ID: 1168282821

View in Genome Browser
Species Human (GRCh38)
Location 19:55314630-55314652
Sequence CCACAGAATGAAGGCCCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 231}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168282814_1168282821 0 Left 1168282814 19:55314607-55314629 CCCACCCAAGAGACTACTGAGTC 0: 1
1: 0
2: 0
3: 6
4: 64
Right 1168282821 19:55314630-55314652 CCACAGAATGAAGGCCCCTGTGG 0: 1
1: 0
2: 0
3: 23
4: 231
1168282817_1168282821 -5 Left 1168282817 19:55314612-55314634 CCAAGAGACTACTGAGTCCCACA 0: 1
1: 0
2: 0
3: 8
4: 126
Right 1168282821 19:55314630-55314652 CCACAGAATGAAGGCCCCTGTGG 0: 1
1: 0
2: 0
3: 23
4: 231
1168282808_1168282821 11 Left 1168282808 19:55314596-55314618 CCCCCACCTACCCCACCCAAGAG 0: 1
1: 0
2: 5
3: 57
4: 535
Right 1168282821 19:55314630-55314652 CCACAGAATGAAGGCCCCTGTGG 0: 1
1: 0
2: 0
3: 23
4: 231
1168282810_1168282821 9 Left 1168282810 19:55314598-55314620 CCCACCTACCCCACCCAAGAGAC 0: 1
1: 0
2: 1
3: 26
4: 262
Right 1168282821 19:55314630-55314652 CCACAGAATGAAGGCCCCTGTGG 0: 1
1: 0
2: 0
3: 23
4: 231
1168282811_1168282821 8 Left 1168282811 19:55314599-55314621 CCACCTACCCCACCCAAGAGACT 0: 1
1: 0
2: 1
3: 37
4: 327
Right 1168282821 19:55314630-55314652 CCACAGAATGAAGGCCCCTGTGG 0: 1
1: 0
2: 0
3: 23
4: 231
1168282812_1168282821 5 Left 1168282812 19:55314602-55314624 CCTACCCCACCCAAGAGACTACT 0: 1
1: 0
2: 3
3: 14
4: 206
Right 1168282821 19:55314630-55314652 CCACAGAATGAAGGCCCCTGTGG 0: 1
1: 0
2: 0
3: 23
4: 231
1168282807_1168282821 14 Left 1168282807 19:55314593-55314615 CCTCCCCCACCTACCCCACCCAA No data
Right 1168282821 19:55314630-55314652 CCACAGAATGAAGGCCCCTGTGG 0: 1
1: 0
2: 0
3: 23
4: 231
1168282815_1168282821 -1 Left 1168282815 19:55314608-55314630 CCACCCAAGAGACTACTGAGTCC 0: 1
1: 1
2: 0
3: 8
4: 90
Right 1168282821 19:55314630-55314652 CCACAGAATGAAGGCCCCTGTGG 0: 1
1: 0
2: 0
3: 23
4: 231
1168282809_1168282821 10 Left 1168282809 19:55314597-55314619 CCCCACCTACCCCACCCAAGAGA 0: 1
1: 0
2: 2
3: 49
4: 371
Right 1168282821 19:55314630-55314652 CCACAGAATGAAGGCCCCTGTGG 0: 1
1: 0
2: 0
3: 23
4: 231
1168282813_1168282821 1 Left 1168282813 19:55314606-55314628 CCCCACCCAAGAGACTACTGAGT 0: 1
1: 0
2: 0
3: 8
4: 161
Right 1168282821 19:55314630-55314652 CCACAGAATGAAGGCCCCTGTGG 0: 1
1: 0
2: 0
3: 23
4: 231
1168282816_1168282821 -4 Left 1168282816 19:55314611-55314633 CCCAAGAGACTACTGAGTCCCAC 0: 1
1: 0
2: 0
3: 8
4: 111
Right 1168282821 19:55314630-55314652 CCACAGAATGAAGGCCCCTGTGG 0: 1
1: 0
2: 0
3: 23
4: 231
1168282806_1168282821 15 Left 1168282806 19:55314592-55314614 CCCTCCCCCACCTACCCCACCCA 0: 1
