ID: 1168277983

View in Genome Browser
Species Human (GRCh38)
Location 19:55287536-55287558
Sequence CAGGGCGAGGAGCTGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 596
Summary {0: 1, 1: 0, 2: 6, 3: 57, 4: 532}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168277983_1168277992 15 Left 1168277983 19:55287536-55287558 CCCAGCTCCAGCTCCTCGCCCTG 0: 1
1: 0
2: 6
3: 57
4: 532
Right 1168277992 19:55287574-55287596 TGCGCTCTGCTAGACAAGCAGGG 0: 1
1: 0
2: 0
3: 7
4: 54
1168277983_1168277988 -10 Left 1168277983 19:55287536-55287558 CCCAGCTCCAGCTCCTCGCCCTG 0: 1
1: 0
2: 6
3: 57
4: 532
Right 1168277988 19:55287549-55287571 CCTCGCCCTGTGGCACTGCATGG 0: 1
1: 0
2: 1
3: 44
4: 382
1168277983_1168277991 14 Left 1168277983 19:55287536-55287558 CCCAGCTCCAGCTCCTCGCCCTG 0: 1
1: 0
2: 6
3: 57
4: 532
Right 1168277991 19:55287573-55287595 ATGCGCTCTGCTAGACAAGCAGG 0: 1
1: 0
2: 0
3: 4
4: 41

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168277983 Original CRISPR CAGGGCGAGGAGCTGGAGCT GGG (reversed) Intronic
900113944 1:1020696-1020718 CCGGGCGGGGAGCGGGGGCTGGG + Intronic
900201030 1:1406681-1406703 CCGGGCGAGGGGCTGGAGCAGGG + Intronic
900408313 1:2502046-2502068 CTGGGGGAGCAGCTGCAGCTGGG + Intronic
900528958 1:3143350-3143372 TGGGGCGAGGGGCTGGTGCTTGG - Intronic
900647472 1:3715440-3715462 AAGGGCTGGGAGATGGAGCTTGG + Intronic
900712235 1:4121803-4121825 CAGAGCGGGGTCCTGGAGCTGGG - Intergenic
902289895 1:15429021-15429043 TAGGGCCAGGAGCTGGGCCTGGG - Exonic
902377229 1:16035493-16035515 GAGGGCGAGGAGCTGGATCCGGG - Intergenic
902382408 1:16058752-16058774 GAGGGCGAGGAGCTGGATCTGGG - Intronic
902503430 1:16925053-16925075 CAGGGTGTGGGGCGGGAGCTGGG + Intronic
902631167 1:17705533-17705555 CTGGGCCATGAGCTGGGGCTGGG + Intergenic
902837373 1:19055456-19055478 CAGGACCAGGAGATGGGGCTGGG + Intergenic
902840394 1:19070525-19070547 CAGGGCCCGGAGCAGGAGCCGGG + Intergenic
903173739 1:21568877-21568899 CACTCCAAGGAGCTGGAGCTTGG - Intronic
903385227 1:22921632-22921654 CTGGGCCTGGAGCTGGAGTTGGG + Intergenic
903403246 1:23073655-23073677 CAGGGCCAGGAGCCAGAGCATGG - Intronic
903465382 1:23548829-23548851 TTGGGCTAGGAGCTGGAGCCAGG + Intergenic
903703948 1:25271421-25271443 CAGGGCCAGGAGCTGCAGGGAGG - Intronic
904259438 1:29280003-29280025 CAGGGTCACAAGCTGGAGCTTGG - Intronic
904286942 1:29459025-29459047 CAGGGCCAGGACATGGACCTGGG - Intergenic
904311941 1:29634801-29634823 GAGGGGGAGGAGTAGGAGCTGGG - Intergenic
904494623 1:30879646-30879668 CAGGGGCAGGAGCCGGAGCCTGG - Intronic
904567026 1:31434315-31434337 CAGGGGCAGGTCCTGGAGCTGGG - Exonic
904814001 1:33181843-33181865 GAGGGCGAGAAGCTGGGGATGGG + Intronic
904841464 1:33374387-33374409 CAGGGCCAGGTGCTGGGGCTAGG + Intronic
905203585 1:36330125-36330147 CAGGGCGAGGAACTGGGTCGGGG - Intergenic
905204779 1:36337193-36337215 CAGGGCGAGGAACTGGGTCGGGG - Intergenic
905340392 1:37273902-37273924 GGGGGCGGGGGGCTGGAGCTGGG - Intergenic
905407101 1:37741237-37741259 CAGCAAGAGGAGCTGGCGCTGGG + Intronic
905769553 1:40628805-40628827 CAGGGCAAGGTGCTGCAGGTGGG - Exonic
907052386 1:51338495-51338517 AGGGGAGAGGAGCTGGGGCTTGG + Intronic
907200904 1:52726332-52726354 GAGGGGGAGAAGCTGGAGGTCGG + Intergenic
907357635 1:53889620-53889642 CAGGGAGAGGAGCTGGGCCGCGG + Intronic
908128160 1:61050576-61050598 CAGGGCCAGGAGCTGCGGCTTGG + Intronic
908359923 1:63358858-63358880 CAGGGCGAGAAGTGGGAGGTGGG + Intergenic
908544198 1:65148157-65148179 GAGGGCGAGGAGGTGGAGAAGGG + Intronic
908669941 1:66534619-66534641 CAGGGAGCTGAGATGGAGCTAGG + Intronic
909670011 1:78177623-78177645 CAGGGTGGGGAGCTGGTGCACGG + Intergenic
909931280 1:81502771-81502793 AAGAGGGAGGAGCTGTAGCTGGG - Intronic
910707192 1:90142297-90142319 CAGAGCAAAGAGCAGGAGCTGGG + Intergenic
911498803 1:98661610-98661632 GCGGGCGAGGGGCTGGAGCGGGG + Intergenic
913133426 1:115863825-115863847 GATGGCTAGGAGCTGAAGCTGGG + Intergenic
915286375 1:154855992-154856014 CAGGGCGGGGAGAGGGAGCATGG - Intronic
915313482 1:155015979-155016001 CAGGGGGTGGATCTGGAGCATGG + Intronic
915332848 1:155124538-155124560 CAGGGGGAGGAGCAGAACCTGGG - Intergenic
915348947 1:155212822-155212844 CAGATGGAGCAGCTGGAGCTGGG + Intronic
915352134 1:155233448-155233470 CAGATGGAGCAGCTGGAGCTGGG + Intergenic
915509346 1:156378064-156378086 CAGGGCCATGAGCAGCAGCTGGG - Exonic
915543302 1:156582264-156582286 CAGCGGGAACAGCTGGAGCTGGG - Exonic
915727772 1:158030912-158030934 CAGGATGAGCAGATGGAGCTGGG - Intronic
916740059 1:167639856-167639878 CAAGGCGTGGCGCTGCAGCTAGG - Intronic
919606370 1:199689393-199689415 CAGGGCGAAGAGCTTAAGGTTGG - Intergenic
921265550 1:213418060-213418082 TAAGGCCAGGAGCGGGAGCTGGG - Intergenic
923086388 1:230706279-230706301 CAGGGCGAGGGGCAGGATCTGGG - Intronic
924592229 1:245414536-245414558 GAGGAGGAGGAGCTGAAGCTTGG - Intronic
924741888 1:246799037-246799059 GAGGCCGAGGAGCAGGAACTCGG + Intergenic
1064420776 10:15188951-15188973 CAGGAGGAGGAGCTGGAGAATGG - Intergenic
1065020144 10:21496344-21496366 CAGGCTGGGGAGCCGGAGCTCGG - Intronic
1065958146 10:30711065-30711087 AAGGGCCAGGGGCTTGAGCTGGG + Intergenic
1066358656 10:34709674-34709696 CAGGGGCAGGAGCTGGAATTTGG + Intronic
1067051653 10:43024932-43024954 CAGGGCGGGAAGCTGGGGCAAGG + Intergenic
1067466489 10:46502957-46502979 CTGGACCAGGAGCAGGAGCTGGG + Intergenic
