACAGTAAGAAGATGG - Intronic
967102603 3:186228665-186228687 CCGGGGAAATGCTAGGAGGAGGG - Intronic
967833676 3:193943253-193943275 CTGAAAACAGGGTAGGAGGAGGG - Intergenic
1202739390 3_GL000221v1_random:39917-39939 CTGGAGACAGGGCAAGAGGAAGG + Intergenic
968502137 4:955732-955754 CTGGGGACACGCCAGGAGGGTGG - Intronic
968582233 4:1400484-1400506 CTGGGGACCCAGTAGGAGTGTGG + Intergenic
968646536 4:1743962-1743984 CTGGGGGCACTGCAGGAAGAAGG + Intronic
969150817 4:5167180-5167202 TTGGGGGCAAGGTGGGAGGATGG - Intronic
969511369 4:7619929-7619951 CTGGGGACAGGGCAGGGGCAGGG - Intronic
969599892 4:8170104-8170126 CTGGGTTCAGGGTAGGAGGGTGG + Intergenic
970815377 4:20150094-20150116 GTGGGGACACAAAAGGAGGAAGG - Intergenic
971393714 4:26209662-26209684 AGGGGGAGACGGAAGGAGGAAGG - Intronic
972166182 4:36287124-36287146 CTGGGGAAAGGGTGGGAGGGAGG - Intronic
972703310 4:41515281-41515303 CTGGGGACGCGGAGGAAGGAAGG - Intronic
973369403 4:49233821-49233843 CTGGAGACAGGGCAAGAGGAAGG - Intergenic
973563781 4:52163126-52163148 GTGGGTACAGGGTAGGAGGAAGG + Intergenic
974382180 4:61155139-61155161 CTGGGGGCAGGAGAGGAGGAGGG - Intergenic
977082040 4:92542616-92542638 CTGGGGACTCGGTGGGAGGGTGG + Intronic
978310141 4:107378655-107378677 ATGGGGAGACAGTAGGGGGATGG + Intergenic
978655557 4:111061676-111061698 CTGGGGACAAAGAATGAGGATGG + Intergenic
980670415 4:135997216-135997238 GAGGGGAGAGGGTAGGAGGAGGG + Intergenic
981718442 4:147775272-147775294 CTGGGGACTGGCCAGGAGGAGGG - Intronic
984137220 4:175955841-175955863 CTGGGGACATGGTAGTATGCTGG + Intronic
984769605 4:183425945-183425967 CTGAGGACACAGGAGGGGGAGGG - Intergenic
984866482 4:184284458-184284480 CTGCGGCCTAGGTAGGAGGATGG + Intergenic
985280570 4:188282653-188282675 CCGGGGATAGGGAAGGAGGAAGG - Intergenic
1202766516 4_GL000008v2_random:153331-153353 CTGGAGACAGGGCAAGAGGAAGG - Intergenic
985505672 5:278860-278882 CTGGGGACACGGGAGGGGCTGGG + Intronic
985639019 5:1054496-1054518 CTGGGGAAACGCTGGGCGGAGGG + Intronic
985743472 5:1633675-1633697 CTGGGGACACGGCAGGTGACGGG + Intergenic
985901683 5:2800651-2800673 GTGGGGAAACGGAAGCAGGAAGG + Intergenic
985963800 5:3324626-3324648 CTGGGATCACAGTAGGAGGGAGG - Intergenic
986039085 5:3969476-3969498 CAGGGGAGACAGTAGGAGGCAGG + Intergenic
988232057 5:28492026-28492048 CAGGGCAAAAGGTAGGAGGAGGG + Intergenic
988882832 5:35522256-35522278 CTGGGGAAAGGGTGGGAGGTGGG + Intergenic
989351660 5:40493802-40493824 CGGGGGAAAGGGTGGGAGGAGGG - Intergenic
990468226 5:56089127-56089149 CTGGGAACACAGGAGGAGAAAGG - Intergenic
992675579 5:79102537-79102559 CTGGGGACATAGTGAGAGGAGGG + Intronic
992996551 5:82339730-82339752 CCTGGGAGAAGGTAGGAGGATGG + Intronic
