ID: 1168283768

View in Genome Browser
Species Human (GRCh38)
Location 19:55320525-55320547
Sequence TCCCCCCAAATCCCTACCCT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 212}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168283766_1168283768 -3 Left 1168283766 19:55320505-55320527 CCACTTTCCTGCAGCGGCGATCC 0: 1
1: 0
2: 0
3: 1
4: 73
Right 1168283768 19:55320525-55320547 TCCCCCCAAATCCCTACCCTCGG 0: 1
1: 0
2: 3
3: 16
4: 212
1168283767_1168283768 -10 Left 1168283767 19:55320512-55320534 CCTGCAGCGGCGATCCCCCCAAA 0: 1
1: 0
2: 0
3: 4
4: 36
Right 1168283768 19:55320525-55320547 TCCCCCCAAATCCCTACCCTCGG 0: 1
1: 0
2: 3
3: 16
4: 212
1168283762_1168283768 21 Left 1168283762 19:55320481-55320503 CCTGGGCAATCCAAGCTAGGGCC 0: 1
1: 0
2: 1
3: 7
4: 78
Right 1168283768 19:55320525-55320547 TCCCCCCAAATCCCTACCCTCGG 0: 1
1: 0
2: 3
3: 16
4: 212
1168283765_1168283768 0 Left 1168283765 19:55320502-55320524 CCTCCACTTTCCTGCAGCGGCGA 0: 1
1: 0
2: 1
3: 2
4: 111
Right 1168283768 19:55320525-55320547 TCCCCCCAAATCCCTACCCTCGG 0: 1
1: 0
2: 3
3: 16
4: 212
1168283763_1168283768 11 Left 1168283763 19:55320491-55320513 CCAAGCTAGGGCCTCCACTTTCC 0: 1
1: 0
2: 2
3: 14
4: 184
Right 1168283768 19:55320525-55320547 TCCCCCCAAATCCCTACCCTCGG 0: 1
1: 0
2: 3
3: 16
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168283768 Original CRISPR TCCCCCCAAATCCCTACCCT CGG Intronic
900420249 1:2553135-2553157 TCACCCCAAATCAGGACCCTGGG - Intergenic
900424181 1:2568523-2568545 TCACCCCAAATCAGGACCCTGGG + Intergenic
900529589 1:3146189-3146211 CCACCCCAACTCCTTACCCTCGG + Intronic
900715020 1:4138679-4138701 TCTTCCCAATTTCCTACCCTGGG + Intergenic
901051043 1:6426043-6426065 TTCATCCAAATCCCTAACCTCGG - Intronic
904287627 1:29462311-29462333 CCCCCCCAACTCCTTGCCCTAGG + Intergenic
904994193 1:34618230-34618252 TGCTCCCCAACCCCTACCCTGGG + Intergenic
905170114 1:36104962-36104984 TCCCCTCGAATCCCTGCTCTGGG + Intronic
905768111 1:40620080-40620102 TACCCCCCAAACCCAACCCTAGG + Intergenic
905937671 1:41837752-41837774 TCCCCCTGAATCCCTAGCCCTGG + Intronic
905973509 1:42158049-42158071 TCCTCCCAAACCCCAACCCCTGG + Intergenic
906161326 1:43650936-43650958 TTCCCCCAAATCTGTTCCCTGGG - Intronic
915773930 1:158461806-158461828 TCCCCACAAATCCCCAAGCTAGG - Intergenic
919618297 1:199835052-199835074 TGCCCCCAACTCCCAACCCAGGG + Intergenic
919724156 1:200871347-200871369 TGCCCCCACCTTCCTACCCTGGG + Intergenic
920442251 1:205989070-205989092 TCCCTACAAACCCCTTCCCTGGG + Intronic
920742149 1:208591155-208591177 GCCCCCTAACTCCCCACCCTCGG + Intergenic
1063689022 10:8266070-8266092 TCCCTCTAAATGTCTACCCTGGG + Intergenic
1064209357 10:13349608-13349630 TCACACCAAATCCCTTCCCTGGG - Intergenic
1070769084 10:79071785-79071807 TCCCTCCAAATGCATTCCCTGGG - Intronic
1070797264 10:79223916-79223938 TCCCCCCAATTCCTTGGCCTGGG - Intronic