1: 1
2: 36
3: 261
4: 2118
Right 1168282821 19:55314630-55314652 CCACAGAATGAAGGCCCCTGTGG 0: 1
1: 0
2: 0
3: 23
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168282821 Original CRISPR CCACAGAATGAAGGCCCCTG TGG Intronic
900126350 1:1070554-1070576 CCACAGAACCATGACCCCTGTGG - Intergenic
900802401 1:4745487-4745509 CCACAGAAGGAGGGGGCCTGGGG + Intronic
901564947 1:10106409-10106431 CGACAGAATGGAGACGCCTGAGG - Exonic
902426170 1:16323898-16323920 CCACAGCATGAGGGCTTCTGAGG + Intronic
903576737 1:24344066-24344088 ACTCAGGGTGAAGGCCCCTGTGG + Intronic
903672730 1:25046133-25046155 CAGCAGAGTGCAGGCCCCTGTGG - Intergenic
905305346 1:37013958-37013980 GAACAGAAAGAAGGCCCATGTGG - Intronic
906114235 1:43345451-43345473 GCACAGAAAGAAGGCCTGTGCGG + Intronic
907646778 1:56252312-56252334 GCACAGAATGAAGGCAGTTGTGG + Intergenic
908794721 1:67819746-67819768 GCACAAAAAGAAGGCTCCTGTGG - Intronic
911054991 1:93701637-93701659 CCACATAAAACAGGCCCCTGTGG - Intronic
912758117 1:112341942-112341964 GCACAGCATGGAGGCTCCTGTGG + Intergenic
915097717 1:153475436-153475458 CCAGAGAAGGAAGGACACTGGGG + Intergenic
915146862 1:153800608-153800630 CCATGGCATGCAGGCCCCTGGGG - Intergenic
915836061 1:159176018-159176040 CCAGAGAAAGAAAACCCCTGGGG + Intronic
921300163 1:213744475-213744497 CCACATAAGAAAGGCCCATGGGG - Intergenic
923601958 1:235411448-235411470 CCACAGAAAGGAGGACACTGAGG - Intronic
1062967185 10:1616696-1616718 CAACAGAATGCAGCCCTCTGAGG - Intronic
1062967198 10:1616788-1616810 CAACAGAATGCAGCCCTCTGAGG - Intronic
1062967252 10:1617165-1617187 CAACAGAATGCAGCCCTCTGAGG - Intronic
1062967266 10:1617257-1617279 CAACAGAATGCAGCCCTCTGAGG - Intronic
1062967281 10:1617349-1617371 CGACAGAATGCAGCCCTCTGAGG - Intronic
1063169512 10:3494944-3494966 CCTCAAAGGGAAGGCCCCTGAGG - Intergenic
1064087306 10:12354787-12354809 CCACACAAGGAAAGCCCCTCGGG - Intronic
1064652747 10:17525909-17525931 CCACTGAATGAAAGTCTCTGCGG - Intergenic
1067451938 10:46387087-46387109 CCACAGGACTAAGGCACCTGGGG - Intronic
1067585300 10:47472668-47472690 CCACAGGACTAAGGCACCTGGGG + Intronic
1071532779 10:86401707-86401729 CCACGGAATGGAAGCCCCAGAGG - Intergenic
1072789550 10:98308352-98308374 CCACCGACTGTAGGCGCCTGGGG + Intergenic
1073607313 10:104909463-104909485 CCTCAGAAGGCAGGCCACTGAGG + Intronic
1074385741 10:113015359-113015381 CCCCAGAATGGAGGCGCATGAGG + Intronic
1075941242 10:126392063-126392085 CCAAAGAAAGAATGCTCCTGGGG + Intergenic
1077065794 11:640395-640417 GCACAGCAGGAAGGCCCCTGGGG - Exonic
