ID: 1168282139

View in Genome Browser
Species Human (GRCh38)
Location 19:55311619-55311641
Sequence CCTAAAGTCAGGCCCGGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 131}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168282135_1168282139 -6 Left 1168282135 19:55311602-55311624 CCAGAATCTGAGAGTCTCCTAAA 0: 1
1: 0
2: 1
3: 10
4: 185
Right 1168282139 19:55311619-55311641 CCTAAAGTCAGGCCCGGCCCAGG 0: 1
1: 0
2: 0
3: 6
4: 131
1168282134_1168282139 14 Left 1168282134 19:55311582-55311604 CCTAGCGAACAGTATCATAACCA 0: 1
1: 0
2: 0
3: 5
4: 78
Right 1168282139 19:55311619-55311641 CCTAAAGTCAGGCCCGGCCCAGG 0: 1
1: 0
2: 0
3: 6
4: 131
1168282133_1168282139 29 Left 1168282133 19:55311567-55311589 CCTGGCAGGCTGTTTCCTAGCGA 0: 1
1: 0
2: 0
3: 8
4: 73
Right 1168282139 19:55311619-55311641 CCTAAAGTCAGGCCCGGCCCAGG 0: 1
1: 0
2: 0
3: 6
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168282139 Original CRISPR CCTAAAGTCAGGCCCGGCCC AGG Intronic
900134531 1:1109825-1109847 CCAAAGGTGAGGCGCGGCCCGGG + Intronic
902761920 1:18586762-18586784 CCTAGAGCCAGGCACGGGCCTGG + Intergenic
903021280 1:20396990-20397012 CCTGAACTCAGTCCCTGCCCTGG - Intergenic
903180311 1:21601911-21601933 CCTATACTCAGGGCCAGCCCTGG + Intronic
904246896 1:29194334-29194356 CCTAAAGACAGGCAGGGACCAGG - Intronic
904252699 1:29236461-29236483 GCTGACGTCAGGCCCGGCCGCGG - Intergenic
904384858 1:30134593-30134615 CCTGAATCCTGGCCCGGCCCTGG + Intergenic
905440830 1:37995970-37995992 CCTGCAGCGAGGCCCGGCCCTGG - Intergenic
905648268 1:39639674-39639696 CGGGAAGTCAGGCCCCGCCCCGG + Exonic
907334976 1:53693971-53693993 CCCACCGTCAGGCCTGGCCCAGG - Intronic
912413199 1:109491666-109491688 CAAGAAGCCAGGCCCGGCCCTGG + Exonic
914919565 1:151838294-151838316 CCGAATATCAGGCCGGGCCCGGG - Exonic
919742278 1:200988394-200988416 CCCAAATTCAGGCTCAGCCCTGG + Intronic
920743637 1:208604936-208604958 CCTAAACTCAGTCTGGGCCCAGG - Intergenic
922602011 1:226863574-226863596 CCTGAACTGAGGCCAGGCCCAGG + Intergenic
1065821995 10:29534211-29534233 CCAAAAGAGAGGCCGGGCCCTGG + Intronic
1067779588 10:49190065-49190087 GCTACATTCAGGCCAGGCCCAGG + Intergenic
1068279962 10:54855095-54855117 AGTAAAGTCAGGCCCGAGCCCGG - Intronic
1068501039 10:57840191-57840213 CCTATTGTCAGGCCTGCCCCTGG + Intergenic
1073303187 10:102483372-102483394 CCTAAGTTCAGCCCAGGCCCAGG + Intronic
1074893228 10:117752420-117752442 CCTGAAGTCAGGCAGGACCCAGG - Intergenic
1076647240 10:131961688-131961710 CGGAAGGTGAGGCCCGGCCCAGG - Intergenic
1076825371 10:132964605-132964627 CCTAGAACCAGGCCTGGCCCAGG - Intergenic
1077128871 11:959234-959256 CCTAGGCTCAGTCCCGGCCCCGG + Intronic
