ID: 1168280271

View in Genome Browser
Species Human (GRCh38)
Location 19:55302010-55302032
Sequence CATCCTGCCCCCGGTGGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 160}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168280265_1168280271 1 Left 1168280265 19:55301986-55302008 CCACTAGAGGGCGATGTAATATG 0: 1
1: 0
2: 0
3: 2
4: 30
Right 1168280271 19:55302010-55302032 CATCCTGCCCCCGGTGGGGTGGG 0: 1
1: 0
2: 0
3: 11
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168280271 Original CRISPR CATCCTGCCCCCGGTGGGGT GGG Intronic
900173655 1:1282398-1282420 CATCCTGCCCCAAGTGGTGCTGG - Intronic
900291929 1:1927335-1927357 CATTCTGCACCCGGGGGGCTGGG + Intronic
901632558 1:10655032-10655054 CTTCCTGGCCCAGCTGGGGTGGG - Intronic
901873102 1:12149987-12150009 CTTCCTGCCCCCGGAGTTGTTGG - Intergenic
901925801 1:12565292-12565314 CATCCTGCCCCTTGGGGGTTTGG + Intergenic
901931063 1:12596259-12596281 GAGGCTGCCCCCGGAGGGGTGGG - Intronic
902747428 1:18482957-18482979 CTTGCTGCCCCCGGTGGGGCCGG - Exonic
902878411 1:19354827-19354849 CATCCTGCCACCTGGGGAGTGGG - Intronic
903813455 1:26047199-26047221 CTTCCTGTCCCCAGTGGTGTGGG - Intergenic
906289513 1:44610647-44610669 CAGCCTGCCTCTGGTGGGCTCGG + Intronic
907319035 1:53591293-53591315 CCTCTTGCCTGCGGTGGGGTGGG - Intronic
910551307 1:88478469-88478491 CATGGTGTCCCCTGTGGGGTAGG - Intergenic
912409176 1:109467573-109467595 CATCCAGGCCCTGGTGGGTTTGG - Intronic
913317793 1:117567254-117567276 TATTCTGCCCCAGGAGGGGTTGG + Intergenic
915973747 1:160371538-160371560 TCTCCTGCCCCTGGTGGGGATGG + Exonic
919896029 1:202010355-202010377 CATCCCGCACCCTCTGGGGTTGG - Exonic
922473520 1:225890706-225890728 CCTCCTGCCCCTGGTGGGCCAGG + Intronic
924772314 1:247088629-247088651 CTTCCTGCAGCCGTTGGGGTGGG - Intergenic
1069081668 10:64095028-64095050 CATCATGCCACCTGTGGGGTGGG + Intergenic
1069959665 10:72072386-72072408 CAGCCAGGCCCCGGTGGGGATGG - Intronic
1070680593 10:78446355-78446377 CATCCTGCTCCAGGTTGGATGGG - Intergenic
1071292043 10:84195287-84195309 CACTCCGCCCCCGGTGGGCTCGG - Intronic
1071997128 10:91160590-91160612 CATCCTGCCCAGGGAGGAGTAGG + Intergenic
1073180225 10:101579021-101579043 CATCCGGCACCCTCTGGGGTAGG - Exonic
1075337047 10:121616089-121616111 CTTCCTGCCCCATGTGGTGTTGG - Intergenic
1075949184 10:126462543-126462565 CATCCATCACCAGGTGGGGTTGG + Intronic
1081870878 11:46381996-46382018 CACGCGGCCCCCGGTGGGGAAGG + Intronic
1083464409 11:62835523-62835545 CATTCCGCACCTGGTGGGGTGGG + Exonic
1084190165 11:67495067-67495089 CATCCTGCGCCAGGTGGGCCTGG - Exonic
1085321165 11:75574891-75574913 CATCCTGACTCAGGTGGGGAGGG + Intergenic
1088522383 11:110712900-110712922 CACCCTATCCCCAGTGGGGTGGG - Intronic
1096478148 12:51921155-51921177 CATCCTGTCCCGGGAGTGGTAGG - Intronic
1099012663 12:77310149-77310171 CATCCTGCCCACTGAGGGGAAGG - Intergenic
1102915725 12:116750356-116750378 CTGCCTGCAGCCGGTGGGGTGGG + Intronic
1103261507 12:119593216-119593238 CCCCCTCCCCCAGGTGGGGTGGG - Intergenic
1104097408 12:125570099-125570121 CATACTGCCCGGGGTGGAGTAGG - Intronic
1104537406 12:129631053-129631075 CATCCTACCCCATATGGGGTAGG - Intronic
