ID: 1168282826

View in Genome Browser
Species Human (GRCh38)
Location 19:55314648-55314670
Sequence TGTGGCTAAACTGATCATCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 132}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168282811_1168282826 26 Left 1168282811 19:55314599-55314621 CCACCTACCCCACCCAAGAGACT 0: 1
1: 0
2: 1
3: 37
4: 327
Right 1168282826 19:55314648-55314670 TGTGGCTAAACTGATCATCAGGG 0: 1
1: 0
2: 0
3: 9
4: 132
1168282816_1168282826 14 Left 1168282816 19:55314611-55314633 CCCAAGAGACTACTGAGTCCCAC 0: 1
1: 0
2: 0
3: 8
4: 111
Right 1168282826 19:55314648-55314670 TGTGGCTAAACTGATCATCAGGG 0: 1
1: 0
2: 0
3: 9
4: 132
1168282815_1168282826 17 Left 1168282815 19:55314608-55314630 CCACCCAAGAGACTACTGAGTCC 0: 1
1: 1
2: 0
3: 8
4: 90
Right 1168282826 19:55314648-55314670 TGTGGCTAAACTGATCATCAGGG 0: 1
1: 0
2: 0
3: 9
4: 132
1168282809_1168282826 28 Left 1168282809 19:55314597-55314619 CCCCACCTACCCCACCCAAGAGA 0: 1
1: 0
2: 2
3: 49
4: 371
Right 1168282826 19:55314648-55314670 TGTGGCTAAACTGATCATCAGGG 0: 1
1: 0
2: 0
3: 9
4: 132
1168282813_1168282826 19 Left 1168282813 19:55314606-55314628 CCCCACCCAAGAGACTACTGAGT 0: 1
1: 0
2: 0
3: 8
4: 161
Right 1168282826 19:55314648-55314670 TGTGGCTAAACTGATCATCAGGG 0: 1
1: 0
2: 0
3: 9
4: 132
1168282819_1168282826 -4 Left 1168282819 19:55314629-55314651 CCCACAGAATGAAGGCCCCTGTG 0: 1
1: 0
2: 0
3: 16
4: 173
Right 1168282826 19:55314648-55314670 TGTGGCTAAACTGATCATCAGGG 0: 1
1: 0
2: 0
3: 9
4: 132
1168282808_1168282826 29 Left 1168282808 19:55314596-55314618 CCCCCACCTACCCCACCCAAGAG 0: 1
1: 0
2: 5
3: 57
4: 535
Right 1168282826 19:55314648-55314670 TGTGGCTAAACTGATCATCAGGG 0: 1
1: 0
2: 0
3: 9
4: 132
1168282814_1168282826 18 Left 1168282814 19:55314607-55314629 CCCACCCAAGAGACTACTGAGTC 0: 1
1: 0
2: 0
3: 6
4: 64
Right 1168282826 19:55314648-55314670 TGTGGCTAAACTGATCATCAGGG 0: 1
1: 0
2: 0
3: 9
4: 132
1168282817_1168282826 13 Left 1168282817 19:55314612-55314634 CCAAGAGACTACTGAGTCCCACA 0: 1
1: 0
2: 0
3: 8
4: 126
Right 1168282826 19:55314648-55314670 TGTGGCTAAACTGATCATCAGGG 0: 1
1: 0
2: 0
3: 9
4: 132
1168282820_1168282826 -5 Left 1168282820 19:55314630-55314652 CCACAGAATGAAGGCCCCTGTGG 0: 1
1: 0
2: 3
3: 18
4: 197
Right 1168282826 19:55314648-55314670 TGTGGCTAAACTGATCATCAGGG 0: 1
1: 0
2: 0
3: 9
4: 132
1168282810_1168282826 27 Left 1168282810 19:55314598-55314620 CCCACCTACCCCACCCAAGAGAC 0: 1
1: 0
2: 1
3: 26
4: 262
Right 1168282826 19:55314648-55314670 TGTGGCTAAACTGATCATCAGGG 0: 1
1: 0
2: 0
3: 9
4: 132
1168282812_1168282826 23 Left 1168282812 19:55314602-55314624 CCTACCCCACCCAAGAGACTACT 0: 1
1: 0
2: 3
3: 14
4: 206
Right 1168282826 19:55314648-55314670 TGTGGCTAAACTGATCATCAGGG 0: 1
1: 0
2: 0
3: 9
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168282826 Original CRISPR TGTGGCTAAACTGATCATCA GGG Intronic
903961823 1:27062761-27062783 TGTGGCTGAAGTCATCATCATGG + Intergenic
906983736 1:50660246-50660268 TGAGGCTAATCTGAGCTTCATGG - Intronic
908971942 1:69846425-69846447 TTTTGGTAAACTAATCATCAGGG - Intronic
909670764 1:78185768-78185790 TGTGGCTACACTGATGAATAAGG + Intergenic
909801285 1:79811408-79811430 TGTGACTAAGCAGATAATCATGG + Intergenic
