ID: 1168282814

View in Genome Browser
Species Human (GRCh38)
Location 19:55314607-55314629
Sequence GACTCAGTAGTCTCTTGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 64}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168282814_1168282821 0 Left 1168282814 19:55314607-55314629 CCCACCCAAGAGACTACTGAGTC 0: 1
1: 0
2: 0
3: 6
4: 64
Right 1168282821 19:55314630-55314652 CCACAGAATGAAGGCCCCTGTGG 0: 1
1: 0
2: 0
3: 23
4: 231
1168282814_1168282818 -9 Left 1168282814 19:55314607-55314629 CCCACCCAAGAGACTACTGAGTC 0: 1
1: 0
2: 0
3: 6
4: 64
Right 1168282818 19:55314621-55314643 TACTGAGTCCCACAGAATGAAGG 0: 1
1: 0
2: 2
3: 21
4: 155
1168282814_1168282826 18 Left 1168282814 19:55314607-55314629 CCCACCCAAGAGACTACTGAGTC 0: 1
1: 0
2: 0
3: 6
4: 64
Right 1168282826 19:55314648-55314670 TGTGGCTAAACTGATCATCAGGG 0: 1
1: 0
2: 0
3: 9
4: 132
1168282814_1168282825 17 Left 1168282814 19:55314607-55314629 CCCACCCAAGAGACTACTGAGTC 0: 1
1: 0
2: 0
3: 6
4: 64
Right 1168282825 19:55314647-55314669 CTGTGGCTAAACTGATCATCAGG 0: 1
1: 0
2: 1
3: 5
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168282814 Original CRISPR GACTCAGTAGTCTCTTGGGT GGG (reversed) Intronic
902871432 1:19315853-19315875 GACTCTGTAGTTTCCTGGCTGGG + Intronic
902958684 1:19945644-19945666 TACTCTGGAGACTCTTGGGTAGG + Intergenic
907496931 1:54851521-54851543 GACTCAGTGGTGGCTGGGGTGGG + Exonic
907860539 1:58348547-58348569 GACTCAGTAGACTCTAGCTTGGG + Intronic
908399378 1:63756071-63756093 GACTCAGGAGTTTCCTGGGAGGG - Intergenic
914420012 1:147520538-147520560 GTCTCAGTTTTCTCATGGGTGGG - Intergenic
916670961 1:167019800-167019822 GAGTCAGTAGACTCCTGAGTTGG + Intronic
918958727 1:191242644-191242666 GACTCAGTAGGCACTTGGTATGG + Intergenic
921555591 1:216594898-216594920 GACTCAGTAGTACCTTGGTAGGG + Intronic
921782998 1:219190865-219190887 CACTCAGTAGTTGCTTGGGAAGG + Intronic
1067893913 10:50159685-50159707 CACTGATTATTCTCTTGGGTTGG - Intergenic
1072434923 10:95406113-95406135 GACTCAGTAGCCTTTCAGGTAGG - Exonic
1083852761 11:65377615-65377637 CACTCAGAAGCCTCTTTGGTGGG - Intronic
1087880729 11:103413011-103413033 GATTCAGTAGTCTGGAGGGTAGG - Intronic
1089704705 11:120269544-120269566 GCCTGAGTTGCCTCTTGGGTGGG + Intronic
1092947783 12:13472731-13472753 CCCTCAGTAGTATCTTGGGTTGG - Intergenic
1095950049 12:47776849-47776871 GACTCAGCAGTTTCTGGGTTAGG - Intronic
1097289639 12:57903790-57903812 TGCTCAGCAGTCTCTTGGGTTGG - Intergenic
1110289854 13:73792158-73792180 GACTCACTGGTATGTTGGGTTGG - Intronic
1113191472 13:107752691-107752713 GAGTCTGTAGTCTCTTTGGAAGG - Intronic
1114756998 14:25270420-25270442 GACTCAGTAGGATCTTGAGATGG - Intergenic
1126732963 15:51702999-51703021 GGGTCAGTGCTCTCTTGGGTGGG + Intronic
1128448522 15:67786258-67786280 GAATTGGTAGTCTCTTGGGGTGG + Intronic
1130907623 15:88251648-88251670 AACTCAGCTGGCTCTTGGGTGGG - Intronic
1147142684 17:38468216-38468238 GTCTCATTAGTCACTGGGGTTGG + Intronic
1154322993 18:13369404-13369426 GCCTCAGTGGGCTGTTGGGTGGG + Intronic
1161036564 19:2088206-2088228 GGCTGATTAGTCTCTGGGGTGGG - Intronic