1077221455 11:1419675-1419697 CCTCAAGTGAGGCCCCGCCATGG - Intronic
1077916782 11:6616730-6616752 CCTCAATCCCGGCCCGGCCCCGG + Exonic
1078142112 11:8700162-8700184 ACTAAGGTCAGGCCAGGCCAGGG + Intronic
1081720702 11:45286255-45286277 CCTGGAGGCGGGCCCGGCCCGGG - Exonic
1083307233 11:61767500-61767522 CCTAGACTCAGGTCTGGCCCTGG - Intronic
1085506986 11:77066547-77066569 CCCCAAGTCAGCCGCGGCCCCGG + Intergenic
1086569604 11:88266742-88266764 CCTAAAGTCAGCACAGCCCCAGG - Intergenic
1088397303 11:109382769-109382791 CCTAATGTCAAGCCAGGGCCAGG + Intergenic
1089079412 11:115763330-115763352 CCCAAAGCCAGGCCTAGCCCTGG + Intergenic
1102005732 12:109588164-109588186 CCTGAAGACAGGCCGGGGCCCGG - Intronic
1104754662 12:131261669-131261691 CCCTAATTCAGGCTCGGCCCTGG + Intergenic
1105294533 13:19076223-19076245 CCTAAAGACAAGCCAGGCCTGGG + Intergenic
1106448356 13:29857260-29857282 ACCAATGTCAGGCCCAGCCCTGG - Intergenic
1108509643 13:51144793-51144815 TCTAAAGCCAGGCCCAGCCCTGG - Intergenic
1119590607 14:75884132-75884154 CATAGAGTAAGGCCCGGCCCAGG + Intronic
1121833024 14:97068048-97068070 CCCAAAGCCAGCCCTGGCCCTGG - Intergenic
1127857501 15:62964494-62964516 CCCAAAGACAGGCCCTGCCTCGG - Intergenic
1129446862 15:75625177-75625199 CCTAAAGTCCGACCCGCCCCAGG + Intronic
1130546945 15:84863607-84863629 CCCAAAGCCAGGCGCGGCCCGGG - Exonic
1131666205 15:94573368-94573390 CCTAAAGTGAGGACGGGGCCTGG + Intergenic
1132522809 16:399206-399228 GCCAAAGCCAGGCCCTGCCCCGG - Intronic
1132902797 16:2267698-2267720 CCCAACGCCAGGCCCTGCCCTGG - Intronic
1133202474 16:4212654-4212676 CCTGACGTCAGTCCCGGGCCTGG - Intronic
1138413274 16:56856172-56856194 CCTCAAGCCAGGCCCAGTCCAGG - Intergenic
1139545991 16:67649784-67649806 ACTGAAGCCAGGCCCGGCCCAGG + Exonic
1141939280 16:87263878-87263900 CCTAGAGTCAGCACCAGCCCCGG + Intronic
1142133765 16:88442504-88442526 CCTGCAGGCAGGCCTGGCCCAGG - Intergenic
1143571057 17:7758863-7758885 CCTAGAGTCAGGCCCCGTCATGG - Exonic
1145272100 17:21410199-21410221 CCTCATGGCAGGCCCTGCCCAGG - Intronic
1145310308 17:21697661-21697683 CCTCATGCCAGGCCCTGCCCTGG - Intronic
1147044393 17:37742725-37742747 CGGAGAGCCAGGCCCGGCCCAGG - Intronic
1148560458 17:48602951-48602973 CCTAGGTTCAGGCCCGGCCTGGG - Intronic
1149660775 17:58332961-58332983 CCAACACTCAGGCCAGGCCCTGG + Intergenic
1151396747 17:73827761-73827783 TCTGCAGTCAGGCCCTGCCCTGG + Intergenic
1152278649 17:79372506-79372528 CCCAAGGCCAGGCCTGGCCCGGG + Intronic
1153762781 18:8347891-8347913 ACTAAAGTCAGGCCCATCCAAGG - Intronic
1154220326 18:12447328-12447350 CCTAAAGTCAGACCAGGCTAAGG + Exonic
1161237472 19:3205062-3205084 CCGAAAGTCCTGCCTGGCCCCGG + Intronic