1106115124 13:26811284-26811306 CATCCTTCCCCCAGTCTGGTGGG + Intergenic
1112333163 13:98492538-98492560 CATCCTGCCCACCTGGGGGTGGG - Intronic
1112593846 13:100789675-100789697 CATCCTGCCCCAGCTGGTCTAGG - Intergenic
1118473002 14:66092945-66092967 CATGCTGGCTCCAGTGGGGTGGG + Intergenic
1118700031 14:68424056-68424078 CATCTTGCCCACAGTGGGGATGG + Intronic
1118713100 14:68538792-68538814 CAGCCTGCCCTGGGTGGGGCTGG + Intronic
1122160615 14:99781490-99781512 CATCCTCCCAGCTGTGGGGTGGG - Intronic
1124115861 15:26842680-26842702 CACCCTTCCCCCGGTGGTGGGGG + Intronic
1124115889 15:26842768-26842790 CACCCTTCCCCCGGTGGTGGGGG + Intronic
1124115904 15:26842812-26842834 CACCCTTCCCCCGGTGGTGGGGG + Intronic
1124115919 15:26842856-26842878 CACCCTTCCCCCGGTGGTGGGGG + Intronic
1124115933 15:26842900-26842922 CACCCTTCCCCCGGTGGTGGGGG + Intronic
1124115960 15:26842988-26843010 CACCCTTCCCCCGGTGGTGGGGG + Intronic
1124115987 15:26843076-26843098 CACCCTTCCCCCGGTGGTGGGGG + Intronic
1126777504 15:52112436-52112458 CACTCTGCCCCAGGTGGGGCCGG + Exonic
1128525154 15:68407262-68407284 AATCCTGTCCCCAGTGAGGTTGG - Intronic
1129473664 15:75768783-75768805 CATCTTGGCCCCAGTGGGTTGGG - Intergenic
1132972760 16:2696954-2696976 CATTCTGCCCCTAGTGGGATTGG + Intronic
1134106248 16:11487495-11487517 CATCCTGGCCAGGGAGGGGTGGG - Intronic
1136143416 16:28301473-28301495 CAGACTGCCCCTGGTGGGGAGGG + Intronic
1138374091 16:56550720-56550742 CTTCCTGCTTCCTGTGGGGTTGG + Intergenic
1141298954 16:82795414-82795436 CAACCTGGGCCCGGAGGGGTCGG + Intronic
1141720380 16:85752264-85752286 CATCCTGCCTCCGGAGGGTGGGG - Intergenic
1142678782 17:1533128-1533150 CTCCTTGCCCCAGGTGGGGTTGG - Intronic
1144497396 17:15757238-15757260 CACCGTGGCCCCGGTGGGGAGGG - Intergenic
1144629188 17:16861722-16861744 CACCGTGGCCCCGGTGGGGAGGG - Intergenic
1144961848 17:19048914-19048936 CATCCTGTCACCCTTGGGGTCGG - Intergenic
1144973313 17:19125608-19125630 CATCCTGTCACCCTTGGGGTCGG + Intergenic
1145160758 17:20572287-20572309 CACCATGGCCCCGGTGGGGAGGG - Intergenic
1146831152 17:36070578-36070600 CATCCTCCCTCCCGAGGGGTGGG - Intronic
1147210708 17:38870956-38870978 CAGCCTGAGCCGGGTGGGGTTGG + Intronic
1147988304 17:44318923-44318945 CATCCTGCCCCTGGCGTGCTCGG - Intergenic
1148237806 17:45981110-45981132 CACCTTGCCTCCGATGGGGTCGG + Intronic
1150718017 17:67588491-67588513 CTTCGTGCCCTGGGTGGGGTGGG - Intronic
1151650826 17:75468433-75468455 CATCCAGCCCCTGCTGGGATGGG + Intronic
1152160784 17:78667330-78667352 CGTCCTGCCCTGGGTGGGGCAGG - Intergenic
1152581433 17:81166968-81166990 CAGCCTGCCCCCGTGGGAGTCGG + Intergenic
1156787780 18:40936547-40936569 CATCTTGCCACCTGTGTGGTAGG - Intergenic
1162208805 19:9075679-9075701 CAGCCAGGCCCAGGTGGGGTGGG - Intergenic
1162951590 19:14074508-14074530 CGTCCTGGCACCGGAGGGGTGGG - Intronic
1163155831 19:15439508-15439530 CATCCTCCTCCCAGTGGGGATGG + Intronic
1164476213 19:28577886-28577908 CATCGTGCCCCCGGAGCGGAAGG + Intergenic
1164595032 19:29526787-29526809 CAGCCTGGGCCCGGAGGGGTAGG + Intronic
1165247184 19:34504526-34504548 CTCCCTGCCCCTGTTGGGGTGGG + Exonic
1166859654 19:45802311-45802333 CAGCCTGCCTCCTGTGGGGGAGG + Intronic