1070797738 10:79226618-79226640 TCCCCTGAAATCCCTCCTCTGGG - Intronic
1071840838 10:89469689-89469711 TCAGCCCAAATGCCCACCCTTGG - Intronic
1072796099 10:98355624-98355646 TCTCCCCAACTCCCTATCATAGG - Intergenic
1073189909 10:101643837-101643859 CCCCCCCACTTCCCTACCCCAGG - Intronic
1074874350 10:117602603-117602625 ACCCACCAACTCCCAACCCTTGG - Intergenic
1075511918 10:123079296-123079318 TTCCCCCAGCTCCCTACCCATGG - Intergenic
1077239154 11:1501642-1501664 TCTCCCCCAGTCCCTTCCCTTGG - Intergenic
1077407634 11:2389717-2389739 TCCTCCCAAGTCCCTTCCCAGGG + Intronic
1077420622 11:2448223-2448245 CCCCCTCAAATCCCTCTCCTTGG - Intronic
1077717964 11:4600366-4600388 TCCCCCGCTATCCCTTCCCTGGG - Exonic
1078611072 11:12820019-12820041 TCCCCACAACTCCCTGCCCCAGG - Intronic
1081807037 11:45896423-45896445 TCCCCCCAAAAGCCAGCCCTTGG - Intronic
1083920618 11:65780088-65780110 TCGCCCCAGATCGCTACCCGCGG + Exonic
1084062731 11:66686718-66686740 TCTTCCCAGATCCCTACCTTTGG + Intronic
1084547584 11:69822170-69822192 GCCCCCCAGACCCCCACCCTGGG + Intergenic
1084562315 11:69911811-69911833 TCCCCCAACACCCCCACCCTGGG - Intergenic
1085319383 11:75564752-75564774 TCTCCCCACCTCCCTCCCCTTGG + Intronic
1085687728 11:78639128-78639150 TCCCCCCAAACCCCCACCATGGG + Intergenic
1088409905 11:109522850-109522872 TCTCCCCAAATCCCTCTCCTTGG + Intergenic
1088558740 11:111090578-111090600 TCCCCCCAAATTCTTACTCCTGG - Intergenic
1089124182 11:116164769-116164791 TTACCCCACATCCCTTCCCTGGG + Intergenic
1089790539 11:120940033-120940055 TCCTCCCAAGCCCCTACCCTAGG + Intronic
1090610988 11:128470343-128470365 TACCCTCAACTCCCTACCCGGGG - Intronic
1090628940 11:128629341-128629363 TCCCCTCAAATCCCTCCCTTTGG - Intergenic
1091067244 11:132526885-132526907 TCTCCCCTAATCCCTACCCTAGG + Intronic
1095465654 12:42485448-42485470 TTCCCACAAATCCCTAAACTAGG - Intronic
1096582179 12:52592729-52592751 TCCCTCCAAGTCCCTTGCCTGGG - Intronic
1100990162 12:100243482-100243504 ATCCCCCAACTTCCTACCCTTGG + Intronic
1105413696 13:20192278-20192300 TCCGCCCAAATCTCTGCCCGGGG + Intronic
1105435110 13:20370043-20370065 TCCCTCCAAACCCCTGCCCCAGG - Intergenic
1105988053 13:25588875-25588897 TCCCCTCCAATCCACACCCTCGG - Intronic
1106968023 13:35096637-35096659 TCCCCCTAAATCACTAACTTTGG + Intronic
1107141048 13:36999092-36999114 TTCCCCCAAATTCCTGACCTCGG - Intronic
1107905768 13:45059896-45059918 TGCCCCCAAATCCCACTCCTAGG + Intergenic
1110941751 13:81359626-81359648 TTCCCCCTCTTCCCTACCCTTGG + Intergenic
1111577049 13:90168662-90168684 TCCTCTCACATTCCTACCCTTGG - Intergenic
1115535232 14:34366668-34366690 TCCTCCCCACTCCCTGCCCTGGG - Intronic
1117242521 14:53849123-53849145 TCAGCCCTAATCCCTACCCTGGG + Intergenic
1118257735 14:64219983-64220005 TCCTCCAAAACCCCTGCCCTGGG - Intronic
1118598544 14:67454783-67454805 TCTTCCCAACTCCCTAGCCTAGG - Intronic