1164934518 19:32200643-32200665 CCTAAATCCAGGCCCTGCCCTGG + Intergenic
1165742508 19:38212151-38212173 GCTGAAGTCAGGCCCGGGTCCGG + Intronic
1168096767 19:54120269-54120291 CCTGATGTCAGGCCAGGCTCAGG + Intronic
1168282139 19:55311619-55311641 CCTAAAGTCAGGCCCGGCCCAGG + Intronic
925005682 2:441365-441387 CCAAGAGTCAGGCTCTGCCCAGG + Intergenic
927204383 2:20597946-20597968 CCTAGAGCCAGGCTCAGCCCTGG + Intronic
927215413 2:20665785-20665807 CCCACAGAGAGGCCCGGCCCAGG - Intergenic
928245953 2:29627083-29627105 CCTAATGCCAGGCACTGCCCTGG + Intronic
928442381 2:31303149-31303171 CCTAATGGCAGGCCTGTCCCTGG - Intergenic
929232020 2:39569741-39569763 CCTAAAGCCAGGGCAGTCCCAGG - Intergenic
932744021 2:74316600-74316622 CCTAAAGCCAGGCCAGGCAAGGG + Intronic
934767483 2:96888063-96888085 CCCAAAGCCAGGCAGGGCCCAGG - Intronic
948801690 2:240436110-240436132 CCCAAAGCCCGGCCAGGCCCGGG - Intronic
948822393 2:240556762-240556784 CCAAAACTCAGTCCCAGCCCTGG - Intronic
1170866668 20:20163896-20163918 CTTAAAACCAGGCCTGGCCCAGG + Intronic
1171853232 20:30323028-30323050 CCCAGACTCAGGCCAGGCCCAGG - Intergenic
1175336446 20:58199264-58199286 TCTGAGGTCAGGGCCGGCCCAGG - Intergenic
1175524741 20:59625816-59625838 CTCAAAGTCAGCCCCTGCCCAGG - Intronic
1175940819 20:62536808-62536830 CCAACAGGCAGACCCGGCCCAGG + Intergenic
1179093657 21:38291953-38291975 CCTAATATCAGGCCTGGCACAGG + Intronic
1181115664 22:20631420-20631442 CCTAAACCCAGCCCAGGCCCCGG - Intergenic
1181323960 22:22030787-22030809 CCTCAGGCCAGGCCCAGCCCAGG + Intergenic
1181520972 22:23448858-23448880 CCTACAGCCAGGCGGGGCCCAGG + Intergenic
1182472720 22:30558468-30558490 CCTATAGACAGCCCTGGCCCAGG - Intronic
1183608569 22:38882162-38882184 CCTAGTGTCAGGCCCTGTCCAGG - Intergenic
1184914440 22:47559424-47559446 GGTAAAGTCAGGCCAGGCTCTGG - Intergenic
1185070704 22:48654254-48654276 CCCAGGGTCAGGCCCAGCCCAGG - Intronic
1185221748 22:49632490-49632512 CCTCGGGTGAGGCCCGGCCCCGG - Intronic
949966761 3:9363218-9363240 CCTGAAGTCCGGCTCGGCGCCGG - Exonic
950476428 3:13218036-13218058 CCTAAAGTCAGGTGCACCCCTGG + Intergenic
951334570 3:21405872-21405894 CCGAACGTCTGGCCCGGGCCAGG - Intergenic
953912411 3:46899674-46899696 CCTGAATTGAGGCTCGGCCCAGG + Intronic
954295929 3:49674451-49674473 ACCAGGGTCAGGCCCGGCCCGGG - Intronic
956364268 3:68482916-68482938 CCTAAAGTTAGTCCTGTCCCTGG + Intronic
962097482 3:132307253-132307275 CCTCATGTCAGCCCCAGCCCTGG + Intergenic
967867790 3:194204320-194204342 CACAAAGGCAGGCCCGGGCCAGG - Intergenic
969949391 4:10818789-10818811 CCTAGAATCAGGGCTGGCCCTGG + Intergenic
970194863 4:13543497-13543519 CCTACTGTGGGGCCCGGCCCTGG + Intronic