910073755 1:83251499-83251521 TGTGGCTCAAGTGGACATCACGG - Intergenic
915783425 1:158579713-158579735 TGCAGGTAATCTGATCATCATGG - Exonic
916313182 1:163419211-163419233 TGGGGCCAAACTGATAAGCAGGG + Intergenic
921489513 1:215757500-215757522 TGTGGCTAAACTTATTCTGATGG + Intronic
1064082742 10:12321730-12321752 TGTGTTTATACTGAACATCAGGG + Intergenic
1065832522 10:29627891-29627913 TGTGGCTAAAATGAACATCCGGG + Intronic
1065894933 10:30154905-30154927 TGGTGCTAAACTGCTCATGAAGG + Intergenic
1066151434 10:32623916-32623938 TGGTGCTAAACTGTTCATGAGGG + Intronic
1066633376 10:37478491-37478513 TGTGTTTATACTGAACATCAGGG + Intergenic
1066703152 10:38150972-38150994 TGTGGCTAATCTTATGTTCATGG - Intergenic
1071893659 10:90040912-90040934 TGTTTCTCAACTGGTCATCAGGG + Intergenic
1073634147 10:105180169-105180191 TGGGGATAAAGTAATCATCATGG + Intronic
1079336838 11:19577497-19577519 AGTGGCTACACTGAGCATCTAGG - Intronic
1079362704 11:19782577-19782599 TGTGGCTAAGCTTTTCTTCAGGG + Intronic
1079642370 11:22822654-22822676 TGCCTTTAAACTGATCATCAGGG - Exonic
1081319115 11:41668778-41668800 TGTGGCTGAGCTGATACTCAAGG - Intergenic
1082126413 11:48435917-48435939 TATGGCTAGTCTGATTATCATGG + Intergenic
1082560000 11:54606990-54607012 TATGGCTAGTCTGATTATCATGG + Intergenic
1085653782 11:78293638-78293660 TGTCGCTAAACTGATCACAGTGG - Intronic
1089810942 11:121130772-121130794 TGTGGCTTCCCTGATAATCAAGG - Intronic
1089911620 11:122106311-122106333 TGTGACTTAACTGCTCAGCATGG - Intergenic
1090876057 11:130789812-130789834 TGTGGATCAACTGCCCATCAGGG + Intergenic
1093916395 12:24806924-24806946 TGTGGCTGCAGTGATCACCATGG - Intergenic
1094039422 12:26107237-26107259 TGTGGCCAAGGTGATAATCATGG - Intergenic
1095640639 12:44481730-44481752 TGTGGCTAAGCTGATATACAAGG + Intergenic
1098774512 12:74594911-74594933 TGTGGCTAAAGTGATCAAAGAGG + Intergenic
1100197471 12:92263414-92263436 TGTGGGTAAATTGATGATAATGG + Intergenic
1101074447 12:101114031-101114053 TGAGGCTACACTGATGATCAGGG - Intronic
1106298386 13:28439483-28439505 GGTGGCTACAGTGATCATTATGG + Intronic
1106884202 13:34165817-34165839 TGTGGCTATACTGATCTTACAGG - Intergenic
1109803776 13:67409709-67409731 TGTCACGAAACTTATCATCAAGG + Intergenic
1116579923 14:46627151-46627173 TGTGGATAAATTGGCCATCAGGG + Intergenic
1117289684 14:54320484-54320506 TGTGGCTAGATTGATCACTATGG - Intergenic
1118358736 14:65037963-65037985 TGAGACTAACCTGATCAACATGG - Intronic
1118697069 14:68395520-68395542 TTTCCTTAAACTGATCATCAAGG - Intronic
1120031696 14:79649044-79649066 TGTGGCTAAACTTATCGACCAGG - Intronic
1202848809 14_GL000225v1_random:2594-2616 TGTTTCTGAACTGATCATCCAGG - Intergenic
1124907234 15:33881484-33881506 TGAGGCTCAACTGATCTTCCTGG + Intronic
1126285830 15:47009490-47009512 TGTGTCTAGACATATCATCATGG + Intergenic
1126747460 15:51840678-51840700 TTTGGCTAAATTAAGCATCAGGG - Intronic
1133130783 16:3675036-3675058 TGTGGCTGCACTGAACACCATGG + Intronic
1133717009 16:8459475-8459497 TGAGGCTAAAATGACCATCAAGG + Intergenic
1138334880 16:56245212-56245234 TGCGGCTGAGCTGATGATCAGGG + Intronic
1138900901 16:61268679-61268701 TGAGACTAGACTGATCAACATGG + Intergenic
1140569152 16:76082272-76082294 TGTCTGTAACCTGATCATCACGG + Intergenic