1077633837 11:3828352-3828374 ACACACAATGAAAGGCCCTGAGG + Intronic
1077900350 11:6482259-6482281 CCTCAGATTGAAGGACCCGGTGG + Exonic
1080431298 11:32202503-32202525 CCACAGAAGGAAGGGCACTTTGG + Intergenic
1081439688 11:43066329-43066351 CCACGGAAGGAAAGCTCCTGGGG - Intergenic
1083000112 11:59283695-59283717 CCACAGAAAGATGGCCACAGAGG + Intergenic
1083815625 11:65130857-65130879 CCCCAGAAGGCAGGCCCCTAGGG - Intronic
1084147284 11:67271853-67271875 CAGCAGAAGGAAGTCCCCTGGGG - Intronic
1084589671 11:70083485-70083507 CCAAAGACTGTAGGCCCCTGAGG + Intronic
1086167974 11:83801499-83801521 AAACAGAATGAAGGCCCTTGTGG - Intronic
1086237500 11:84649398-84649420 CTACAGAATAAAGCCCCATGAGG + Intronic
1086443248 11:86849005-86849027 CCAGAGGATGAAGGCCCCCTGGG + Intronic
1087907372 11:103714204-103714226 CCACAGAATGCAGCCCTGTGTGG - Intergenic
1088441689 11:109877902-109877924 CCCCAGAATGAAGGCACGTGGGG + Intergenic
1089805193 11:121080973-121080995 ACAGAGAATGAAGCCACCTGTGG - Intronic
1090470134 11:126973312-126973334 CAACTGAATGGTGGCCCCTGAGG - Intronic
1090660732 11:128880096-128880118 CCACACAATGAAGGTCGCTATGG - Intergenic
1095418107 12:41997959-41997981 CCACACAATCAATCCCCCTGGGG + Intergenic
1096387839 12:51206696-51206718 ACAGAGAGTGAAGGGCCCTGTGG + Intronic
1096676689 12:53230148-53230170 CCAAAGAACCAAGGCACCTGGGG - Intronic
1098034629 12:66289398-66289420 TCAAAGAATGGAGTCCCCTGAGG - Intergenic
1102643885 12:114390864-114390886 TCACAGAATGAACGTCGCTGGGG + Intronic
1103809273 12:123601104-123601126 CCCCAAAATGAAGGCCCCAGAGG - Intergenic
1105292624 13:19062330-19062352 CCTCAGAAGGAAGGCCCTTTGGG + Intergenic
1107383350 13:39880491-39880513 CCACAGCATGCAGGCTCCTGGGG - Intergenic
1108030583 13:46225141-46225163 CCACAGCATGCAGGACCCAGAGG - Intronic
1110639753 13:77809094-77809116 CAACAGAAAGAAGGCCACTGAGG - Intergenic
1110849837 13:80232482-80232504 CCACAGCAAGGAGCCCCCTGAGG - Intergenic
1112045168 13:95589455-95589477 CCACAGTATGATGGCATCTGGGG + Intronic
1112388962 13:98965135-98965157 CCACAGTAAGAAGGGCCCTCAGG + Intronic
1114163095 14:20190780-20190802 CCAGAGAACGGAGGCCCCAGAGG + Intergenic
1115197589 14:30818131-30818153 CCACAGAATGAAAGGCACTGGGG - Intergenic
1117102901 14:52368833-52368855 CAACAGAAGGAAGGCCAGTGTGG + Intergenic
1122953384 14:105058698-105058720 CCACAGCATGAGGGGCCCGGAGG + Intronic
1125101219 15:35914772-35914794 CCACAGAATGCAGCCCACTCTGG - Intergenic
1127959029 15:63877273-63877295 CCCCAGAATGAAGGCACGTGGGG + Intergenic
1129903073 15:79166489-79166511 CCACAGAAAGAGGGCGCCTTGGG + Intergenic
1130525223 15:84700023-84700045 CCACAGACTAAAGGCCGCTCTGG + Intronic