1067620699 10:47881648-47881670 CTGGACCAGGAGCAGGAGCTGGG - Intergenic
1067839755 10:49666243-49666265 CTGGGGCTGGAGCTGGAGCTGGG - Intergenic
1067839760 10:49666261-49666283 CTGGGGCTGGAGCTGGAGCTGGG - Intergenic
1069142174 10:64840173-64840195 CAGAGAGGGGAGCTGGAGCAGGG - Intergenic
1069246888 10:66217959-66217981 TAGGGGAAGGAGCTGGAGCCAGG + Intronic
1070327897 10:75399983-75400005 CAGGCCGAGGCGCTGGAGCTCGG + Exonic
1070749448 10:78955332-78955354 CAGGGTGAGGATCAGGAGGTAGG - Intergenic
1070761409 10:79026607-79026629 CTGGGTGAGGAGCTGGACCCTGG + Intergenic
1070984868 10:80679993-80680015 AGGGGCGAGGGGCTGGAGGTTGG + Intergenic
1071967211 10:90864082-90864104 CAGGGAGAGGTGCTTGAGCCCGG - Intergenic
1072536998 10:96371506-96371528 CAGGGCGTGGAGCTCCAGCGGGG - Intronic
1072886082 10:99275577-99275599 AAGGGAGAGGAGCTGTTGCTGGG - Intergenic
1073152744 10:101323008-101323030 CAGGGAGAGGAGCAGGAGGAGGG + Intergenic
1074086258 10:110210498-110210520 CGGGGCGAGGGCCTGGAGCGGGG - Intronic
1075110396 10:119575721-119575743 CAGGGGGAGGAGCTTGTCCTTGG + Exonic
1075585221 10:123652435-123652457 CAGGCTGGGGAACTGGAGCTGGG + Intergenic
1076197243 10:128527716-128527738 CAGGGGAGGGAGCGGGAGCTGGG - Intergenic
1076330068 10:129657625-129657647 CTGGAGGAGGAGCTGGAGCTGGG + Intronic
1076992134 11:280926-280948 CTGCGCCAGCAGCTGGAGCTCGG + Exonic
1077010332 11:376650-376672 CAGGGCGCGGGGGCGGAGCTCGG - Exonic
1077330456 11:1981895-1981917 GAGGGAGAGGGGCTGCAGCTCGG - Intronic
1077371821 11:2185923-2185945 GAGGGCGTTCAGCTGGAGCTGGG + Intergenic
1077998526 11:7474602-7474624 CAGAGCCATGAGCTGGGGCTGGG + Intergenic
1078315459 11:10289858-10289880 CAGGGCCAGGGTCAGGAGCTGGG + Intronic
1078561577 11:12377597-12377619 CGGGACGCGGAGCTGGCGCTGGG - Exonic
1078907018 11:15697112-15697134 TGGGGCCAGGACCTGGAGCTGGG + Intergenic
1080139030 11:28892295-28892317 TAGGGTGAGGGGCTGGTGCTTGG - Intergenic
1080749367 11:35138700-35138722 CTGGGAGAGGAGCTGGAGAGAGG - Intergenic
1083272169 11:61578084-61578106 CAGAGTGTGGAGCTGGAGCCTGG + Intronic
1083386592 11:62315255-62315277 CAGGGTGAGGGGCTGGACTTCGG + Intergenic
1083682302 11:64357248-64357270 CGGGGCCCGGAGATGGAGCTGGG + Exonic
1083727173 11:64634637-64634659 CAGGGTGAGGATGTGGGGCTGGG + Intronic
1083903421 11:65654848-65654870 CAGGGGCAGGGGCTGGAGCCTGG + Exonic
1083944923 11:65918548-65918570 CAGGGCCGGGAGGTGTAGCTGGG - Intronic
1083962451 11:66021803-66021825 CAGGGCGATGATCTTGAGCAGGG + Exonic
1084035769 11:66509335-66509357 GAGGGGGAGGGGCAGGAGCTTGG + Exonic
1084393961 11:68896819-68896841 CAGGGGGTGGAGCAGGGGCTGGG - Intronic
1084464314 11:69313334-69313356 CGGGGAGAGGAGCTGGCTCTGGG + Intronic
1084656465 11:70522638-70522660 CAGCCCGCGGAGCTGGAGCCGGG - Intronic
1085152381 11:74262521-74262543 CAGAACCAGGATCTGGAGCTTGG - Intronic
1085503287 11:77041170-77041192 AAGTGAGTGGAGCTGGAGCTGGG + Exonic
1085521369 11:77140684-77140706 CAGGGAGTGCAGCTGGGGCTTGG + Intronic
1085967668 11:81548307-81548329 CAGGGCGTGTAACTGGACCTTGG + Intergenic
1087143771 11:94791720-94791742 CATGGCCAGGAGCGAGAGCTGGG - Intronic
1088135507 11:106552072-106552094 CATGGGGAGGAGGTGAAGCTGGG + Intergenic
1088489823 11:110375990-110376012 CAGGAAGGGGAGCTGGGGCTAGG - Intergenic
1089011788 11:115137421-115137443 CAGGTAGTGGAGCAGGAGCTGGG - Intergenic
1089078691 11:115759464-115759486 CAAGGGGAGAAGCTGGAGCAGGG + Intergenic
1089209238 11:116789425-116789447 CAGAGGGAGGGGCTGGAGATGGG + Exonic
1089282301 11:117382851-117382873 CAGGCCGAGGAGCTGGGCCCTGG + Exonic
1090184120 11:124725256-124725278 CAGGGGGAGGAGCTGCAAGTAGG - Intergenic
1090254184 11:125271768-125271790 CTGGGCTATGAGCTGGAGCAAGG - Intronic
1090651229 11:128807924-128807946 TAGAGAGAGGAGCTGGGGCTTGG - Intronic
1090716606 11:129436985-129437007 CAGGCCCATGAGCTGCAGCTCGG - Exonic
1202813434 11_KI270721v1_random:37074-37096 GAGGGAGAGGGGCTGCAGCTCGG - Intergenic
1091786530 12:3246378-3246400 TGGGGTGGGGAGCTGGAGCTGGG - Intronic
1091841183 12:3621987-3622009 CAGGGAGAGGAGCTGGTATTGGG + Intronic
1092045576 12:5430229-5430251 CAGGGCGAGAAGCTGGAGGAGGG + Intergenic
1092528072 12:9322605-9322627 CAGGGAGAGGCGCTGGAGCGGGG - Intergenic
1092539197 12:9409152-9409174 CGGGGAGAGGCGCTGGAGCGGGG + Intergenic
1092860661 12:12716997-12717019 CCGGGCGAGGAGCGGGAGGGAGG + Intronic
1094017922 12:25884329-25884351 CATGGGGAGGAGGTGGAGCTAGG + Intergenic
1094499579 12:31010028-31010050 CAGAGCTAGGAGCTGGAACCAGG + Intergenic
1094500259 12:31015343-31015365 CAGGGAGAGGCGCTGGAGCGGGG - Intergenic
1095085751 12:38056151-38056173 CAGGTCGAGGAGGTGGTGTTTGG + Intergenic
1095465469 12:42483892-42483914 AAGGACGCGGAGCTGGGGCTTGG - Intronic
1096228369 12:49883492-49883514 CAGGGGAAGGGGCAGGAGCTTGG + Intronic
1096553934 12:52391646-52391668 CAGGGAGTGGAGCTGGATCCAGG + Intergenic
1096660819 12:53122999-53123021 CCGGGCGGGGGGCTGGAGGTGGG + Intronic
1096782898 12:54001040-54001062 CAGGGCCAGGGGATGGGGCTGGG + Intronic
1097707224 12:62880800-62880822 CAGGGCGAGCACCTGGAGAAGGG - Intronic
1098157006 12:67609505-67609527 CAGGCCATGGAGCTGGAGGTAGG - Intergenic
1100315585 12:93441819-93441841 CAGAGCGAAGAGCTGGAGGCCGG + Intronic
1102571956 12:113832127-113832149 CATGACCAGGAGCTGGAGATAGG + Intronic
1103091705 12:118102781-118102803 CAGGGAGAGGAGATGGAGCCAGG - Intronic
1103343615 12:120234881-120234903 CAGGGGGAGGAGTCGGAGCCAGG + Intronic
