ID: 1168283767

View in Genome Browser
Species Human (GRCh38)
Location 19:55320512-55320534
Sequence TTTGGGGGGATCGCCGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 41
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 36}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168283767_1168283779 10 Left 1168283767 19:55320512-55320534 CCTGCAGCGGCGATCCCCCCAAA 0: 1
1: 0
2: 0
3: 4
4: 36
Right 1168283779 19:55320545-55320567 CGGGCAGAATTACCTGATGTAGG 0: 1
1: 1
2: 1
3: 4
4: 76
1168283767_1168283782 27 Left 1168283767 19:55320512-55320534 CCTGCAGCGGCGATCCCCCCAAA 0: 1
1: 0
2: 0
3: 4
4: 36
Right 1168283782 19:55320562-55320584 TGTAGGGAAAGCCTTTACTGAGG 0: 1
1: 0
2: 2
3: 16
4: 137
1168283767_1168283770 -9 Left 1168283767 19:55320512-55320534 CCTGCAGCGGCGATCCCCCCAAA 0: 1
1: 0
2: 0
3: 4
4: 36
Right 1168283770 19:55320526-55320548 CCCCCCAAATCCCTACCCTCGGG 0: 1
1: 0
2: 1
3: 27
4: 272
1168283767_1168283768 -10 Left 1168283767 19:55320512-55320534 CCTGCAGCGGCGATCCCCCCAAA 0: 1
1: 0
2: 0
3: 4
4: 36
Right 1168283768 19:55320525-55320547 TCCCCCCAAATCCCTACCCTCGG 0: 1
1: 0
2: 3
3: 16
4: 212
1168283767_1168283780 11 Left 1168283767 19:55320512-55320534 CCTGCAGCGGCGATCCCCCCAAA 0: 1
1: 0
2: 0
3: 4
4: 36
Right 1168283780 19:55320546-55320568 GGGCAGAATTACCTGATGTAGGG 0: 1
1: 0
2: 3
3: 11
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168283767 Original CRISPR TTTGGGGGGATCGCCGCTGC AGG (reversed) Intronic
901772515 1:11537463-11537485 TTTTGGGGGATGGCCCCTGTGGG + Exonic
901875264 1:12163890-12163912 TTTTGGGTGGTCGCAGCTGCAGG - Intergenic
903627910 1:24744877-24744899 CTTGGGGAGGTAGCCGCTGCGGG + Intergenic
917975473 1:180235034-180235056 TTTGGGGGACTCGCCGGTGGAGG + Intronic
1063730522 10:8691774-8691796 TTTGGGGCAATCACAGCTGCTGG + Intergenic
1073491478 10:103855702-103855724 TCCGGGGGGATCGGCGCTGGCGG + Intergenic
1076828835 10:132983984-132984006 TCTGGGGGGCTCCCCGCTGCTGG + Intergenic
1077487971 11:2847846-2847868 TCTGGGGGGGCCGCCGCTGCCGG - Exonic
1079172043 11:18105804-18105826 TTTGTGGGGATGGCGGCTCCCGG + Intronic
1082756599 11:57082974-57082996 TTTGGGGCGATTCCAGCTGCTGG - Intergenic
1096675044 12:53221704-53221726 TTTCCGGGAGTCGCCGCTGCTGG - Intronic
1105514119 13:21075821-21075843 CTTGGGGAGAACGCCGCCGCCGG - Intergenic
1113848683 13:113405929-113405951 TGTGGGGCGATGGCAGCTGCAGG - Intergenic
1113856108 13:113446235-113446257 TCTGGGGGGTTTGCAGCTGCAGG - Intronic
1117922347 14:60738495-60738517 TTTGGGAGGATCGAGGCGGCTGG - Intronic
1117996514 14:61483133-61483155 TTTGGAGGGATGGCCACTGATGG - Intronic
1202859495 14_GL000225v1_random:72535-72557 TGTTGGGGGATCCCCTCTGCTGG + Intergenic
1124610487 15:31204605-31204627 TGTGGGGGGCTTGCCGCTGTAGG + Intergenic
1150867636 17:68870395-68870417 TTTGGGGTGATTCCGGCTGCAGG + Intronic
1152609850 17:81310149-81310171 TTGGGGGGGTGCGCAGCTGCTGG - Intergenic
1155245461 18:23904486-23904508 TTTGGGGGGATGTCAGCTGCTGG + Intronic
1160809645 19:1007849-1007871 CTTGGGGGGGTCGCTCCTGCTGG - Exonic
1168283767 19:55320512-55320534 TTTGGGGGGATCGCCGCTGCAGG - Intronic
1172130668 20:32652734-32652756 TTTGGGGGGCTTCCTGCTGCTGG + Intergenic
1174507229 20:51024229-51024251 TTTGGAGGGATCTGTGCTGCTGG + Intergenic
1175894301 20:62329294-62329316 TCTGGGGGCCTCCCCGCTGCAGG - Intronic
1176373465 21:6076083-6076105 TCTGGGGCAATCGCCGCTGTTGG - Intergenic
1179750012 21:43462160-43462182 TCTGGGGCAATCGCCGCTGTTGG + Intergenic
1180736942 22:18024389-18024411 CTGGGCGGGATCGCAGCTGCAGG - Exonic
953465235 3:43114100-43114122 TTTGGGGGCATTGCAGCTACAGG - Intergenic
953684638 3:45067057-45067079 TTTGAGGGCATCACTGCTGCTGG - Intergenic
966316873 3:178657185-178657207 TTTGTGGGGATCGTAGCAGCAGG - Intronic
968585673 4:1414897-1414919 TCTGGGGGGAGGGCAGCTGCGGG - Intergenic
987083817 5:14450148-14450170 TTTGGTGAGATCGACGCGGCCGG + Intronic
1009848552 6:69165390-69165412 TTGGGGGGGATGGCTGCCGCGGG - Intronic
1026445688 7:70482614-70482636 TTTGGGGGGAGGGCCTCTGCAGG + Intronic
1039454320 8:37697383-37697405 TTTGCGGGAGTCGCCGCCGCCGG - Exonic
1051284710 9:15484225-15484247 TTTGGGAGGATCACCGAGGCTGG + Intronic
1062206513 9:135340552-135340574 TTTGGGGGCAGTGCAGCTGCGGG - Intergenic
1186937872 X:14471056-14471078 TTTGGGGGGGTCTCAGCTGATGG - Intergenic
1196695436 X:118606681-118606703 TTTGCGGGCATCGCTGCTGTTGG + Intronic