1118708822 14:68503178-68503200 TCCCTCCAAATCCATTCCCAAGG - Intronic
1119896916 14:78228052-78228074 TCTCCCCATCTCCATACCCTTGG - Intergenic
1121337808 14:93087907-93087929 TTCCCCCACATCCCTTCCCTGGG - Intronic
1122362195 14:101174178-101174200 TCCTCCCCCATCCCCACCCTGGG + Intergenic
1122917993 14:104867607-104867629 TCACCCCAAGACCCAACCCTGGG - Intronic
1124953591 15:34345138-34345160 TCCCCCAAAAGGCCTTCCCTGGG - Intronic
1125531829 15:40418571-40418593 TGCCCCCAGGTGCCTACCCTGGG - Exonic
1125531843 15:40418609-40418631 TGCCCCCAGGTGCCTACCCTGGG - Exonic
1127820454 15:62650119-62650141 TCCAGCCAAATCCCTTTCCTCGG - Exonic
1129169418 15:73798603-73798625 CCCCTCCAAAGCCCTGCCCTTGG + Intergenic
1129252092 15:74314684-74314706 AACCCCCAAATCCCCACCCCAGG - Intronic
1129298469 15:74612478-74612500 GCCTCCCAACTCCCAACCCTGGG + Intronic
1131358837 15:91771183-91771205 CCTCCCCAAACCCCTACACTGGG + Intergenic
1133741406 16:8654402-8654424 TTCCCCCAATTCCATGCCCTGGG - Intergenic
1133919194 16:10137065-10137087 TATCCACAAATCCCTACCGTTGG + Intronic
1134249438 16:12564008-12564030 ACTCCTCAACTCCCTACCCTGGG - Intronic
1135221911 16:20621335-20621357 GCCCCCCAGGACCCTACCCTGGG - Intronic
1135691037 16:24538172-24538194 TCTCCCCCAACCCCTACCTTCGG - Intronic
1135935339 16:26775096-26775118 TGCACCCACATCCCTGCCCTAGG + Intergenic
1136985043 16:35094713-35094735 TTTCCCCAACTCCCTATCCTGGG - Intergenic
1136993169 16:35169601-35169623 GCCCCCCAAACCCCTACCGATGG + Intergenic
1137305044 16:47190874-47190896 TCCCACCAAACCCCAACCCCAGG - Intronic
1137582006 16:49639293-49639315 TCCCCTCAAATCCCTAATCCTGG + Intronic
1138488194 16:57360265-57360287 GCCCTCCAAGACCCTACCCTTGG - Intronic
1139129094 16:64118686-64118708 TTCCCCCAAGGTCCTACCCTTGG - Intergenic
1139954503 16:70686625-70686647 GCCCCCCAAATGCCCAGCCTTGG - Intergenic
1140311777 16:73856415-73856437 TCCCCCCAACCCCCACCCCTTGG + Intergenic
1142420383 16:89966227-89966249 TCCCCCCAGCTCCCTGCCCATGG - Exonic
1142433733 16:90044273-90044295 TCCCCACAAAGCCTGACCCTGGG + Exonic
1145166082 17:20614273-20614295 TCCCCCCAACTCCCTGCCCATGG - Intergenic
1146371849 17:32269492-32269514 TCACCCCAAATCCTCACCCCAGG - Intronic
1146547454 17:33751085-33751107 TCCCCACCCGTCCCTACCCTGGG - Intronic
1146798321 17:35798652-35798674 TCCACCCATATGCTTACCCTGGG + Intronic
1147605722 17:41772729-41772751 CCACCCCAGATCCCTAGCCTGGG - Intronic
1148212066 17:45814634-45814656 TCCCCCCAAGTCCCTGTCCCCGG + Intronic
1151391047 17:73786788-73786810 TCCCACCCCACCCCTACCCTGGG - Intergenic
1151850687 17:76687999-76688021 TCCCACCCCATCCCTCCCCTCGG + Intronic
1153766876 18:8383478-8383500 CCCCACAAAATTCCTACCCTTGG - Intronic
1153903152 18:9636857-9636879 TCCCCCTTACCCCCTACCCTGGG - Intergenic
1155404988 18:25477997-25478019 TCCCACCAAATCCATAGCTTGGG + Intergenic
1158393698 18:57063581-57063603 ACCCTCCAAATCCCCATCCTAGG + Intergenic