1103564925 12:121810689-121810711 GAGGACGAGGAGCTCGACCTGGG + Exonic
1103568299 12:121828100-121828122 CAGGGCCAGGGGCAGGAGCAGGG - Intronic
1103721720 12:122978897-122978919 CCGGGCCAGGACCTGGAGCTGGG + Exonic
1103722726 12:122983199-122983221 CAGAGCCAGGTGCTGGGGCTGGG + Intergenic
1103778542 12:123384095-123384117 CGGGGCGAGCAGCTGGAGCCCGG + Exonic
1103938105 12:124487037-124487059 CAGCCTGAGGAGCTGAAGCTTGG + Intronic
1104043499 12:125145649-125145671 CCGGGCGAGAAGGTGGGGCTGGG - Intergenic
1104466349 12:128993942-128993964 CAGTGTGAGGAGCTGGGGCGAGG - Intergenic
1104600412 12:130149659-130149681 CAGGGCCAGGAGCTGGAGAATGG + Intergenic
1104649708 12:130522706-130522728 CAGGGAGAGGAGGAGGAGGTGGG + Intronic
1104754154 12:131258453-131258475 CTGGGCGGGGGGGTGGAGCTCGG + Intergenic
1104957152 12:132472529-132472551 TAGGGAGAGCAGCTGGAGCCGGG + Intergenic
1104966374 12:132510331-132510353 CAGGGCCAGGAGCGAGAGCCGGG - Intronic
1106183222 13:27385838-27385860 CAGTTCGGGGAGCTGGGGCTTGG + Intergenic
1106308398 13:28532833-28532855 GAGGGCGGGGAGGTGGCGCTCGG - Intergenic
1108573047 13:51769099-51769121 CAGGGCTAGGGGCAGCAGCTGGG - Intronic
1110136229 13:72070753-72070775 CAGGACCATCAGCTGGAGCTTGG + Intergenic
1111487881 13:88927266-88927288 CAGGTTGTGGAGCTGCAGCTGGG + Intergenic
1111843093 13:93473767-93473789 CACAGGGAGGAGGTGGAGCTGGG - Intronic
1112398658 13:99056821-99056843 CAGGGCGAGGAGCTGCTCCTTGG - Intronic
1113546198 13:111153362-111153384 CAGGCCAAGGACCTGGAGCAGGG + Intronic
1113698555 13:112365876-112365898 CAGGGCTAAGGGGTGGAGCTGGG - Intergenic
1113766981 13:112887891-112887913 CAGGGAGAGGAGATGTAGCCAGG - Intergenic
1113874721 13:113587002-113587024 CATGGTGAGGAGCTGGACCCAGG + Intronic
1114664435 14:24369584-24369606 CAGGCCGAGGGGGTGGAGGTCGG - Exonic
1114665054 14:24372722-24372744 CTGGGGGAGGGGCTGGAGTTGGG + Intronic
1115592208 14:34874952-34874974 GCGGGCGAGGAGCCGGCGCTGGG - Intronic
1117421773 14:55553838-55553860 CAGTACGGGGAGCTGGAGTTGGG + Intergenic
1117814598 14:59583793-59583815 CAGGGCAGGGAGTTGGTGCTGGG + Intergenic
1118322474 14:64761399-64761421 CAGGGCGGGGAGCTGAGGCTGGG + Intronic
1118862490 14:69675391-69675413 CAGGGCCAGGAGGAGGTGCTGGG - Intronic
1119408231 14:74411886-74411908 CTGGGGGAGGAGCTGGCGCTTGG - Intronic
1119617521 14:76108469-76108491 AAGGGTAAGGAGTTGGAGCTGGG - Intergenic
1120235198 14:81882485-81882507 CAGGGCCAGGCCCTGGAGTTAGG + Intergenic
1121085382 14:91142176-91142198 CAGGTGGTAGAGCTGGAGCTTGG + Intronic
1121245746 14:92459851-92459873 CAGGGCCAGGAGCTGGATACAGG - Intronic
1121573100 14:94962204-94962226 GAGGGAGTGGAGCTGGAGATAGG + Intergenic
1122215572 14:100201545-100201567 CAGGGAGAGGAGAGGGAGATAGG + Intergenic
1122235808 14:100330109-100330131 CGGGGCGGGGAGCATGAGCTGGG + Exonic
1122280453 14:100619298-100619320 CAGGAAGAGAAGCTGAAGCTGGG + Intergenic
1122603164 14:102931053-102931075 GAGGGTGAGGAGCTGGAGGGAGG + Exonic
1122799276 14:104221693-104221715 CATGGCGAGGAGCTGGGGTGGGG + Intergenic
1122801345 14:104231183-104231205 CAGGACTGGGAGCTGGAGCCTGG + Intergenic
1122904343 14:104795164-104795186 CCGGGCCTGGAGCTGGGGCTCGG - Intronic
1122953920 14:105061186-105061208 CGTGGTGAGGAGCTGGACCTCGG - Intronic
1122972274 14:105157207-105157229 CAGGGGGAGCAGCCGGGGCTGGG - Intronic
1124109512 15:26773102-26773124 GAGGGGGAGGAGCGGGCGCTGGG + Intronic
1124220643 15:27847283-27847305 GAGGGCGGGGAGCTGGTGCTAGG + Intronic
1124622194 15:31280094-31280116 CAGCACATGGAGCTGGAGCTGGG + Intergenic
1124654210 15:31495499-31495521 GAGGCCGAGGAGCTGGGGTTGGG - Intronic
1125323293 15:38511269-38511291 TAGAGCAAGGAGCTGGAGCGAGG + Intronic
1125730883 15:41892306-41892328 CAGGGTGAGGGGCTGGTGCAGGG - Intronic
1126131745 15:45348490-45348512 GAGGTGGAGGAGCTGGAGCTGGG + Intergenic
1127643138 15:60934031-60934053 TATGGTGTGGAGCTGGAGCTGGG - Intronic
1127818732 15:62636677-62636699 CAGGGGAAGGAAGTGGAGCTAGG + Intronic
1128082959 15:64867119-64867141 CAGGGAGAGTGGCTGGACCTCGG - Exonic
1128760440 15:70212996-70213018 GAGGGAGAGGAGGTGGATCTGGG + Intergenic
1129260775 15:74366008-74366030 CAGGGCGAGGTCCAGGCGCTCGG - Intronic
1129294242 15:74591254-74591276 AAGAGGGAGGAGCTGTAGCTGGG - Exonic
1129388404 15:75208208-75208230 CAGGGGATGGAGCTGGAGCAGGG - Exonic
1129616679 15:77104408-77104430 CCAGGCCAGGAGCTGAAGCTGGG + Exonic
1129888590 15:79056075-79056097 CAGGGTGAGGCGTTTGAGCTTGG + Intronic
1131174420 15:90201223-90201245 CAGCGCGAGGGGCGGCAGCTCGG - Intronic
1131396464 15:92090661-92090683 GGGGGAGAGGGGCTGGAGCTGGG - Intronic
1131694076 15:94856409-94856431 CAGGGCGAGGGGCCGGAGGCTGG + Intergenic
1132271336 15:100528680-100528702 GAGGGAGAGGAGATGGAGATTGG - Intronic
1132291111 15:100704508-100704530 ATGGGCGCTGAGCTGGAGCTGGG + Intergenic
1132462145 16:60934-60956 CGGGGCGAGGAGCTGGAGATGGG + Intronic
1132826063 16:1906278-1906300 TGGGGCGGGGAGCTGAAGCTGGG - Intergenic
1132932452 16:2465905-2465927 CAGCGCCAGGAGGGGGAGCTGGG - Intergenic
1133001480 16:2853641-2853663 GAGGGCGAGGTGGTGCAGCTGGG + Intronic
1133211601 16:4266179-4266201 AAGGAAGAGGAGCTGGGGCTGGG + Intronic
1133220610 16:4317659-4317681 CAGGGGGAGGGGCTGCACCTGGG + Intronic
1133235508 16:4385690-4385712 CAGTGAGAGGAGCAGGGGCTGGG - Intronic
1133702593 16:8322994-8323016 CTAGGCCAGGGGCTGGAGCTAGG - Intergenic
1134098618 16:11436062-11436084 CTGGGCCAGGAGCTGGAGCCAGG - Intronic