1140932805 16:79643380-79643402 TGTGACCTAACTGATCCTCAAGG - Intergenic
1146626828 17:34441446-34441468 TGTGTCTAAGCTGAACCTCAAGG - Intergenic
1156993611 18:43439863-43439885 TGTGGCTAAGGTGGGCATCACGG + Intergenic
1165254914 19:34570643-34570665 TGTGGCTCAGGTGGTCATCACGG + Intergenic
1167449664 19:49559809-49559831 TGAGGATAAACTGCTCATCCAGG + Intronic
1168282826 19:55314648-55314670 TGTGGCTAAACTGATCATCAGGG + Intronic
924997264 2:373628-373650 TTTGGCTCAACTGATATTCATGG + Intergenic
925122635 2:1431167-1431189 TGGGGCTAAACCATTCATCAGGG - Intronic
926192331 2:10738284-10738306 TGGGCCTAAACTGAAAATCAAGG - Intronic
926586465 2:14691292-14691314 TGTGGCTAAAGGGGGCATCATGG - Intergenic
928430288 2:31212689-31212711 TGTGAATGAACTGAACATCAGGG - Intronic
931487505 2:62707173-62707195 AGTGTCTTGACTGATCATCATGG + Exonic
931534668 2:63260748-63260770 TGAGACTAGCCTGATCATCATGG - Intronic
931842431 2:66168489-66168511 TCTGGCTAATGTGATAATCATGG + Intergenic
932026607 2:68140092-68140114 TGTGGTTAAACTCATCCTCCTGG + Intronic
933005380 2:76986539-76986561 TGTGGCTAATCTGAACATTTTGG + Intronic
934628069 2:95880888-95880910 TGTGGATATACTGATTAACAAGG + Intronic
934805336 2:97218764-97218786 TGTGGGTATACTGATTAACAAGG - Intronic
934832025 2:97536757-97536779 TGTGGATATACTGATTAACAAGG + Intronic
938024429 2:127933827-127933849 TTTGTCTAATCTGAGCATCAGGG - Intergenic
939886744 2:147689488-147689510 TCTGGTTAAAATGATTATCATGG - Intergenic
942962237 2:181844865-181844887 TGTGGCTAAACACATAATTATGG + Intergenic
944651949 2:201839138-201839160 TATAGCTAAACAGATCAACATGG - Intronic
945313976 2:208350594-208350616 TTTTGTTAAACTGATCTTCAGGG - Intronic
946695677 2:222356226-222356248 TGTTGCAAAACTGATCATCTGGG - Intergenic
946727436 2:222674506-222674528 TGTAGGTAAATTGATCATCATGG + Intronic
948700780 2:239758379-239758401 TGTGGCTACACGGAGCAGCAGGG - Intergenic
1169939961 20:10926142-10926164 ATGGGCTAAACTGATCTTCACGG - Intergenic
1176215587 20:63946211-63946233 TGTGGCCAGAATGATCATCGAGG - Exonic
1177522416 21:22244089-22244111 TTTGGCTACTCTGATCATAACGG - Intergenic
1177719489 21:24886261-24886283 TATGGCCAAACTGATCAGCATGG - Intergenic
1178241010 21:30900733-30900755 TCTGGCTAAACTGACCTACAAGG + Intergenic
1180413947 22:12692673-12692695 TGTTTCTGAACTGATCATCCAGG + Intergenic
1181997101 22:26891724-26891746 TGTGGCTGGAGTGGTCATCATGG + Intergenic
949279245 3:2327044-2327066 TGTGGCTTAACTGAACTCCAGGG - Intronic
949458200 3:4261928-4261950 TCTGGCTAAAATGCACATCAAGG - Intronic
949472221 3:4408472-4408494 TGTGGCTAGAGGGATCAGCAAGG + Intronic
949798038 3:7872294-7872316 TCAGGCTAAACAGTTCATCAGGG + Intergenic
950876924 3:16283981-16284003 TGTGGTTAAGGTGAGCATCAAGG + Intronic
952617534 3:35292855-35292877 TGTGGCAACTCTGATCATCGTGG + Intergenic
955903483 3:63782108-63782130 TCTGGCTAATATTATCATCAAGG - Intergenic
958270627 3:91494898-91494920 AGTGGCTAAACTGAGAATTAAGG - Intergenic
961704929 3:128776926-128776948 TGTAGCTCAACTAATCATCAGGG - Intronic
962162359 3:133012940-133012962 TGTGGCTGCACAGATCAGCAGGG - Intergenic
966264573 3:178023622-178023644 TATGGCTAAAATGATTATCAAGG - Intergenic
969098385 4:4751269-4751291 TGTGGCCAACGTGATCATCCGGG - Intergenic
969464327 4:7345946-7345968 TTTGGCTAGACTGAGCATGAAGG - Intronic