1132063231 15:98709922-98709944 CTACTGATTGAAGACCCCTGGGG + Intronic
1137726740 16:50661874-50661896 CCAGAAGATGAAGGCTCCTGTGG - Intergenic
1137822299 16:51457787-51457809 GCACAGAAAGAAGGATCCTGAGG - Intergenic
1139199394 16:64957278-64957300 CCTCAGACTGAAGTGCCCTGTGG - Intronic
1141034464 16:80615671-80615693 ACACAGAATGAAAGGCTCTGGGG - Intronic
1141282945 16:82645237-82645259 CTAGAGAATGAAAGCCTCTGGGG + Intronic
1141294436 16:82753769-82753791 CCACAGAATAAAGGGCCCCATGG - Intronic
1142697253 17:1640319-1640341 CAACAGGAGGGAGGCCCCTGGGG + Intronic
1142704000 17:1682898-1682920 ACACAGAATTCAGGTCCCTGAGG + Intronic
1142800855 17:2344610-2344632 CAACAGAATGTAAGCTCCTGCGG - Intronic
1143385198 17:6525101-6525123 CCACAGAATGACTACCCCAGTGG - Intronic
1143731860 17:8886095-8886117 GCACAGGAGGTAGGCCCCTGGGG - Intronic
1144969122 17:19096130-19096152 TCACAGCCTGATGGCCCCTGCGG + Intronic
1144978794 17:19155936-19155958 TCACAGCCTGATGGCCCCTGCGG - Intronic
1144989428 17:19222296-19222318 TCACAGCCTGATGGCCCCTGCGG + Intronic
1145041292 17:19579923-19579945 CCTCCGCATGGAGGCCCCTGCGG + Intergenic
1145369082 17:22293972-22293994 CCTCAGACTGTGGGCCCCTGAGG + Intergenic
1146468154 17:33103588-33103610 CCCTAGAATGAAGTCCCTTGAGG - Intronic
1146497038 17:33331971-33331993 CAACTGAATCAGGGCCCCTGGGG + Intronic
1148814104 17:50314273-50314295 CCAGAGACTGAGCGCCCCTGAGG - Intergenic
1151256168 17:72878410-72878432 TCACAGCAAGAAGGCCCCTGGGG - Intronic
1152555129 17:81049240-81049262 TCACAGAACGTGGGCCCCTGGGG + Intronic
1156449014 18:37256063-37256085 CTGCAGACTGGAGGCCCCTGTGG + Intronic
1157141052 18:45106989-45107011 GCACAGAAGGAAGGCCAGTGAGG - Intergenic
1157505642 18:48224425-48224447 GCACAGAATAGAGGCCCTTGAGG + Intronic
1157583610 18:48787512-48787534 CCTCAGAATGGAGGCGGCTGAGG - Intronic
1157779068 18:50421183-50421205 CATCAGAATGAAGGCCCTGGTGG + Intergenic
1162551543 19:11361016-11361038 CCAGATAATGAGGGTCCCTGGGG + Intronic
1165093294 19:33397515-33397537 ACACACAGTGAAGGCCCGTGGGG - Intronic
1166361624 19:42254984-42255006 CCCCAGCATGAAGACCCCGGCGG - Exonic
1167195395 19:48024635-48024657 CCACAGACTGAACGCCACTGTGG - Intronic
1168282821 19:55314630-55314652 CCACAGAATGAAGGCCCCTGTGG + Intronic
925886977 2:8401714-8401736 ACACAGGGGGAAGGCCCCTGAGG + Intergenic
927191978 2:20523317-20523339 CCAGAGGCTGAAGGCACCTGGGG - Intergenic
927687668 2:25183223-25183245 CCACAGATTGTTGGCCCCTTAGG - Intergenic
928128210 2:28630470-28630492 GCACAGGCTGCAGGCCCCTGGGG + Intronic
928410541 2:31050864-31050886 CCACACAGAGAAGTCCCCTGTGG - Intronic