1135423757 16:22322258-22322280 CAGGGCCTGTGGCTGGAGCTGGG + Intronic
1135424197 16:22324257-22324279 CAGGCCTGGGAGCTGGAGCCTGG - Intronic
1136079556 16:27842742-27842764 CAGAGAGTGGAGATGGAGCTGGG + Intronic
1136139890 16:28281808-28281830 GAGGGCGAGAAGCTGGAGAAGGG + Intergenic
1136185683 16:28587555-28587577 CAGGGCCAGAAGATGGAGGTAGG - Intronic
1136186552 16:28591842-28591864 CAAGTTGAGGAGCTGGAGCGGGG + Intergenic
1137717660 16:50608580-50608602 CAGGGCCAGGACATGGACCTAGG - Intronic
1138171764 16:54857510-54857532 AAGGGTGAGGAGCTGGAAGTGGG + Intergenic
1139463737 16:67142716-67142738 CAGGGTCTGGAGCTGCAGCTGGG + Intronic
1139517154 16:67458886-67458908 TAGTGCCAGGAGATGGAGCTGGG - Intronic
1139666367 16:68459670-68459692 CAGGGCTAGGAAGTGGGGCTAGG + Intergenic
1139974805 16:70801031-70801053 CAGGGCGAGGCGGCGGAGCGTGG - Exonic
1141594012 16:85086576-85086598 CAGGGCGAGGAGCTGGGGCAAGG + Intronic
1141597288 16:85105054-85105076 CCTGGCTAGGAGCTGGACCTAGG + Intronic
1141984783 16:87572692-87572714 CAGGTGCAGGTGCTGGAGCTGGG + Intergenic
1142033822 16:87851758-87851780 CAGGGCCAGGGCCAGGAGCTTGG + Exonic
1142067133 16:88069029-88069051 CTGGGCCTGGGGCTGGAGCTGGG - Intronic
1142192044 16:88722543-88722565 CAGGGGCAGCAGCTGGGGCTCGG + Intronic
1143381180 17:6497426-6497448 CAGGACCAGGGGCTGGAGTTAGG + Intronic
1143739495 17:8942110-8942132 AAGGGAGAGAAGCTGGAGATGGG - Intronic
1143830376 17:9645886-9645908 GCCGGCGGGGAGCTGGAGCTGGG - Exonic
1144026296 17:11278889-11278911 CAGGGCAGGAAGGTGGAGCTGGG + Intronic
1144206727 17:12984709-12984731 CCAGGGGAGGAGCTGCAGCTGGG - Exonic
1144561737 17:16326053-16326075 CAGGGGAAGAAGCTGGAGTTTGG - Exonic
1144595668 17:16568609-16568631 CAGGGCTCGGAGCTGGAGCCTGG - Intronic
1144624745 17:16838941-16838963 GTGGGGGAGGAGCTGGGGCTTGG + Intergenic
1144881685 17:18433780-18433802 GTGGGGGAGGAGCTGGGGCTTGG - Intergenic
1145128398 17:20320558-20320580 CAGGGCGGGGAGCGGCTGCTCGG + Intergenic
1145150548 17:20510606-20510628 GTGGGGGAGGAGCTGGGGCTTGG + Intergenic
1145196214 17:20896656-20896678 CAGGGCGGGGAGCGGCTGCTCGG - Intergenic
1145998591 17:29118269-29118291 TAGAGCCAGCAGCTGGAGCTGGG + Intronic
1146017655 17:29246873-29246895 CAGGCTGAGCAGCAGGAGCTGGG + Exonic
1146691263 17:34877819-34877841 TAGGAGGACGAGCTGGAGCTAGG - Intergenic
1147135966 17:38434375-38434397 CTGGCCGAGGAGCTGGCCCTGGG + Intronic
1147481167 17:40764655-40764677 CTGGGAGAGGAGCTGGAGATGGG + Intergenic
1147595126 17:41712104-41712126 CATGGTGAGGGGCTGGAGCGGGG - Intergenic
1147615396 17:41824419-41824441 CATAGCTAGGAGCTGGAGCCAGG - Intergenic
1147659074 17:42107611-42107633 CAGGGCCAGCAGCCGGCGCTCGG + Exonic
1147742383 17:42676564-42676586 CCGGGCGAGGAGCTGCGGATGGG + Exonic
1147889257 17:43705496-43705518 CAGGGCCAGGATCTGAAGCTGGG + Intergenic
1148000621 17:44385190-44385212 CAGGCCGGAGAGCTGGTGCTTGG - Exonic
1148127228 17:45243086-45243108 CAGGGTGAGGAGGCGGAGCTGGG - Intronic
1148461544 17:47841481-47841503 CACTGCGGGGAGCTGGAGCTGGG + Intergenic
1148582408 17:48752893-48752915 CAGGGCGAGGAGATCACGCTTGG - Intergenic
1148713546 17:49699378-49699400 GAGGAGGAGGAGCTGGAGCTTGG - Intergenic
1149347243 17:55751156-55751178 CAGAGCGGGCTGCTGGAGCTCGG - Exonic
1149634738 17:58157449-58157471 CAGAGCGAGGAGCTGGGACGTGG - Intergenic
1149840984 17:59964791-59964813 CGGGGCTAGGAGGTGGAGCCGGG - Intronic
1149994788 17:61400673-61400695 CAGGGCCAGAACCTGGAGCCGGG - Intronic
1150664471 17:67119459-67119481 CAGGGCTGGGAGCTGGAGGATGG + Intronic
1151563933 17:74886700-74886722 CAGGCAGAGGACCTGGAACTTGG - Intronic
1151703537 17:75755400-75755422 CAGGGGGCGGGGCTGGGGCTGGG + Intronic
1151784870 17:76270518-76270540 CCGGGCGCTGGGCTGGAGCTGGG + Exonic
1152310724 17:79548199-79548221 CCGGGAGCGGAGCAGGAGCTGGG - Intergenic
1152655106 17:81515630-81515652 CAGGGCAAGGAGCTGGAGGTGGG - Intronic
1152728114 17:81957651-81957673 GAGGGTGAGAGGCTGGAGCTGGG - Intronic
1153811407 18:8755214-8755236 CAGGACGAGGGGCAGGACCTAGG + Intronic
1155839080 18:30625557-30625579 CAGAGAGAGGAGCTGGAGAGGGG + Intergenic
1157179884 18:45487690-45487712 CAGAGGGAGGAGCTGGACTTTGG + Intronic
1157225061 18:45855248-45855270 CTGGGGCAGGGGCTGGAGCTGGG - Intronic
1157425260 18:47579250-47579272 GAGGGAGAGGAGGAGGAGCTGGG + Intergenic
1157513277 18:48293996-48294018 TTGGGTGAGGTGCTGGAGCTTGG + Intronic
1159250191 18:65865951-65865973 CAAGGTGAGGAGGTGGAGATGGG + Intronic
1160276537 18:77442775-77442797 CAGGGAGGGGTGCTGGAGCCTGG - Intergenic
1160333325 18:78015143-78015165 CAGGGAGAGGGGCTGGAGAAAGG - Intergenic
1160458931 18:79022796-79022818 CGGGTCCCGGAGCTGGAGCTGGG - Intergenic
1160536437 18:79597016-79597038 CTGGGCGAGGTGCTGGAGCCGGG - Intergenic
1160865085 19:1252802-1252824 CAGGGCGGGGGCCGGGAGCTGGG + Intronic
1160993973 19:1873400-1873422 CAGGGCCAGTGGCTGGAGCATGG - Intergenic
1161028912 19:2049045-2049067 CAGGGCCAGGAGCTCACGCTGGG - Intronic
1161153965 19:2722773-2722795 CAGGCTGAGAAGCTGGACCTTGG - Intronic
1161208386 19:3053993-3054015 CAGGGCCAGGGCCTGCAGCTGGG + Exonic
1161250175 19:3276070-3276092 CATGGGGAGGAGCTGGCTCTGGG + Intronic
1161379802 19:3958951-3958973 GAGTGGGAGGAGCTGGAGCCAGG - Exonic
1161798551 19:6402121-6402143 GAGGATGAGGAGCTGGTGCTGGG + Intergenic
1162099556 19:8331628-8331650 CAGGGCAAGCAGCTGGAGGTGGG + Intronic