1160136250 18:76274184-76274206 TCCCCTCAAATCCCTCACCCAGG + Intergenic
1160657700 19:281875-281897 TACCCCCAAAGTCCTCCCCTGGG - Intronic
1160827345 19:1086741-1086763 TCCTCACACATCCCTCCCCTAGG - Exonic
1161610023 19:5237380-5237402 TCTCCCCAACTCCCTGTCCTGGG + Intronic
1163291295 19:16381097-16381119 CCCCACCAGATCCCTTCCCTGGG + Intronic
1165526167 19:36356643-36356665 ACGCCCTACATCCCTACCCTTGG + Intronic
1165715649 19:38044167-38044189 TCCCTGCAAACCCCGACCCTGGG - Intronic
1166142616 19:40813221-40813243 TCCCCCCCAACCCCCATCCTAGG + Intronic
1166386784 19:42386975-42386997 TCCACCCAGATTCCTACCCTGGG + Intergenic
1167048651 19:47066276-47066298 GCCCCCAAGTTCCCTACCCTGGG + Exonic
1167134761 19:47609750-47609772 CCTCCCCAAATCCCTCCCGTGGG + Intronic
1167277105 19:48545329-48545351 TCCCCCCAACCCCCTTCCCCAGG + Intergenic
1168063532 19:53907234-53907256 TCCCCCCAGACCCCGCCCCTGGG + Exonic
1168283768 19:55320525-55320547 TCCCCCCAAATCCCTACCCTCGG + Intronic
1168721231 19:58555999-58556021 GCCCCCCAAACCCCTACCCATGG + Exonic
925663191 2:6224426-6224448 TTCCCCCACAGCCCCACCCTAGG - Intergenic
927011976 2:18913566-18913588 TCCCTCCAAATCTCTCCACTTGG + Intergenic
929713949 2:44292202-44292224 TCCCCAGCAGTCCCTACCCTGGG - Intronic
930237354 2:48900739-48900761 TTCCTCCACATCCCTTCCCTTGG + Intergenic
932758794 2:74426342-74426364 TCCCCCCAGACCACTCCCCTAGG - Exonic
934053036 2:88226129-88226151 TGCCTCCAAGTCCCCACCCTCGG - Intergenic
937312138 2:120908984-120909006 GCACCCCAATTCCCCACCCTGGG - Intronic
937916362 2:127100982-127101004 CCCCCGCACATTCCTACCCTTGG - Intronic
938153903 2:128911200-128911222 TCCCCCCTAATTCAAACCCTTGG + Intergenic
941373733 2:164701874-164701896 TCCCACCACATCCCCAGCCTTGG - Intronic
944777438 2:202981163-202981185 TCCCCCCAACTCTCCACCCTGGG - Intronic
946871760 2:224091318-224091340 TCCCCCAAAATCTCTTCCCCCGG - Intergenic
947528836 2:230895783-230895805 TCCACCCACATCCACACCCTTGG + Intergenic
948944305 2:241211646-241211668 TCCCCTCAGAGCCCTACCCTTGG - Intronic
1170315462 20:15035975-15035997 TCCCCCCATTCCCCTTCCCTTGG - Intronic
1170697781 20:18675235-18675257 TTCCCCCAGAGCCCTAGCCTTGG + Intronic
1171047846 20:21827655-21827677 TCCCCCCATGTCTCTACTCTGGG + Intergenic
1172037773 20:32021887-32021909 TATCCCCAAATGCCTATCCTGGG + Intronic
1172165213 20:32894594-32894616 TCCTCCCAAGTCCATACACTGGG - Intronic
1172515320 20:35528976-35528998 TCCGCCCAAATCCCTGCCCTTGG - Intronic
1172529174 20:35618489-35618511 GCCCCCCAATTTCCCACCCTAGG - Intronic
1175440840 20:58990030-58990052 TCCCCACAAAACCCTTCCCATGG + Intronic
1175690080 20:61058713-61058735 TCCCCCAAAGTCCCTGCCTTGGG + Intergenic
1176015247 20:62927508-62927530 CCCCCCCAGGTCCCTGCCCTCGG - Intronic
1181942121 22:26486079-26486101 TGCCCCACAATCCCTACCATTGG - Intronic
1182662574 22:31935415-31935437 GCCTCCCAAAGCCCAACCCTGGG - Intronic