1166947092 19:46404087-46404109 CCACCTGCCCCCTGCGGGGTAGG - Intergenic
1167045175 19:47045459-47045481 CTTCCTGCCGCCGGTGGTGCGGG + Exonic
1167428940 19:49443311-49443333 GATGCGGCCCGCGGTGGGGTGGG + Intergenic
1168147927 19:54430034-54430056 GGTCCTGCCCAGGGTGGGGTGGG + Intronic
1168280271 19:55302010-55302032 CATCCTGCCCCCGGTGGGGTGGG + Intronic
925636009 2:5941954-5941976 CGTCCTTCCCGTGGTGGGGTAGG - Intergenic
927721734 2:25387525-25387547 CCTCCTGCCCCCGGTGTGCCTGG - Intronic
927741154 2:25570709-25570731 GATCCTGCCTCCAGTGAGGTGGG - Intronic
929576865 2:43057481-43057503 CATCCTGCCCCAAGGGGGCTGGG + Intergenic
930020110 2:46996567-46996589 CATCCTGCCTCAGCTGGGGCTGG + Intronic
934526213 2:95053292-95053314 CATCCAGCCCCACGTGGCGTAGG - Intronic
937318916 2:120949065-120949087 CATCCTGCCACGGGATGGGTGGG - Intronic
938070617 2:128306404-128306426 CATCGTGGCCAGGGTGGGGTGGG - Intronic
938491469 2:131763431-131763453 CACCAGGCCCCAGGTGGGGTGGG - Intronic
938496093 2:131798892-131798914 CACCAGGCCCCAGGTGGGGTGGG + Intronic
938901803 2:135804757-135804779 CATCCAGCCCCAGGTATGGTGGG - Exonic
948452146 2:238082427-238082449 CACCCTGCCCCATGTGGGCTGGG - Intronic
948697941 2:239742781-239742803 CCTCCTGCTCCCGGGAGGGTGGG + Intergenic
948806854 2:240456755-240456777 AATCCTGCCCCCACGGGGGTGGG + Intronic
1168959293 20:1857727-1857749 CATCCTGCCCCCGTTCTGCTAGG - Intergenic
1171414650 20:24969460-24969482 CATCATGGCCGGGGTGGGGTGGG - Intronic
1172288368 20:33757254-33757276 CACCGTGCCCCCGGTGGCGCTGG - Exonic
1172691452 20:36793296-36793318 CATGCTCCCCCAGGTGGGGAAGG - Exonic
1176061806 20:63175817-63175839 CACCCTGCCCCAGGTGGAGCCGG + Intergenic
1178489459 21:33039750-33039772 CATCCTGACCCAGGCGGGGCAGG - Intergenic
1181275972 22:21687824-21687846 CATCCTGGCCACCGTGGGATGGG - Intronic
1182518077 22:30870233-30870255 CAGCCTTCCCAGGGTGGGGTGGG - Intronic
1183198941 22:36372754-36372776 GTTCGTGCCCTCGGTGGGGTGGG + Intronic
1183334061 22:37236706-37236728 CATCCTTCCTCCGTGGGGGTGGG - Intronic
1183376349 22:37467677-37467699 CAGCCTTCCCTGGGTGGGGTGGG + Intergenic
1183487630 22:38097896-38097918 CAGCCAGCCCCTGGTGGGGTGGG - Intronic
1184664280 22:45979026-45979048 CTTCCGGCCCGAGGTGGGGTCGG + Intergenic
1184893651 22:47394427-47394449 CAACCTGCTCCAGGTGGGGAAGG - Intergenic
950144193 3:10636077-10636099 CATCTTGACCCCTGTGGGGTCGG - Intronic
952945396 3:38475406-38475428 CATCCTGCACCAGGTGGCCTAGG - Intronic
960293230 3:115912397-115912419 CCTCCTCCTCCCAGTGGGGTTGG - Intronic
963615035 3:147525936-147525958 CATCCTGCAGCCTGTGGGTTGGG + Intergenic
965653711 3:170961181-170961203 CACCCTACCCCCATTGGGGTAGG - Intergenic
968433809 4:575144-575166 CATCCTGTCCCCGGAGGAGTCGG - Intergenic
968472447 4:788276-788298 GAGACTGCCCTCGGTGGGGTTGG - Intronic
970959777 4:21858041-21858063 CATGCTGGCTGCGGTGGGGTGGG - Intronic
978945776 4:114494384-114494406 CATCCTGCCCCCTGTGAAGAAGG - Intergenic
980229509 4:130031201-130031223 CGCCCTGCCCCCGGTGTGTTTGG + Intergenic
980958840 4:139454490-139454512 CGACCAGCCCACGGTGGGGTTGG - Intronic
983577154 4:169271444-169271466 CCTCCTCCCCCCGGCGGGGCTGG + Intergenic