928412290 2:31064404-31064426 CCACAGACTCCAGGCCTCTGAGG - Intronic
929114631 2:38433931-38433953 CCACAGAATGGGGTGCCCTGTGG - Intergenic
929283634 2:40110977-40110999 CCAATGAATCAAGACCCCTGTGG + Intronic
929500452 2:42486583-42486605 GGACAGAAGGAAGGCCCATGTGG - Intronic
929617884 2:43326718-43326740 CCAAAGAATGAAGACCCCAGTGG + Intronic
929790647 2:45020168-45020190 CAAAAGAATTAAGGCCCCTTAGG + Intergenic
929943305 2:46351627-46351649 CCTTAGAAGGAAGGCCCCTGTGG + Intronic
930092042 2:47538023-47538045 TATGAGAATGAAGGCCCCTGAGG + Intronic
934137806 2:89015070-89015092 CCTCAGAATGAAGTCCCATAAGG - Intergenic
934231441 2:90185557-90185579 CCTCAGAATGAAGTCCCATAAGG + Intergenic
936141900 2:109947981-109948003 GCAGAGAATGAGGGCCCTTGGGG + Intergenic
936178588 2:110245929-110245951 GCAGAGAATGAGGGCCCTTGGGG + Intergenic
936202790 2:110423503-110423525 GCAGAGAATGAGGGCCCTTGGGG - Intronic
936530248 2:113271324-113271346 CCACAAGTTGAAGGACCCTGGGG - Intronic
938774888 2:134532724-134532746 CCACACAGTGAAGGCCGCTTGGG + Intronic
938841823 2:135171958-135171980 GCACAGAAGGAAGGCCACTGTGG + Intronic
941754234 2:169167541-169167563 CCACAAAATTAAGGCCACTTTGG + Intronic
942717419 2:178909007-178909029 CCACAGAGGAAAGGCCCATGTGG - Intronic
943451838 2:188052208-188052230 CAGCTGAATGAAGGTCCCTGAGG + Intergenic
944098208 2:195993800-195993822 CCACAGAATGTATGCCTTTGGGG - Intronic
1169351482 20:4871640-4871662 CCACAGAATGAACAAGCCTGAGG - Intronic
1169414554 20:5404902-5404924 ACAAAGAATGAAGGGCCCTCTGG + Intergenic
1169837404 20:9895863-9895885 CCACAGAAGGTAGGACCATGTGG + Intergenic
1170455638 20:16530449-16530471 CGACAGAGTGAGGACCCCTGTGG + Intronic
1170740278 20:19049881-19049903 ACTCAGAGTGCAGGCCCCTGCGG + Intergenic
1171482026 20:25461237-25461259 CCACAGAATGGAGGAGCCAGAGG - Intronic
1172153346 20:32806157-32806179 GCACAGAATGAAGGGACCTGGGG - Intronic
1173009609 20:39170016-39170038 ACAGAGAGAGAAGGCCCCTGGGG - Intergenic
1173209785 20:41023212-41023234 CCACAGCATGATAGCCCCAGAGG + Intergenic
1173759053 20:45543762-45543784 CCAGACAATGAAGGGCCTTGTGG - Intronic
1174152187 20:48493501-48493523 CCACAGAGAAACGGCCCCTGGGG - Intergenic
1174872838 20:54199534-54199556 TCACAGAATGGAGGCCCAAGAGG + Intergenic
1175219459 20:57408704-57408726 CCACAGACAGGAGGCCCCTCAGG + Exonic
1175923222 20:62459519-62459541 CCCCAGAAACACGGCCCCTGAGG + Intergenic
1177194354 21:17886946-17886968 TCACTGAAGGAAGGGCCCTGAGG + Intergenic
1179730479 21:43364700-43364722 CCAGAGGATCAGGGCCCCTGAGG - Intergenic
1182047549 22:27287671-27287693 CCACAGAATGGAGTCACCCGTGG + Intergenic