1162384597 19:10353540-10353562 CTGGGCGAAGAGCAGCAGCTGGG + Exonic
1162386363 19:10362519-10362541 CAGGGCTGGGGGCTGGGGCTGGG - Intronic
1162472137 19:10878783-10878805 CGGGGGGAGGACCTGGATCTGGG - Intronic
1163023574 19:14496367-14496389 GAGGGGGGGGAGCTGCAGCTGGG + Intergenic
1163526470 19:17824576-17824598 CAAGGCCAGCAGCTGGGGCTGGG + Intergenic
1163631885 19:18421685-18421707 CAGGAAAAGGAGCTGGGGCTGGG + Intronic
1164598135 19:29543599-29543621 CAGGACAAGGAGCTGAAGCCTGG + Intronic
1164669869 19:30066434-30066456 CGGGGTGAGGAGCTGATGCTCGG - Intergenic
1164869823 19:31633412-31633434 GAGGGAGAGAAGATGGAGCTGGG + Intergenic
1165307179 19:35009987-35010009 CTGGGCTAGGAGCTGGGACTGGG - Intronic
1165486883 19:36101716-36101738 CAGGGTCAGGAGGCGGAGCTGGG - Exonic
1165763683 19:38336946-38336968 CAGGGCCAGGAGCAAGAGCAGGG + Intronic
1165763707 19:38337042-38337064 CAGGGCCAGGAGCAAGAGCAGGG + Intronic
1165792933 19:38502804-38502826 CAGGGGGAGGAGCAGGGGCAGGG + Intronic
1165903483 19:39179466-39179488 CAGGGAGAGGGTCTGGATCTGGG + Intronic
1166247179 19:41537591-41537613 CATGCCTAGGTGCTGGAGCTGGG - Intergenic
1167158773 19:47754775-47754797 CAGGGCGAGGGGCCGGAGGCTGG + Exonic
1167245553 19:48371043-48371065 CAGGGCCAGGAGCCGGACTTGGG - Intronic
1167433050 19:49464235-49464257 CTGGGGCAGGCGCTGGAGCTGGG + Exonic
1167665712 19:50821926-50821948 CAAGGCTAGGAGAGGGAGCTGGG + Intronic
1168102926 19:54150495-54150517 GAGGGTCAGGAGCTGGGGCTTGG + Intronic
1168239057 19:55080298-55080320 CTGGGGGTGGAGCTGGAACTGGG + Intronic
1168277983 19:55287536-55287558 CAGGGCGAGGAGCTGGAGCTGGG - Intronic
1168594471 19:57664340-57664362 GCGGGCGAGGAGCTGGGGCGCGG + Intergenic
1168604316 19:57746441-57746463 CAGGCCGCTGAGATGGAGCTGGG + Intronic
925010834 2:484694-484716 CAGGGTGAGGACGTGGGGCTGGG + Intergenic
925406175 2:3606585-3606607 CAGAGCAAGGAGCAGGGGCTGGG - Intronic
926105404 2:10146602-10146624 CAGAGCGAGGAGCATGCGCTGGG - Intronic
926704525 2:15827242-15827264 CAAGGAGAGGAGCTGGACCCAGG - Intergenic
927810771 2:26179192-26179214 CAGGGCCAGGGGCGGGGGCTGGG - Intronic
927915446 2:26933154-26933176 CAGGGGGAGGCGCTGGTGCCAGG + Intronic
928108621 2:28489093-28489115 CAGGGCCAGGAGATGGCTCTGGG - Intronic
928823638 2:35392218-35392240 CAGGTCTTGGAGCTGCAGCTGGG + Intergenic
929242280 2:39665682-39665704 CGGGGCGAGGAGAGGGGGCTGGG + Intronic
929545085 2:42850527-42850549 CTGGGCCAGGGGCTGGAGCTGGG - Intergenic
930107638 2:47652641-47652663 CATGGAGCAGAGCTGGAGCTAGG - Intergenic
930728933 2:54709359-54709381 CAGAGTGAGCAGCAGGAGCTGGG - Intergenic
932347953 2:71007786-71007808 CAGGCAGAGGAGCTGGGCCTAGG + Intergenic
932356592 2:71072769-71072791 CAGATCCAGGACCTGGAGCTGGG - Intronic
932763512 2:74455933-74455955 CTGGGTGAGGATCTGGAGGTGGG + Exonic
933973513 2:87489458-87489480 CAGAGGCAGGAGCTGGGGCTGGG + Intergenic
935187604 2:100748143-100748165 CAGGGGGAGGAGAGGGTGCTGGG + Intergenic
935646293 2:105337835-105337857 GGGGGCGAGGAGCAGGAGCGAGG - Intronic
936320212 2:111460755-111460777 CAGAGGCAGGAGCTGGGGCTGGG - Intergenic
937259625 2:120577134-120577156 GAAGGGGAGGAGCTGGAGCTTGG - Intergenic
937360199 2:121224300-121224322 CAGGGCTGGGAGCTGGAGACAGG + Exonic
938452196 2:131431359-131431381 CAGGCCAAGTAGATGGAGCTTGG + Intergenic
939728616 2:145754142-145754164 GAGGGGGAGGAGCTGGAGTGGGG + Intergenic
940009580 2:149039166-149039188 GAGAGCGCGGAGCTGGGGCTGGG + Intronic
942086481 2:172448968-172448990 TAAGGCCTGGAGCTGGAGCTTGG + Intronic
942229234 2:173844416-173844438 CAGGGCAAGGGGCTGGGGCTGGG - Intergenic
945471297 2:210230347-210230369 CTGGGATTGGAGCTGGAGCTTGG + Intergenic
946737598 2:222770075-222770097 CAGGGAGAAGGGCTGGAGCAGGG - Intergenic
946911921 2:224470915-224470937 CAGAGCCAGGAGTTGGACCTAGG - Exonic
947526429 2:230879303-230879325 AGGGTCGAGGAGCTGGACCTCGG + Intergenic
947626533 2:231622668-231622690 CTGGGCCTGGAGCTGGGGCTGGG - Intergenic
947720681 2:232367787-232367809 AAGGGCCAGGGGCGGGAGCTGGG - Intergenic
948005005 2:234601025-234601047 CAGGTTGAGGAGGTGGAGATGGG + Intergenic
948447740 2:238046195-238046217 GAGGTGGAGGAGCTGTAGCTGGG + Intronic
948728034 2:239946592-239946614 CATCGAGATGAGCTGGAGCTGGG - Intronic
948753086 2:240143757-240143779 CAGGGGCAGGAGCTGGGGCTGGG - Intronic
948894002 2:240919865-240919887 CAGGTCCAGCAGCTGGAGCCTGG + Intronic
948920903 2:241065473-241065495 CAGGGCCTGGAGCTGGTGCGAGG - Exonic
948984496 2:241511894-241511916 AAAGGTGAGGGGCTGGAGCTGGG + Intergenic
1169213289 20:3779167-3779189 CAGTGGGAGAAGCTGGAGCGGGG + Intronic
1169815611 20:9653045-9653067 CAGGGTGAGGAGTTGAAGCGAGG - Intronic
1170802269 20:19600193-19600215 CAGGGTCTGGAGCTGGAGCTGGG - Intronic
1170847714 20:19975895-19975917 CCGGGAGAGAAGGTGGAGCTGGG - Intronic
1171227265 20:23452011-23452033 AAGGGCAAGGAGCTGGTCCTAGG + Intronic
1171403366 20:24893248-24893270 GAGGGAGAGGAGGTGGAGGTGGG + Intergenic
1172038727 20:32028941-32028963 GAGGGCCAGGAGCTGGAGGGAGG + Intronic
1172180647 20:33001359-33001381 CTGGGGGAGGCCCTGGAGCTGGG + Intronic
1172528805 20:35616973-35616995 CAGAGGGCGGAGCTGGAGCCGGG + Intronic
1173581968 20:44153527-44153549 CATGGGGAGGAGATGGAGGTGGG + Intronic
1173821357 20:46022252-46022274 CAGAGTGAGGAGGTGGAACTAGG + Intronic
1174449972 20:50613787-50613809 GAGGGGCAGGTGCTGGAGCTGGG + Intronic
1175545369 20:59774585-59774607 CAGGTCGAGGGGCTGCACCTGGG + Intronic