970211074 4:13710572-13710594 TCTGGCAGAGCTGATCATCAGGG - Intergenic
980438166 4:132808108-132808130 AGTTGCTGAACTAATCATCAGGG + Intergenic
980671363 4:136010969-136010991 TTTGGCTAAATTTATCAGCAAGG - Intergenic
982652875 4:158108912-158108934 TGTGGTTAAAGAGATCAGCAGGG - Intergenic
984411260 4:179401314-179401336 TGTGGCTAGCCTGGTCAACATGG - Intergenic
987270861 5:16307555-16307577 TATTGCTAAACTGAACATCTAGG - Intergenic
987730129 5:21759466-21759488 GGTGGCTAAAATGATCTTGATGG + Intronic
993478793 5:88397268-88397290 CGTGGCTAAATTGTTAATCAGGG + Intergenic
995595819 5:113746650-113746672 TGGTGCTAAACTGTTCATGAGGG + Intergenic
996669202 5:126097307-126097329 TGGTGCTAAACTGTTCATAAGGG - Intergenic
997500483 5:134370033-134370055 CCTGGCTAACCTGATCACCAAGG + Intronic
1001168859 5:169397519-169397541 TGTGGCTAAAATAATCAGGAGGG - Intergenic
1002395081 5:178946379-178946401 TGTGGCTATACTGTTCACCCAGG + Exonic
1002683180 5:180985601-180985623 TGTGTCTTAACTATTCATCAAGG + Intergenic
1008984517 6:57526446-57526468 AGTGGCTAAACTGAGAATTAAGG + Intronic
1009172565 6:60419338-60419360 AGTGGCTAAACTGAGAATTAAGG + Intergenic
1009897520 6:69771461-69771483 TGTGGCTAAAATGATGCTGATGG - Intronic
1010240687 6:73612849-73612871 TGTGACTAACCTGAGCAACATGG + Intronic
1016418935 6:143864072-143864094 TGTGGCAAAACTGAATATTAAGG + Intergenic
1021013679 7:15504543-15504565 TGTCGCTCAACTGATCATAGTGG + Intronic
1021939560 7:25666211-25666233 TGTTGCTAAACTGATCACGTTGG - Intergenic
1030462597 7:109859078-109859100 TATGGCTAAGCTCAACATCATGG + Intergenic
1031731623 7:125309461-125309483 TGTGACTATTCTGATCAGCAGGG + Intergenic
1033833659 7:145283069-145283091 TGTGCCTAAAAATATCATCAGGG + Intergenic
1035106975 7:156449341-156449363 GGTGGTGACACTGATCATCATGG + Intergenic
1035775885 8:2187823-2187845 TTTGGCTAAAGTGGTGATCAGGG + Intergenic
1039285404 8:36034502-36034524 TGTTGCTAAACTATTCATGAAGG + Intergenic
1042078047 8:65017423-65017445 TGTGATTAAAATGATCATGAAGG - Intergenic
1042796718 8:72671699-72671721 TGTGGCTAAGCTCAGAATCAAGG - Intronic
1045849983 8:106684069-106684091 TGTGTCTAAACTGATTTTAAAGG + Intronic
1047994174 8:130317788-130317810 TGTGGCTGAAGTGATGAACATGG + Intronic
1050996896 9:12231983-12232005 TGTGGCTGCACAGAGCATCAGGG + Intergenic
1055064384 9:72103921-72103943 TGGGGCTAAACTATTCATAAAGG - Intergenic
1057052537 9:91936434-91936456 TGTGGCCAAACTGACCCTTAAGG + Intronic
1060474281 9:123975289-123975311 TGGGCCTAAACTGATTCTCAGGG - Intergenic
1186703178 X:12113379-12113401 GATGGCTAAACTGATCTGCAGGG + Intergenic
1187605536 X:20878386-20878408 TGAAGCCAACCTGATCATCATGG - Intergenic
1188102295 X:26104151-26104173 TGTAGCTATATTGATGATCAGGG + Intergenic
1189868838 X:45360864-45360886 TGTGGCTGAACTGGTATTCAAGG + Intergenic
1197765929 X:130059689-130059711 TTTGGCTAAACAGATCTTTATGG - Intergenic
1200185308 X:154178835-154178857 TGAGGCTAACCTGACCAACATGG + Intergenic
1200190961 X:154215973-154215995 TGAGGCTAACCTGACCAACATGG + Intergenic
1200196712 X:154253775-154253797 TGAGGCTAACCTGACCAACATGG + Intergenic
1200202367 X:154290893-154290915 TGAGGCTAACCTGACCAACATGG + Intronic
1200845001 Y:7822969-7822991 TATTGCTAAACTCAGCATCAAGG - Intergenic