1182082608 22:27539796-27539818 CCAGAGAAGGAAGGTCTCTGGGG + Intergenic
1182332799 22:29562726-29562748 ACACAGAATGGAGGCCTGTGGGG + Intronic
1182394973 22:30028669-30028691 CCAAAGAGTGAAGGCCTCTGGGG - Intronic
1182481875 22:30614479-30614501 CCACAGAATGGTGGCCCTGGTGG - Exonic
1182534581 22:30991150-30991172 CTACAGAATGAAAACCTCTGAGG + Intergenic
1182540294 22:31036462-31036484 GAACAGAATGAAGGCCACTGTGG - Intergenic
1183512657 22:38245120-38245142 CCTCAGAATTAAGACCCATGGGG + Intronic
1183717511 22:39542245-39542267 CCACAGAACGTAAGCACCTGGGG + Intergenic
1184257770 22:43296829-43296851 CCACCTGCTGAAGGCCCCTGTGG - Intronic
1184462890 22:44649290-44649312 GCAGAGAAGGAAGGACCCTGTGG + Intergenic
1184786349 22:46673853-46673875 ACACAGACTGAAGGCCCGTGAGG + Intronic
1185103722 22:48855533-48855555 CAACAGAATAAAGGTCCCAGAGG - Intergenic
950053319 3:10008087-10008109 CCCCAGAAAGAGGGCCCCTGTGG + Intronic
950089643 3:10286638-10286660 CCACAGAGTGAACTCCCATGTGG + Intronic
950121531 3:10485220-10485242 CCACAGAAGGAAGGCACCCTTGG - Intronic
950230855 3:11274599-11274621 CCACATCGTGAAGGGCCCTGTGG + Intronic
950627967 3:14262198-14262220 CTGCAGAATGGTGGCCCCTGAGG + Intergenic
951895892 3:27609454-27609476 CCTCAAAATGAAGGCCTCAGAGG + Intergenic
953978454 3:47400452-47400474 CCCAAGAATGCAGCCCCCTGTGG - Intronic
955750716 3:62183590-62183612 GCACAGAATGAAGGCCTTGGTGG + Intronic
955884220 3:63580297-63580319 GCACAGAATTAAGTGCCCTGGGG + Intronic
956717652 3:72092543-72092565 CCACAGAAAGAAGGCCGGTCGGG - Intergenic
958882774 3:99691649-99691671 CCTTAGAATGAAGCCCCATGAGG - Intronic
959054953 3:101558369-101558391 CCTCACAATGAAGGTCCCAGTGG + Intergenic
960121992 3:113956521-113956543 CCACAGTATGGAGGCCCCCTGGG + Intronic
961203651 3:125063654-125063676 CAACAGAATGAGGGCCCAGGGGG - Intergenic
963052840 3:141157412-141157434 TATCAGATTGAAGGCCCCTGTGG - Intergenic
963412886 3:144954145-144954167 CCACAGACCAAAGGCTCCTGCGG - Intergenic
966005561 3:175007509-175007531 CATCAGAAAGAAGGCCCCTGGGG + Intronic
968731567 4:2271594-2271616 CCCCAGGAGGAAGGCTCCTGTGG + Intronic
968747186 4:2366064-2366086 CCAGTGAAGGAAGGACCCTGAGG + Intronic
969547528 4:7841309-7841331 ACACTGAATGCAGACCCCTGGGG + Intronic
971193381 4:24448564-24448586 CCACAGTATGGAGGGACCTGGGG + Intergenic
972155275 4:36153473-36153495 CCACAGAATGAATGACACTCAGG + Intronic
973639010 4:52885302-52885324 CCAGAGAATATAGGCCCCTAAGG + Intronic
975935173 4:79570732-79570754 CAAATGAATGGAGGCCCCTGGGG + Intergenic
976509967 4:85897064-85897086 ACAAAGAAAGAAGGCCCATGTGG - Intronic
977366973 4:96082348-96082370 CCACAGAAAGAAGTTTCCTGTGG - Intergenic