984943826 4:184955805-184955827 CACCCAGCCTCCCGTGGGGTGGG - Intergenic
985635569 5:1034160-1034182 GATCCTTCCCCCTGTGGAGTTGG + Intronic
990210741 5:53480031-53480053 TATCCCGCCCCGGGTCGGGTCGG - Intergenic
992070662 5:73145551-73145573 CAACTTGCCCTCAGTGGGGTTGG - Intergenic
998548583 5:143053480-143053502 CATCCTGTCCCTGGTGAGGCAGG - Intronic
999200134 5:149810388-149810410 CATGCTGCCGAAGGTGGGGTGGG + Intronic
1000210086 5:159100488-159100510 CATCCCGCTCCCGGTGGCGCAGG + Intergenic
1001084798 5:168692804-168692826 CATCCAGCCCCTGGTCAGGTGGG + Intronic
1001933192 5:175687419-175687441 CAGCCTGCCCTGGGTGGGGTGGG + Intergenic
1002524516 5:179807544-179807566 GGCCCTGCCCCCGGTGGTGTAGG + Intronic
1006904157 6:37521759-37521781 AATTCTGCCCCTGGTGTGGTGGG + Intergenic
1007200948 6:40108728-40108750 CATCCTGCCCCATGTGGGGCTGG - Intergenic
1007521238 6:42452873-42452895 CACCCTGGCCTCGGTGGGGCTGG + Intergenic
1011729028 6:90241379-90241401 CAGCCTGCCCCCTGTTGAGTAGG - Intronic
1015772498 6:136783598-136783620 CATCTTGCCCCAGGTGGAGCGGG + Intronic
1017906408 6:158760028-158760050 CATCCTTCTCCCAGTGGGGTGGG - Intronic
1018949561 6:168370478-168370500 CCTCCTGCCCGCGGTCGGGCTGG + Intergenic
1019285279 7:220154-220176 CATGCTGCCCTCGCTGTGGTGGG + Intronic
1019693687 7:2432620-2432642 CATCCTGCCCCGGGCGGGCTGGG - Exonic
1020103244 7:5407336-5407358 TCTCCTGCCCCAGGTGGGGCAGG - Intronic
1023025779 7:36048566-36048588 TCTCCTGCCCTCAGTGGGGTGGG + Intergenic
1024063263 7:45714253-45714275 CATCCTTCCCTCCGTGGCGTAGG + Exonic
1024219079 7:47273744-47273766 CATCCTGTCCCCAGGGAGGTAGG - Intergenic
1025003172 7:55335219-55335241 CATTCTGCCCCCGCTGCTGTAGG - Intergenic
1026956161 7:74377514-74377536 CTTCCTGGCCCTGGTGGAGTGGG - Intronic
1029544216 7:101201947-101201969 CGTCCCGCCCGCAGTGGGGTCGG - Intergenic
1030216082 7:107044888-107044910 CATCCTGCCTCCGGGGCGGCAGG - Exonic
1035641601 8:1188661-1188683 CTTCCTGCCCCCGGAGTGCTGGG - Intergenic
1035744594 8:1952581-1952603 CATCCTGCCCCTGGCGGATTTGG + Intronic
1037755921 8:21710021-21710043 CATCCAGACCCAGGTGGGGCTGG + Intronic
1039554214 8:38465562-38465584 TATCCTACCCCCAGTGGGTTAGG - Intronic
1039985690 8:42445798-42445820 CTTCCTGCCGCAGGTGGGCTGGG - Intronic
1045394627 8:101748529-101748551 CACCCTGCCCATGGTGGGCTTGG + Intronic
1045459442 8:102412915-102412937 CATCCCACCCCCGGCGGGGCTGG - Intergenic
1049451444 8:142664258-142664280 CCTCCTGCCTCAGGTGGGGTCGG + Intronic
1049692594 8:143969164-143969186 CACCCTCCCCCCGCTGGAGTCGG - Intronic
1053368103 9:37538059-37538081 CATCCAGACCCCAGTGGGGAGGG - Intronic
1056820314 9:89836951-89836973 GATCCTGCCTCTGGCGGGGTGGG + Intergenic
1062625946 9:137441569-137441591 CGCCCCGCCCCCGGGGGGGTGGG + Intronic
1187900978 X:24026017-24026039 CATCTTGGCCACGGTGGGGGTGG + Intronic
1190868168 X:54402123-54402145 CATACTTCCCCCTGTGTGGTAGG - Intergenic
1195065361 X:101234379-101234401 CATCCTGGCCCTGGTGTGGCAGG + Intronic
1197068796 X:122267739-122267761 CATGCTGCTCCTGCTGGGGTTGG + Intergenic
1198808404 X:140510523-140510545 CATCCTGCGCCCCCTGTGGTTGG - Intergenic
1199684789 X:150256387-150256409 CTTCCTGCCCCAGGTGGGGCTGG - Intergenic