996016005 5:118534660-118534682 CTGGGGAAACGGGAAGTGGAGGG - Intergenic
997267535 5:132503950-132503972 CTGGGGAGACTGGAGTAGGAGGG + Intergenic
997903758 5:137793872-137793894 GGGAGGACAAGGTAGGAGGATGG - Intergenic
998461396 5:142312889-142312911 CTGGGGAGAGGGTAGGGGAAAGG - Exonic
999330800 5:150672241-150672263 CCGCGGACGCGGTTGGAGGAGGG - Intronic
1000240839 5:159406678-159406700 CTGGGGATAGAGTAGGAGCACGG - Intergenic
1001329199 5:170750468-170750490 CTAGGGTGACGGTAGGAGGGAGG - Intergenic
1001700666 5:173704556-173704578 CTGGGCCCAGGGTAGAAGGAGGG - Intergenic
1002059147 5:176616159-176616181 GTGGGCACACAGTAGGAGGTAGG + Intergenic
1002194528 5:177494882-177494904 CTGGGGTCAGGGGAGGGGGAGGG + Intronic
1002338379 5:178496082-178496104 CATGGGACAGGGTAGGAGGCAGG + Intronic
1004303148 6:14476580-14476602 TTGTGGACACGGTGGGAGGGAGG - Intergenic
1004545426 6:16593573-16593595 CTGGAGAGAAGGCAGGAGGATGG - Intronic
1005039531 6:21588499-21588521 CAGGGGATGGGGTAGGAGGACGG + Intergenic
1005886409 6:30101050-30101072 CTGGGGACTGGGTAGGCGGATGG - Intergenic
1005887679 6:30109178-30109200 GTGGGGAGAGGGGAGGAGGATGG - Intronic
1006084802 6:31587973-31587995 CTGGGGACAGGGAAGGGGGAGGG + Intronic
1006174267 6:32112481-32112503 GTGGGGAGAAGGGAGGAGGAAGG + Intronic
1006305160 6:33214187-33214209 CTGGGGACCCGGGAGGGGGCAGG - Intergenic
1006369288 6:33634100-33634122 CTGGCGACAGGGGAGCAGGAGGG - Intronic
1006375753 6:33670916-33670938 CTGGGGACACAGAAGGAAGTGGG - Intronic
1006439119 6:34042428-34042450 GTGAGGACATGGCAGGAGGATGG + Intronic
1007654908 6:43446042-43446064 CTGGGGACAAGGGATGGGGAAGG + Intronic
1007721972 6:43890573-43890595 CTCAGGACACAGTAGCAGGAAGG + Intergenic
1007764665 6:44153550-44153572 CTGGGGCCCGGGCAGGAGGAGGG + Intronic
1007864710 6:44955721-44955743 CAGGGGAAAGGGTAGGAGGGGGG + Intronic
1008004274 6:46393478-46393500 CAGGGGAAACGGTGGGATGAGGG + Intronic
1010117595 6:72333003-72333025 GAGGGGACAAGGAAGGAGGAGGG + Intronic
1012204631 6:96445304-96445326 TAGGGGAAAGGGTAGGAGGAAGG + Intergenic
1014917206 6:127165617-127165639 AGGGTGACAAGGTAGGAGGAAGG - Intronic
1015503033 6:133953032-133953054 TTGGGGACCAGGAAGGAGGAAGG + Intronic
1015930502 6:138354714-138354736 CTGGGAACACGGTGGGAGCCTGG - Intergenic
1015935235 6:138402300-138402322 CTGGGGACAGGGAAGGAGGCAGG + Intergenic
1018442465 6:163825630-163825652 ATGGGGATGCGGTAGGAGGTGGG + Intergenic
1018780043 6:167055007-167055029 CTGGAGACAGGGGAGGAGGAAGG + Intergenic
1019794702 7:3041188-3041210 CTGTGGACACTGTACTAGGAAGG - Intronic
1020558823 7:9703008-9703030 AGGGGGACAGGGTGGGAGGAGGG + Intergenic
1021205676 7:17777021-17777043 CTGGGGATAGGGAATGAGGAGGG - Intergenic