979609872 4:122678382-122678404 CAGCAAAATGAAGTCCCCTGAGG + Intergenic
981752771 4:148108624-148108646 CGACAGAAGGAAGGCCTCTGAGG - Intronic
985950615 5:3219243-3219265 CCCCAGATTCCAGGCCCCTGAGG - Intergenic
992490193 5:77235086-77235108 CAACAGATTGTAGGCCTCTGTGG - Intronic
996209966 5:120796750-120796772 CCACAGAATTAAAGACACTGCGG + Intergenic
997811992 5:136979453-136979475 CCGAGGTATGAAGGCCCCTGGGG + Exonic
998135552 5:139672592-139672614 CCTCAGGAGGAAGGCCCCAGAGG - Intronic
999152321 5:149434437-149434459 CTATAGAATGGAGGCCCATGTGG - Intergenic
1001042437 5:168346478-168346500 CATCAGAATGAAGGCATCTGGGG + Intronic
1003233506 6:4275580-4275602 CCACAGACGGAAGGGGCCTGGGG + Intergenic
1005745524 6:28833568-28833590 CTACAGCATGAAGGCAACTGAGG + Intergenic
1007321934 6:41033937-41033959 CCAAGGTATGGAGGCCCCTGGGG - Exonic
1007729028 6:43934669-43934691 CCACAGACAGAAGCCCCATGAGG + Intergenic
1010829050 6:80508639-80508661 CAATACAATGAAGGCTCCTGGGG - Intergenic
1013004044 6:106053970-106053992 TCACAGAATAAAAGCCCCTCTGG + Intergenic
1015145333 6:129978662-129978684 CCAGCGAATGAAGGCTGCTGAGG - Intergenic
1015827030 6:137325038-137325060 CCCCAGACTGAAGGCCCTTGAGG + Intergenic
1017787387 6:157767926-157767948 CCTCAGAGTGGAGGCTCCTGGGG + Intronic
1018384062 6:163287180-163287202 CTGCAGAATCAAGGGCCCTGAGG + Intronic
1021031279 7:15739525-15739547 CCAGAGACTGAAGGACCTTGGGG + Intergenic
1021265304 7:18513597-18513619 TCTCAGAATAAAGGCCACTGTGG + Intronic
1021345267 7:19519650-19519672 CCACAGAATGAAGGGGCAGGAGG + Intergenic
1021375240 7:19898763-19898785 ACACAGAATATAGGCCCTTGAGG + Intergenic
1022355545 7:29611191-29611213 CCACAGAGAGACGGGCCCTGAGG - Intergenic
1022547484 7:31202297-31202319 CCAGAGAATCAAGGCTACTGTGG + Intergenic
1022778512 7:33553847-33553869 CCCCAGAATGTAAGCTCCTGTGG - Intronic
1023109415 7:36794461-36794483 CCCCACAATGACAGCCCCTGAGG - Intergenic
1023223940 7:37949516-37949538 CCACAGCATGAATGCCTGTGTGG - Intronic
1026157952 7:67843741-67843763 CCACAGCAGGGAGGCCCCTAGGG - Intergenic
1026605059 7:71808794-71808816 CCACACAATGAAAGCACATGGGG - Intronic
1028615842 7:92765985-92766007 GAACAGAAAGAAGGCCACTGTGG + Intronic
1029521589 7:101066315-101066337 CCACAGAAAGCCAGCCCCTGTGG + Intergenic
1030090521 7:105853959-105853981 CCACAGATGTTAGGCCCCTGTGG - Intronic
1032184652 7:129713929-129713951 CCACAGTTTGAAGGGCCTTGTGG + Intronic
1032192089 7:129771180-129771202 CCACTGACTGATGGCCCCAGAGG - Intergenic
1033556640 7:142493821-142493843 CCAGAGAATGATGGTCACTGAGG + Intergenic