1176511828 21:7754592-7754614 CAGTGAAAGGAGCTGGAGCCCGG - Intronic
1177782854 21:25639383-25639405 CAGGGCGAGGAGCTGGGGGCGGG - Exonic
1178645941 21:34385118-34385140 CAGTGAAAGGAGCTGGAGCCCGG - Intronic
1179416794 21:41204498-41204520 CACGGAGAGGGGCTGGAGCTAGG + Intronic
1179485379 21:41706714-41706736 CAGGGGAGGGAGCTGGAGGTGGG - Intergenic
1179551376 21:42146083-42146105 CAGCCCTAGGAGCTGGTGCTGGG + Intergenic
1179586192 21:42375481-42375503 CAGGCAGAGGAGCTGGGGCCCGG - Intronic
1179606402 21:42518367-42518389 CAGAGAGAGGATCTGGAGCCAGG + Exonic
1179612538 21:42561805-42561827 GTGGCCGAGGAGCTGCAGCTGGG + Intronic
1179804296 21:43827094-43827116 CAGGGCGAGCAGAAGCAGCTGGG + Intergenic
1180057587 21:45366940-45366962 TGGGGAGAGGAGCTGGAGGTTGG + Intergenic
1180066870 21:45416801-45416823 CAGGGGCAGGCGCTGGGGCTGGG - Intronic
1180077151 21:45468712-45468734 CGGGGCCTGGAGCTGGAGCCTGG + Exonic
1180167306 21:46036767-46036789 CTGGGTGAGCAGCTGGAGCGAGG + Intergenic
1180195519 21:46191416-46191438 CAGGGCGGGGAGTCTGAGCTGGG - Intronic
1180840747 22:18957776-18957798 CAAGGTGAGGAGCTGTGGCTGGG + Intergenic
1181048513 22:20227831-20227853 CAGTACCAGGAGCTGGACCTGGG - Intergenic
1181138527 22:20786592-20786614 CAGTGTGGGGAGCTGGAGCTGGG + Intronic
1181266156 22:21632262-21632284 CAGAGCCAGGAACTGAAGCTAGG + Intergenic
1181440627 22:22933630-22933652 CAGGCCTAGGAGCTGGATCAAGG + Intergenic
1181947507 22:26529505-26529527 AGGGGCTAGGAGCTGGAGATTGG + Intronic
1182148816 22:28014278-28014300 CAGGGCACGGAGCGGGGGCTTGG + Exonic
1182512650 22:30830012-30830034 CATGGGGTTGAGCTGGAGCTGGG + Intronic
1183261489 22:36798566-36798588 CAGGAGGAGGGGCTGGGGCTGGG - Intergenic
1183270957 22:36862366-36862388 CAGAGCGGGGTGCAGGAGCTGGG + Intronic
1183380288 22:37487272-37487294 CAGGGTGAGTAGCAGGAGATGGG - Intergenic
1183382166 22:37495731-37495753 CAGAGCCAGGAGCTGGGGATGGG - Intronic
1183468169 22:37990548-37990570 CTGGGCCAGGAGCTGGGACTGGG + Intronic
1183597995 22:38823654-38823676 CAGGGCCAGATGCTGGAGCCTGG - Intronic
1183740015 22:39664194-39664216 CAGGGCCAGGGGCCCGAGCTGGG - Intronic
1184205348 22:42998956-42998978 CAGGATGGGGAGCTGGAGATGGG - Intronic
1184507051 22:44910183-44910205 CAGGGCGGGGTGCTGCAGTTGGG + Intronic
1184634726 22:45817976-45817998 CAGGGTGAGAAGCTGGAAGTTGG + Intronic
1184661606 22:45967965-45967987 CTGGGTGAGGAGCTGGAACTGGG + Intronic
1184681301 22:46073667-46073689 CAGGGCCATGAGCTGGCTCTTGG + Intronic
1185014485 22:48335120-48335142 CGGGACTAGGACCTGGAGCTGGG - Intergenic
1185023341 22:48393342-48393364 CAGAGCCAGGATCTGGAGCCTGG + Intergenic
1185107378 22:48881612-48881634 CAGGAGGAGGAGCTGGGCCTGGG - Intergenic
1185389124 22:50549353-50549375 CAGGGCCACCAGCTTGAGCTGGG - Exonic
949826055 3:8167158-8167180 CAGGGAGAGGAGCTGTGGCGAGG - Intergenic
949932495 3:9089793-9089815 GAAGGCAAGGAGCTGGAGCCTGG - Intronic
949954031 3:9252674-9252696 AAGGGTGAGGACCTGGTGCTGGG - Intronic
950052740 3:10004634-10004656 CAGGGCCACGTGGTGGAGCTGGG - Intronic
950457182 3:13099778-13099800 CAGAGAGAGGAGCTGGGGGTAGG - Intergenic
951898422 3:27633058-27633080 CAGGGCCTGCAGCGGGAGCTGGG + Intergenic
952190792 3:31021196-31021218 CAGGGAGAATAGCTGGAACTTGG - Intergenic
953464365 3:43105926-43105948 CTGGGCCAGAAGCTGGCGCTGGG - Exonic
953850852 3:46464631-46464653 CATGGGGAGGAACAGGAGCTGGG - Intronic
954556263 3:51519899-51519921 CAGGGCCAGAAGTTGGGGCTGGG - Intergenic
954652336 3:52172683-52172705 CAAGGAGAGGAGAAGGAGCTGGG + Intergenic
954751913 3:52818611-52818633 CAGGATGGGGGGCTGGAGCTTGG - Exonic
954786547 3:53097297-53097319 CAGGGCCAGGCGCTGGGGCCAGG + Intronic
954808685 3:53234888-53234910 CAGGTGCAGGAGCTGAAGCTGGG - Intronic
954812393 3:53256089-53256111 CAGGGGGAGGAGGCGGGGCTCGG + Intergenic
956798991 3:72739897-72739919 CATAGCAAGGTGCTGGAGCTGGG - Intergenic
957193421 3:77039492-77039514 CGCGGCGAGGAGCAGGAGCCTGG + Intronic
958915514 3:100045921-100045943 AAGGGGGAGGAGGCGGAGCTGGG + Intronic
961195828 3:125000640-125000662 CTGGGATAAGAGCTGGAGCTTGG - Intronic
961339540 3:126208754-126208776 CTGGGCGAGGAGCTGGGACACGG + Intergenic
961641357 3:128366536-128366558 GAGGAGGAGGAGCAGGAGCTGGG + Intronic
961755865 3:129127070-129127092 CAGGGTGAGGAGCCCCAGCTAGG + Intronic
962313198 3:134340290-134340312 CATGGGGAGGAACTGGAGCGAGG - Intergenic
962344222 3:134607872-134607894 CAGGCAGAGGTGCTGGAGCTTGG + Intronic
962649337 3:137472841-137472863 AAGGGCAAGGGGCTGGAACTAGG - Intergenic
962990759 3:140575040-140575062 CATGTAGAGGAGCTGGAGGTGGG - Exonic
963338126 3:144000927-144000949 CAGGGTGAGGAGCAGTAGCAAGG + Intronic
963904740 3:150763694-150763716 CAGGGCGAGGGGCTCGAGTTGGG + Intergenic
964570763 3:158105755-158105777 CAGGCGGAGGAGCTGGAGGAGGG - Exonic
964710770 3:159669083-159669105 CCGGGGGTGGAGCTGGAGTTCGG - Intronic
965280940 3:166751813-166751835 CAGGGAGATGACCTGGGGCTTGG + Intergenic
966760475 3:183413639-183413661 CAGGGCGAGGAACTGGGTCAGGG - Intronic
966909516 3:184551215-184551237 CAGGCTGAGGAGCTTGGGCTGGG + Intronic
966912456 3:184567010-184567032 CAGGTCGAGGACCTTGAGCAGGG - Intronic
967300382 3:188006738-188006760 CAGAGGGAGCAGCTGGAGATGGG + Intergenic
968075269 3:195812716-195812738 CAGGGCAGGGAGCTGGAGCCAGG + Intergenic
968442156 4:629507-629529 CAGGGAGAGGAGCTGGAAGGTGG - Intronic
968724803 4:2241872-2241894 CTGGGCGAGGAGCTGGGGCGGGG - Intronic