1021600330 7:22357346-22357368 CTCGGGACCCGGGAGGAAGAGGG + Intergenic
1022335217 7:29415572-29415594 CTCGGGACACAGTTGGTGGAGGG + Intronic
1022652766 7:32292734-32292756 CTTGGAACACAGCAGGAGGAGGG - Intronic
1023895646 7:44430933-44430955 CTGAGGACACGGCAGGAGGATGG - Intronic
1023895691 7:44431197-44431219 CTGGGCACATGGTAGGAGGCAGG + Intronic
1024932683 7:54680391-54680413 CTGGGGACACAGAAGGTGGTGGG - Intergenic
1026142831 7:67720956-67720978 CTTGGGACAGGGTAGGAAGAGGG + Intergenic
1027878548 7:83802309-83802331 CTGGGGACAGGGTTGGGGGTAGG + Intergenic
1027933188 7:84566809-84566831 CTGGGGACAGGGTTGGTAGATGG - Intergenic
1028071863 7:86460575-86460597 GTGGGGAGAGAGTAGGAGGAGGG - Intergenic
1029538062 7:101167275-101167297 ATGGGGGCAGGGGAGGAGGAAGG + Intergenic
1029585579 7:101468722-101468744 CTGGGGAAACTGTGGGAGGAGGG + Intronic
1030474411 7:110011527-110011549 CTTGGCACATGGTAGGAAGAAGG + Intergenic
1033609288 7:142950466-142950488 ATGGGGACAGGGCAGGAGGCAGG - Intronic
1033961083 7:146913900-146913922 CAGGGGAAAGGGTAGGAGGGTGG - Intronic
1034277269 7:149829401-149829423 AGGGGGACACAGGAGGAGGAGGG - Intergenic
1034414079 7:150955829-150955851 GTGGGGACCTGGTAGAAGGAGGG - Intronic
1035372029 7:158386076-158386098 CTTGGGGCACGGGAGGAGGGAGG - Intronic
1035372120 7:158386347-158386369 CTTGGGGCACGGGAGGAGGGAGG - Intronic
1035917325 8:3638816-3638838 CTGGAGACAAGGTGTGAGGAAGG - Intronic
1036644352 8:10602441-10602463 CTGTGGACACGGGGGCAGGAGGG + Intergenic
1036657050 8:10683451-10683473 GAGGGGACAAGGTATGAGGATGG + Intronic
1037507044 8:19540952-19540974 CTGGGGACAGGGTAGGGGCTTGG - Intronic
1037764466 8:21763763-21763785 TTGAGGACAGGGTAGGGGGACGG - Intronic
1038286840 8:26212819-26212841 CTGAGGACACAGTAAGAAGACGG + Intergenic
1038813590 8:30877976-30877998 TTAGGGACAGGGTAGGAGAATGG - Intronic
1039408329 8:37331374-37331396 CGGGGGAGACTGAAGGAGGAGGG + Intergenic
1040701321 8:50069698-50069720 CTGGGGAGAAGTCAGGAGGAAGG - Intronic
1041277492 8:56177884-56177906 CTGGGGACACAGAAGCAGTACGG - Intronic
1043534983 8:81192986-81193008 CTGGGGACTCGGGGGGAGGTTGG - Intergenic
1043923385 8:86009618-86009640 CAGGGTAGAGGGTAGGAGGAGGG - Intronic
1045355920 8:101388996-101389018 ATGGGGACAGAGAAGGAGGATGG - Intergenic
1045596301 8:103660084-103660106 CTGAGGACACGGCAGCAGGCAGG - Intronic
1046083641 8:109403938-109403960 TTGGGTACACAGTAGGATGAGGG + Intronic
1047292618 8:123542769-123542791 CTGGGGCCGAGGTGGGAGGATGG - Intergenic
1047614918 8:126556280-126556302 CTGTGGACGGGGGAGGAGGAAGG - Exonic
1047976013 8:130131522-130131544 CTGGGGTCGAGGTGGGAGGATGG + Intronic
1048021292 8:130541759-130541781 CTGGGGACATGATTGGAGAAGGG - Intergenic