1034547643 7:151799569-151799591 TCACAGACTGAAGGGCTCTGGGG - Intronic
1035113753 7:156505915-156505937 CCACAGAAAGGAGGTCCCAGGGG + Intergenic
1035302856 7:157908303-157908325 CCACAGAATGCAGGCTGCAGGGG - Intronic
1035317180 7:158003510-158003532 ACACAGAAGGACAGCCCCTGAGG + Intronic
1035556693 8:572551-572573 CCACAGAATAGAGGAGCCTGCGG + Intergenic
1036619963 8:10418332-10418354 TCACAGTTTGAAGGCCCTTGTGG - Intronic
1040632353 8:49230223-49230245 CCACAGACACAAGGCCTCTGGGG - Intergenic
1041532140 8:58881038-58881060 CCACACAGGGGAGGCCCCTGTGG - Intronic
1043399213 8:79867301-79867323 CTAAAGAATGAAGTCCACTGTGG - Intergenic
1048051256 8:130818895-130818917 ACAGAGATTGAAGTCCCCTGAGG - Intronic
1048512887 8:135078500-135078522 CCATGGAATTAGGGCCCCTGAGG - Intergenic
1048859846 8:138716157-138716179 CCACAGAGAGCAGCCCCCTGTGG - Intronic
1049390174 8:142363663-142363685 TCACAGCTTGAAGGCTCCTGTGG - Intronic
1049569026 8:143359798-143359820 CCACAGGAAGAGGGCCACTGAGG + Intronic
1050092130 9:2025740-2025762 CCACAGTATGAAGAAACCTGGGG - Intronic
1051900669 9:22035724-22035746 CCACAGAAAGAAAGCCAGTGTGG - Intergenic
1055411676 9:76037085-76037107 CCACAAAATGAATACCACTGTGG - Intronic
1056307373 9:85303335-85303357 CCACAGAAAGAAAACCCCTGGGG - Intergenic
1056823246 9:89859393-89859415 CCACTGAATGCAAGTCCCTGGGG - Intergenic
1057446241 9:95117158-95117180 CCACAGAATGTGGGATCCTGGGG + Intronic
1057935592 9:99236116-99236138 GAACAGAATGAAGGGCTCTGTGG - Intergenic
1060174146 9:121485222-121485244 CCAGAGAAGGTAGGCCCATGTGG - Intergenic
1061039710 9:128132890-128132912 CCACTGAATGCAAGTCCCTGGGG + Intergenic
1186343517 X:8667556-8667578 CCAGAGAATGAAAACCACTGTGG + Intronic
1187892823 X:23953187-23953209 CCAGGGAATGAATGCCCCTCTGG + Intergenic
1189364924 X:40380843-40380865 CCACAGAAGGAAGCGACCTGAGG - Intergenic
1189751548 X:44227796-44227818 CCTCTGAATGAAAGCCCCTCTGG + Intronic
1195799870 X:108695862-108695884 CAACAGAATGAAGTATCCTGAGG - Intronic
1196251475 X:113465357-113465379 CTACAGGATGAAGTGCCCTGTGG + Intergenic
1196490373 X:116258583-116258605 AAACAGCATGAAGGCCACTGTGG + Intergenic
1196591737 X:117493442-117493464 CTACAGGGTGAAGGTCCCTGGGG + Intergenic
1197301290 X:124784538-124784560 CCACAGAGATAAGGCTCCTGTGG + Intronic
1197904122 X:131405699-131405721 GCACAGAATACAGCCCCCTGCGG - Intergenic
1199606036 X:149580333-149580355 CAACAAAAAGAAGGACCCTGAGG - Intergenic
1199633085 X:149789035-149789057 CAACAAAAAGAAGGACCCTGAGG + Intergenic
1199658314 X:150021195-150021217 ACAAAGAAAGAAGGCCCTTGAGG + Intergenic
1200179245 X:154140483-154140505 CCAAGGAAAGAGGGCCCCTGGGG - Intergenic