ID: 1168282814

View in Genome Browser
Species Human (GRCh38)
Location 19:55314607-55314629
Sequence GACTCAGTAGTCTCTTGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168282814_1168282818 -9 Left 1168282814 19:55314607-55314629 CCCACCCAAGAGACTACTGAGTC No data
Right 1168282818 19:55314621-55314643 TACTGAGTCCCACAGAATGAAGG No data
1168282814_1168282826 18 Left 1168282814 19:55314607-55314629 CCCACCCAAGAGACTACTGAGTC No data
Right 1168282826 19:55314648-55314670 TGTGGCTAAACTGATCATCAGGG No data
1168282814_1168282825 17 Left 1168282814 19:55314607-55314629 CCCACCCAAGAGACTACTGAGTC No data
Right 1168282825 19:55314647-55314669 CTGTGGCTAAACTGATCATCAGG No data
1168282814_1168282821 0 Left 1168282814 19:55314607-55314629 CCCACCCAAGAGACTACTGAGTC No data
Right 1168282821 19:55314630-55314652 CCACAGAATGAAGGCCCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168282814 Original CRISPR GACTCAGTAGTCTCTTGGGT GGG (reversed) Intronic