1048949239 8:139480478-139480500 CTGAGGAGACGGGAGGAGCAGGG + Intergenic
1048968304 8:139629728-139629750 CTGGGGACACAGCAGGAAGGTGG - Intronic
1049544120 8:143221605-143221627 CAGGAGACTGGGTAGGAGGAGGG + Intergenic
1050090855 9:2015896-2015918 TGGGGGACAGGGGAGGAGGATGG + Intronic
1050374910 9:4960650-4960672 CTGGGGAAACTGAAGCAGGAGGG - Intergenic
1050537896 9:6645830-6645852 CTGGGAAGAGGGTAGGAAGAGGG - Intergenic
1050874346 9:10615412-10615434 GTGGGGAGGAGGTAGGAGGAAGG - Intergenic
1052626205 9:30980530-30980552 CTGGGGACATGATAGGGTGAGGG + Intergenic
1052877287 9:33576370-33576392 CTGGAGACAGGGCAAGAGGAAGG + Intergenic
1053498715 9:38568024-38568046 CTGGAGACAGGGCAAGAGGAAGG - Intronic
1053662477 9:40293281-40293303 CTGGAGACAGGGCAAGAGGAAGG + Intronic
1053912931 9:42923456-42923478 CTGGAGACAGGGCAAGAGGAAGG + Intergenic
1054374606 9:64439506-64439528 CTGGAGACAGGGCAAGAGGAAGG + Intergenic
1056133676 9:83609486-83609508 CTGGGGAAAGGGTGGGAGGGGGG + Intergenic
1057161768 9:92894322-92894344 CTGGAGACAGGGCAAGAGGAAGG - Intergenic
1057191371 9:93089754-93089776 CTGGGGGCAGGGAAGGAGGGAGG - Intergenic
1057678166 9:97152517-97152539 CTGGAGACAGGGCAAGAGGAAGG - Intergenic
1058073556 9:100626970-100626992 CTGGGTACAGGGTAGGAAGAGGG - Intergenic
1060192682 9:121603091-121603113 CAGAGGCCACAGTAGGAGGATGG - Intronic
1060798139 9:126526488-126526510 CTGGGATCACGGCAGGAGGAAGG + Intergenic
1061249062 9:129415999-129416021 CTGGGGACACAGCTGGAAGATGG + Intergenic
1061252203 9:129432953-129432975 CTGGGGACACCTTAGCAGGTGGG + Intergenic
1061506043 9:131032340-131032362 CAGGGGACCCGGCAGGAGGTGGG - Intronic
1062171517 9:135137397-135137419 CTGGGGGCAGGGAGGGAGGAAGG + Intergenic
1062277282 9:135736932-135736954 CTGGAGACACGGCAGGAAGCAGG - Intronic
1062528603 9:136989410-136989432 CTGGGGACACGCGTGGTGGATGG + Intergenic
1203708033 Un_KI270742v1:69866-69888 CTGGAGACAGGGCAAGAGGAAGG + Intergenic
1203547271 Un_KI270743v1:138209-138231 CTGGAGACAGGGCAAGAGGAAGG - Intergenic
1186182961 X:6990671-6990693 GTGGGGACAGGGTAGGCAGAGGG + Intergenic
1190061153 X:47212526-47212548 CTCAGGACAGGGAAGGAGGATGG + Intronic
1195300265 X:103523318-103523340 CTGGGGACAGGGCAATAGGAGGG + Intergenic
1196511133 X:116513930-116513952 CTGGGGAAAAGGTGGGAGGGGGG - Intergenic
1196768368 X:119270151-119270173 CTGGGGACTGGGTAGGACCATGG + Intergenic
1197306976 X:124854349-124854371 CAGGGGAAAGGGTAGGAGGTGGG + Intronic
1199326737 X:146507442-146507464 AAGGGGAGAGGGTAGGAGGATGG + Intergenic
1200099829 X:153684921-153684943 CCTGGGACACGGTAAGGGGAGGG + Intronic
1200224356 X:154409076-154409098 CTGGGGAGACGGAAGAAGGGAGG - Intronic
1200237096 X:154472921-154472943 CTGGGCACAGGGCAGGAGGGTGG - Exonic