1163137171 19:15320672-15320694 GTCTCAGGAGTTACTTGGGTGGG - Intronic
1167149398 19:47700061-47700083 GAGTCTGAAGTCTCTAGGGTAGG + Intronic
1168282814 19:55314607-55314629 GACTCAGTAGTCTCTTGGGTGGG - Intronic
925771630 2:7288011-7288033 GACACAGTAGTCTTTTGGCAAGG - Intergenic
935366413 2:102296153-102296175 CAGTTAGAAGTCTCTTGGGTGGG + Intergenic
938095288 2:128457424-128457446 GGCTCAGTCATCACTTGGGTTGG - Intergenic
1171303341 20:24083391-24083413 GACACAGAAGTCACTTGTGTGGG - Intergenic
1172393363 20:34581721-34581743 GAGTCAGGAGTCTCTAGGGTAGG - Intronic
1175084435 20:56446752-56446774 GATTCAACAGTCTCTGGGGTTGG - Intronic
1175266077 20:57704278-57704300 AACTCAGTTGTCTTTGGGGTGGG - Intronic
1178349045 21:31858347-31858369 GACTCAGAAGTCCCTTGGGAAGG + Intergenic
1183134189 22:35871068-35871090 TACTCAGCAGTATCCTGGGTTGG + Intronic
952660601 3:35841989-35842011 GACCCAGTACAGTCTTGGGTAGG + Intergenic
957441395 3:80252522-80252544 GACTCAGCAATCTCTTGTCTAGG - Intergenic
965833582 3:172826433-172826455 CACTCAAGAGTCTCATGGGTGGG - Intergenic
971063198 4:22996056-22996078 GTTGCAGTAGTCTCTTTGGTTGG + Intergenic
971578050 4:28302262-28302284 GACTCAGTAATCTCATGACTGGG + Intergenic
971818773 4:31524985-31525007 GACTCAGTAGTCTCATTACTAGG - Intergenic
972067009 4:34960218-34960240 GTCTCAATAGTCTCTCAGGTTGG - Intergenic
973822609 4:54676238-54676260 AACTCAGCAGGTTCTTGGGTGGG - Intronic
980829390 4:138111569-138111591 CACTGAGTAGGTTCTTGGGTGGG + Intergenic
985062244 4:186091098-186091120 GACTGAGTCGGCTCTTGGGTGGG + Intergenic
991146616 5:63313561-63313583 GCCTCAAAAGCCTCTTGGGTGGG - Intergenic
999503598 5:152171583-152171605 GACTCAGCAGTTTCTTTGCTCGG - Intergenic
1004971115 6:20911475-20911497 GAATCAGTAATCTCTTATGTGGG + Intronic
1006455495 6:34129660-34129682 GACTCAGCTGTCTCTTGAGCAGG + Intronic
1007222011 6:40286254-40286276 AGCTCAGGAGTCTCTTAGGTTGG + Intergenic
1013220169 6:108071236-108071258 GAATTAGTTGTCTCTTGGGGAGG - Intronic
1017208863 6:151833281-151833303 TACTCTGAAGTCTTTTGGGTGGG + Intronic
1020998032 7:15289831-15289853 AAATGAGTATTCTCTTGGGTAGG + Intronic
1033152986 7:138932768-138932790 GACTCCGTAGGGTCTTGAGTGGG - Intronic
1033254150 7:139785026-139785048 GACTCAGGAATCTCTGGGGGTGG + Intronic
1036791484 8:11724053-11724075 GACACAGTATTCTCTTGTGACGG + Intronic
1038525782 8:28271981-28272003 GTCTCAGTGGTCTTTTGGGTAGG - Intergenic
1041527313 8:58821921-58821943 GAGTCTGTAGTCTCTGGGGCGGG - Intronic
1041579055 8:59435425-59435447 GCATCAAAAGTCTCTTGGGTTGG - Intergenic
1043164568 8:76887350-76887372 GACTAAGTAGTCTCTTACTTTGG - Intergenic
1046664544 8:116986366-116986388 GCCTCTGTAGTCTCCTGGTTGGG + Intronic
1057112283 9:92484737-92484759 GACTGAGGAGTGCCTTGGGTGGG - Intronic
1187284737 X:17894133-17894155 GACTCAGGAGTGACTTGGTTGGG + Intergenic
1188537661 X:31215335-31215357 GACTCAGATGCCTCTTGGGGTGG + Intronic
1191248015 X:58243285-58243307 CACCCAGTAGTCTCTTTGGCTGG - Intergenic
1194264062 X:91733929-91733951 GACTCTGTAGCCGCTTGGGCAGG - Intergenic
1194728727 X:97429304-97429326 GAGTCAGTGGTTTCTTGGTTAGG + Intronic