969440276 4:7212862-7212884 CAGGGTGAGGAGTTGGAGGAGGG + Intronic
969583682 4:8080033-8080055 CAGGGCCAGGAGCTGGGGGTCGG - Intronic
969683814 4:8657721-8657743 TGGGGCGAGGAGCTGGAGGAAGG - Intergenic
970167384 4:13253473-13253495 CAGGGGGAGGAGTAGGACCTAGG + Intergenic
971376737 4:26061797-26061819 CAGGGCCTGGAGCTGGGCCTGGG + Intergenic
974626544 4:64433323-64433345 GAGGGGGAGGGGCAGGAGCTTGG + Intergenic
975585101 4:75941015-75941037 GAGGAGGAGGAGCTGGGGCTGGG + Exonic
978454139 4:108869284-108869306 TAGGGCAAGTAGCTGGATCTCGG - Intronic
979765756 4:124462827-124462849 CAGGGTGAGGGGCTGGGCCTCGG + Intergenic
983184218 4:164682524-164682546 CATTGCCAGTAGCTGGAGCTAGG - Intergenic
983990186 4:174108604-174108626 CAGGAAGAGGGGCTAGAGCTTGG + Intergenic
985489516 5:171211-171233 CAGGACAAGCAGCGGGAGCTAGG + Exonic
986775428 5:11009401-11009423 GAGGGAGAAGAGATGGAGCTGGG + Intronic
987135032 5:14892414-14892436 CAGGTGGAGGAGCTGAACCTTGG + Intergenic
989552443 5:42751630-42751652 CAGAGCCAGGATCTGAAGCTAGG + Intergenic
991927477 5:71719385-71719407 CAGGGCTCGGGGCTGGAGCTCGG - Exonic
995862095 5:116651728-116651750 CAGGGAGAAGAGCAGGCGCTTGG - Intergenic
997262731 5:132476810-132476832 TGGGGAGAGGAGCTGGAGTTGGG - Intergenic
997262738 5:132476834-132476856 TGGGGAGAGGAGCTGGAGTTGGG - Intergenic
998166489 5:139847360-139847382 CTAGGCTTGGAGCTGGAGCTGGG - Intronic
998350356 5:141496355-141496377 CAGGGAGAGAAGCAGGAGCTTGG + Intronic
998390227 5:141782785-141782807 CAGGGCTAAGAGGTGCAGCTGGG + Intergenic
999375983 5:151086884-151086906 CTGGGTGAGGAGCAGGGGCTGGG + Intronic
1001014496 5:168127985-168128007 CAGGGCTAGGAGCTTGCGCAGGG + Intronic
1001702773 5:173719727-173719749 CAGGGCGAGGAGCTTGACCCAGG + Intergenic
1001777931 5:174343212-174343234 GAGGGTGAGGAAGTGGAGCTAGG - Intergenic
1001823703 5:174729228-174729250 CAGGGCGAGGAGCTGGGATGTGG - Exonic
1002021460 5:176366425-176366447 CAGCGCGAGGTGCTGGTGCTGGG + Exonic
1002093559 5:176818093-176818115 CAGGGGCAGGGGCTGCAGCTGGG - Intronic
1002276621 5:178108125-178108147 CAGGAGGAGGAGCTGAAGCAAGG - Intergenic
1002644423 5:180646186-180646208 CTGGGAGAGGAGCAGGACCTTGG - Intronic
1003145402 6:3505992-3506014 TAGGGAGAGGAGATGGTGCTGGG + Intergenic
1005117673 6:22356429-22356451 CAGGGCGTGGAGCAGGGGGTGGG + Intergenic
1005681484 6:28212751-28212773 CAGGGCGGCCAGCTGGAGCCGGG + Intergenic
1006143629 6:31945552-31945574 CAGGCCAAGGAGCGGGAGGTGGG - Exonic
1006392391 6:33766157-33766179 CAGGGCATGGTGCTGCAGCTGGG - Intergenic
1006423665 6:33950677-33950699 CAGGGCCAGGAGGAGGGGCTGGG + Intergenic
1006429692 6:33988146-33988168 CAGGACCAGGAGAAGGAGCTTGG - Intergenic
1006934773 6:37709810-37709832 CACTGTGGGGAGCTGGAGCTCGG - Intergenic
1007104904 6:39276978-39277000 CAGAGTGAGGAGCTGGGCCTGGG - Intergenic
1007156922 6:39753845-39753867 CAGATAGAGGAGCTTGAGCTGGG - Intergenic
1007614457 6:43171909-43171931 TCGGGCGAGGAGGAGGAGCTGGG + Exonic
1007620721 6:43212918-43212940 CAGGGCTAGGCGCTGGGTCTAGG + Intronic
1012930321 6:105309670-105309692 GAGAGCAAGGAGCTGGTGCTTGG + Intronic
1014092385 6:117418487-117418509 CAGGGCCAGCAGCTTGACCTTGG - Exonic
1015286436 6:131490724-131490746 AAGGGAGAAGAGCTGGAGATTGG + Intergenic
1015776828 6:136822851-136822873 GAGCGCGAGGAACTGGAGCCCGG - Intronic
1017293947 6:152772941-152772963 CAGGAGTAGGTGCTGGAGCTGGG + Intergenic
1017407945 6:154140005-154140027 GAGGGCGGGGAACTGGAGATGGG - Intronic
1018005382 6:159617312-159617334 ATGGGCAAGGAGCTGCAGCTGGG + Intergenic
1018706492 6:166467472-166467494 CTGGGAGAGGAGCTGCAGTTTGG + Intronic
1019618870 7:1979847-1979869 CAGGGGGCGGCGCTGGAGCCGGG - Intronic
1019783687 7:2959673-2959695 CAGGGCCAGGGGTTGGGGCTGGG + Intronic
1019923940 7:4180176-4180198 CTGGGCATAGAGCTGGAGCTGGG - Intronic
1019923951 7:4180226-4180248 CTGGGCATAGAGCTGGAGCTGGG - Intronic
1019923994 7:4180426-4180448 CTGGGCATAGAGCTGGAGCTGGG - Intronic
1019924000 7:4180451-4180473 CAGGGCATAGAGCTGGAGCCGGG - Intronic
1020392588 7:7674506-7674528 CAGGGACAGGAGCAGTAGCTGGG + Intronic
1021085884 7:16421004-16421026 CAGGGCGGGGAGCGGGAGGCCGG + Intronic
1021742081 7:23696970-23696992 CAGGGGGCAGAGCTGGAGGTGGG + Intronic
1022334062 7:29406245-29406267 CAGGGAGAGGAGGAGAAGCTGGG + Intronic
1023758747 7:43444544-43444566 CTGGCCGAGCAGCTGGACCTGGG + Exonic
1024095034 7:45976393-45976415 CAGGGCTGGGAGGTGGAGATAGG + Intergenic
1027224675 7:76236446-76236468 GGGGGCGGGGAGCTGGAGCCTGG + Intronic
1027265727 7:76494258-76494280 GAGGGAGAGGAGCTGGAGTGGGG + Intronic
1027317098 7:76992375-76992397 GAGGGAGAGGAGCTGGAGCGGGG + Intergenic
1027319434 7:77002826-77002848 CAGGGAGAGCAGCTGGGGGTCGG - Intergenic
1028093075 7:86727290-86727312 CTGGGAGAGGAGCTATAGCTAGG - Intronic
1028984570 7:96999331-96999353 TAGGGCCAGGAGGTGGAGATGGG - Intergenic
1029441928 7:100591599-100591621 GAGGGAGATGAGTTGGAGCTTGG - Intronic
1029479078 7:100802190-100802212 CTGGGGCAGGAGCTGGAGCAGGG - Intergenic
1029657602 7:101937219-101937241 CAGGGGGAGGAGCTGGGGGCTGG - Intronic
1031528470 7:122849925-122849947 CTGGGCCAGGAGCTGGGGCCTGG - Intronic
1032718015 7:134527530-134527552 CAGTGGGAGGAGTTGGAGCCTGG - Intergenic
1032722636 7:134563235-134563257 CAGTGGGAAGAGCTGGAGCCTGG - Intronic
1033152188 7:138925066-138925088 CAGGGCGAGGTGCAGGTGCCTGG - Intronic