974920146 4:68228978-68229000 CCAAGAGTCAGGCCAGTCCCAGG + Intronic
975836391 4:78426619-78426641 CCTAAAGTCAGTCAGGTCCCAGG - Intronic
977045585 4:92064903-92064925 CCCAAAGTCAGTCCCAGCTCTGG + Intergenic
986721343 5:10563580-10563602 CCTCAAGCCACGGCCGGCCCCGG + Intergenic
999075588 5:148792638-148792660 CTGAAAGTCAGGCCAGGCCTAGG - Intergenic
999314538 5:150575385-150575407 CCGGAAGCCAGGCCTGGCCCGGG + Intergenic
999893445 5:156003491-156003513 CCTCCAGTCAGCCCCAGCCCAGG - Intronic
1001587714 5:172844675-172844697 CCTAGGGCCAGGCCAGGCCCCGG - Intronic
1004019276 6:11761914-11761936 CCTCAATTCAGCCCCAGCCCTGG - Intronic
1008687720 6:53943639-53943661 CCTCCAGTGAGGCCTGGCCCTGG - Intronic
1013355006 6:109338989-109339011 CGTAAGGTCCGGCCTGGCCCAGG - Intergenic
1019410544 7:904801-904823 CCTGAACTCAGGCCCAGCCGTGG - Intronic
1019943675 7:4310328-4310350 CCCAAAGAGAGGCCTGGCCCTGG - Intergenic
1023545901 7:41317527-41317549 CCTAAAATCAGCCCTAGCCCTGG - Intergenic
1023989882 7:45122370-45122392 CCTCAGGTCAGGCCTGGGCCTGG + Intergenic
1025157673 7:56623947-56623969 TCTAAAGTCAAGCCCAGCCAGGG - Intergenic
1027217390 7:76192725-76192747 CCCAAAGCCAGGCCTGCCCCTGG - Intergenic
1031239387 7:119219077-119219099 CCCAATGTCAGGCCTGCCCCTGG - Intergenic
1032081768 7:128862706-128862728 CGTAAAGACAGGCCCGAACCAGG - Intronic
1032791447 7:135246020-135246042 CCGAAAGTCAGGCTCGGCTGTGG - Intronic
1034902135 7:154914328-154914350 TCCAGAGGCAGGCCCGGCCCCGG - Intergenic
1034985287 7:155509610-155509632 CCCAAAGTCTGGCCCTCCCCGGG + Intronic
1038303967 8:26382991-26383013 CCTGACGTCAGGGCCCGCCCAGG - Exonic
1047707515 8:127514590-127514612 CCTAAATTGACCCCCGGCCCTGG + Intergenic
1050850340 9:10277402-10277424 CCGAGAGTCAGGGCTGGCCCTGG - Intronic
1056788603 9:89610841-89610863 CCCAAAGTCAGTCTCTGCCCAGG + Intergenic
1057265304 9:93613479-93613501 CCTAAAGACAAGCCAGGCCTGGG - Intronic
1062264093 9:135678890-135678912 CCCGCAGTCAGGCCAGGCCCAGG + Intergenic
1062479963 9:136746602-136746624 CCTGAGGCCAGGCCTGGCCCGGG + Intronic
1190243953 X:48678192-48678214 CCTTAGGTCAGGCCTGTCCCAGG + Intronic
1190308999 X:49103213-49103235 CCTTATGTCAGGCCTGTCCCAGG + Intergenic
1192240308 X:69323124-69323146 CCTAAAGTCATCCACTGCCCAGG - Intergenic
1193531869 X:82664358-82664380 CTTAAAGTCAAGCCCAGCCATGG + Intergenic
1199153168 X:144514030-144514052 CCTAAAGCCAGGCCAGGCAAAGG + Intergenic
1202037196 Y:20647232-20647254 CCTCATGTCAGCCCCAGCCCTGG + Intergenic
1202259177 Y:22951691-22951713 TCTAAAGTCAAGCCCAGCCACGG + Intergenic
1202412163 Y:24585435-24585457 TCTAAAGTCAAGCCCAGCCACGG + Intergenic
1202458617 Y:25084633-25084655 TCTAAAGTCAAGCCCAGCCACGG - Intergenic