1033890439 7:146006416-146006438 CAGGGGGAGGAGAAGGAGCAGGG - Intergenic
1034184102 7:149161115-149161137 CAGGGTGAGGAGGTGGTGGTGGG - Intronic
1034418817 7:150978470-150978492 CAGAGCGAGGGGCTGGCGTTGGG - Intergenic
1035049839 7:155992364-155992386 CAGGGGGAAGCACTGGAGCTGGG + Intergenic
1035212162 7:157336791-157336813 CAGGGCGAGGGGGCGGAGCTCGG - Intronic
1035375634 7:158404990-158405012 GAGGCCGAGGAGCTGGAGGCTGG - Intronic
1035579207 8:729374-729396 CAGGAGGAGGGGATGGAGCTTGG - Intronic
1035784603 8:2250773-2250795 CAGGGGGAGTGGCTGGTGCTGGG + Intergenic
1035808204 8:2470940-2470962 CAGGGGGAGTGGCTGGTGCTGGG - Intergenic
1036436955 8:8743506-8743528 CAGGGCCAGGAGCAGCGGCTGGG - Intergenic
1036644126 8:10601495-10601517 CAGGGCTGGGAGCTGGGGGTGGG + Intergenic
1037763430 8:21757043-21757065 TAGGGCCAGGAGCTGGAGGTTGG - Intronic
1037859210 8:22392798-22392820 CAGGCCCAGGCGCTGGAGCCAGG - Intronic
1038430877 8:27498330-27498352 CAGGAAGAGGAGCTGGAGCTAGG + Intronic
1039913663 8:41844210-41844232 CAAGGTGAGGAGCTGGACCAGGG - Intronic
1040522910 8:48193234-48193256 GAGGAGGAGGAGCAGGAGCTGGG + Intergenic
1041314530 8:56547227-56547249 CAAGCCGAGGAGCTGGAACCTGG - Intergenic
1041326167 8:56667661-56667683 CAGGAGTAGCAGCTGGAGCTGGG - Intergenic
1045005322 8:97912396-97912418 CAGCGAGAGCAGCTGGAGCCGGG + Intronic
1047115083 8:121832916-121832938 CAGGGCAGGCAGCTTGAGCTGGG + Intergenic
1047427000 8:124755532-124755554 CAGGGCCCGAAGCTGGACCTGGG + Intergenic
1048063662 8:130946547-130946569 CAGGGCGAGAAGCTTGAGTTGGG - Intronic
1048151786 8:131901795-131901817 CCGGGACAGGAGCTGAAGCTGGG - Intergenic
1049107985 8:140625460-140625482 CAGGGTCAGGGGCTGGGGCTGGG - Intronic
1049203551 8:141353050-141353072 CAGGGCAAGGACGTGGAGGTGGG - Intergenic
1049294397 8:141823437-141823459 CAGGGAGTGGAGATGGAGCATGG - Intergenic
1049432938 8:142573688-142573710 CAGGGAGATGAGCTGGGCCTGGG + Intergenic
1049515029 8:143049748-143049770 CAGTGCGAGCAGCTCCAGCTGGG - Intronic
1049646672 8:143738763-143738785 CAGGGCCAGGAGCTGCATCCTGG + Intergenic
1049686866 8:143942552-143942574 CAGTGCGGGGAGCTGGACCGCGG + Intronic
1049719815 8:144110612-144110634 CAGGGTCAGGAACCGGAGCTGGG - Intronic
1053410233 9:37911588-37911610 CAGGGGCTGGAGCTGGGGCTGGG - Intronic
1053410236 9:37911594-37911616 CAGGGTCAGGGGCTGGAGCTGGG - Intronic
1054366106 9:64343454-64343476 CAGGGTGTGGAGCTGGAGTGAGG + Intergenic
1055187494 9:73474260-73474282 GAGGGGGAGGGGCAGGAGCTTGG - Intergenic
1057168381 9:92945886-92945908 CAGAGCAATGAGCGGGAGCTGGG + Intergenic
1057485317 9:95478327-95478349 CAGGGAGAGAAGCTGAAGTTGGG + Intronic
1057805953 9:98220174-98220196 GAAGTGGAGGAGCTGGAGCTGGG - Intronic
1057814672 9:98285785-98285807 CAGGGAGAGGAGGTGGTACTGGG - Intergenic
1059088766 9:111334140-111334162 CAGGGAGGGGAGCCGGAGCAGGG + Intergenic
1060527198 9:124327312-124327334 CAGGGCGAGGAGAAGGAGATTGG - Intronic
1060544130 9:124450507-124450529 GCGGGTGAGGAACTGGAGCTGGG + Intergenic
1061252014 9:129431999-129432021 CTGGGCCTGGAGCTGGGGCTAGG + Intergenic
1061255530 9:129452870-129452892 CAGGGCCAGGCCGTGGAGCTGGG - Intergenic
1061282560 9:129605890-129605912 GAGGCCGAGGGGCTGGAGCGAGG - Intergenic
1061497943 9:130986369-130986391 CCAGGCGAGCAGCTGGAGCCAGG + Intergenic
1061500154 9:130997379-130997401 CAGGGAGAGGGGTTGGAGGTTGG + Intergenic
1061613785 9:131765944-131765966 CAGGGCTGGGAGCAGGAGGTCGG - Intergenic
1061725303 9:132579286-132579308 CAGGGTGGGGACCTGGGGCTGGG + Intergenic
1061781043 9:132996256-132996278 CATGGTGAGCAGCTGGGGCTGGG - Intergenic
1062098843 9:134717505-134717527 CAGCGCTAGGGTCTGGAGCTGGG - Intronic
1062217771 9:135398595-135398617 CTGGGAGAGGAGCTGTAGGTGGG + Intergenic
1062250541 9:135591683-135591705 CAGGCCGAGGAGCGGGAGTTGGG + Intergenic
1062262994 9:135672109-135672131 CAGGAAGTGGCGCTGGAGCTGGG - Intergenic
1062308025 9:135920542-135920564 CAGGACTAGGAGCTGCACCTGGG + Intergenic
1062351969 9:136143742-136143764 CAGGGTGAGGAGCTTGGGTTGGG - Intergenic
1062354535 9:136155526-136155548 CAGTTTGAGGAGCAGGAGCTGGG - Intergenic
1062540821 9:137040942-137040964 CGGGGGCAGGGGCTGGAGCTGGG - Exonic
1062588944 9:137264335-137264357 AAGGGCCAGGAGCAGGTGCTGGG + Exonic
1062592875 9:137281832-137281854 CAGGGCTAGGGGAAGGAGCTGGG + Exonic
1185603497 X:1354634-1354656 GAGGGGGAGGAGGTGGAGATGGG + Intronic
1185603523 X:1354723-1354745 GAGGGGGAGGAGGTGGAGATGGG + Intronic
1187273798 X:17801498-17801520 CAGGTCCAGGAGCTGGGGCTGGG + Exonic
1189219366 X:39357861-39357883 CAGGGAGAGGAGCTGAAGATAGG + Intergenic
1189328136 X:40125621-40125643 CAGGTGGAGGAGTTGAAGCTGGG - Intronic
1189491457 X:41474286-41474308 CAGGTAGAGCAGCTCGAGCTCGG - Exonic
1189875675 X:45433703-45433725 CAGGGCCAAGACCTGGAACTAGG + Intergenic
1190550046 X:51570609-51570631 CTGGGGGAGGAGATGGAGTTTGG + Intergenic
1192358382 X:70423722-70423744 AGGGGTGAGGAGCTGGAGCTGGG - Intronic
1192456846 X:71283354-71283376 AAGGGAGAGGAGCTGGGGGTGGG - Intronic
1195410971 X:104567427-104567449 CTGGGAGAGCAACTGGAGCTGGG + Intronic
1195577573 X:106468243-106468265 CTGGGAGAGGAGGAGGAGCTGGG - Intergenic
1197715359 X:129702375-129702397 CAGGGCCAGGAGTCGGACCTGGG - Intergenic
1198033627 X:132779934-132779956 CAGTGGGTGGAGCTGGAGCTAGG - Intronic
1198212818 X:134531004-134531026 CAGGGGGATGACCTGGAGCAGGG - Intergenic
1198957477 X:142148583-142148605 GAGGAGGAGGAGCAGGAGCTTGG + Intergenic