1182820873 22:33214989-33215011 TGCCCCCAAGGCCCTACTCTGGG + Intronic
1182830844 22:33303419-33303441 TCCCCCAAAGTCCCTGCCGTGGG - Intronic
1183433585 22:37780707-37780729 TCCTCCCTAATCCCGGCCCTGGG - Intergenic
1184836533 22:47026306-47026328 TCCCCCCAAATCGGAAACCTGGG + Intronic
954252556 3:49379360-49379382 CACCCCCAAGTCCCTGCCCTAGG - Intronic
955483929 3:59416965-59416987 TCCCCCCAAACCCATATCCCAGG + Intergenic
960696965 3:120405899-120405921 TCCTCCCAAATCCTTTCCCTAGG + Intronic
960773387 3:121220131-121220153 TCTCCCCAACTCCTAACCCTTGG + Intronic
961479719 3:127171964-127171986 TCCCCCAAAATCCCTCCACATGG - Intergenic
961954025 3:130782052-130782074 TCCCTCCCTCTCCCTACCCTTGG - Intergenic
963603985 3:147398502-147398524 GCCCCCCAACCCCCGACCCTCGG - Intronic
964717871 3:159741801-159741823 TCCCCTCAAATCCATACTCCTGG - Intronic
967043244 3:185713505-185713527 TCCCCTCAAACCCCTGCCTTTGG - Intronic
967930398 3:194686675-194686697 TCCCCCCAACTCCCTACCACAGG + Exonic
969690248 4:8700187-8700209 TCCCCCCAATAACCCACCCTTGG - Intergenic
972963433 4:44481422-44481444 TCCCCCTAATCCCCTACCCCAGG - Intergenic
979347384 4:119604683-119604705 ACACCCCAAATCCCGGCCCTCGG + Intronic
979512881 4:121574210-121574232 TCACCCCCAACCCCTAGCCTGGG + Intergenic
985449841 4:190055250-190055272 TCCCTCCACATCCCCACCATGGG - Intergenic
987032839 5:13991444-13991466 TTCCCCCTAATCCCTACCCTTGG - Intergenic
989169460 5:38460157-38460179 TCCCTACAAATCCCCACCCTGGG + Intronic
989294742 5:39811314-39811336 ACCCCCTTAATCCCAACCCTCGG - Intergenic
991066382 5:62429169-62429191 TCCCCCCAATTCCCCAGCCTAGG + Intronic
991895007 5:71386216-71386238 TCCTCAAATATCCCTACCCTTGG + Intergenic
994522837 5:100863103-100863125 TCCACCCAAGACCCTACCTTTGG - Intronic
996580919 5:125031409-125031431 TCCTCCCAAAGCCCTTCCCCTGG + Intergenic
997119977 5:131164477-131164499 TCCACCCCAAGGCCTACCCTGGG - Intronic
998711646 5:144832639-144832661 TCAGGCCAAATCCCTGCCCTTGG + Intergenic
999096490 5:148982759-148982781 TGCCCCCATTTCCCTACCATAGG - Intronic
999240535 5:150124900-150124922 TCCCCCCACTCCCCTACCCCCGG + Intronic
999314591 5:150575551-150575573 GCCCCCCACATCCCCAGCCTGGG - Intergenic
1001085722 5:168698996-168699018 ACCCCCCCAATCCCTCGCCTGGG + Intronic
1001814396 5:174655822-174655844 TGCCCCCAAAACCCTACACAGGG - Intergenic
1005044480 6:21628901-21628923 TCCCCCCAAACCCTGAACCTTGG - Intergenic
1005997585 6:30940782-30940804 TGCCCCCAGATCCCACCCCTCGG + Intergenic
1006132396 6:31877470-31877492 TCCTCCCTAATCCCTCCCCAGGG + Intronic
1006714494 6:36107325-36107347 TCCTCCAAAATACCTACTCTAGG - Intronic
1007287481 6:40758102-40758124 TCTCCACAACTCTCTACCCTTGG - Intergenic
1013193247 6:107821759-107821781 CCTCCCCAAGTCCCTGCCCTCGG - Intronic
1013327634 6:109063335-109063357 TCCCCCCAACCCCCTGCCCAAGG - Intronic
1014002926 6:116385059-116385081 CTGCCCCAAATGCCTACCCTAGG - Intronic
1014827537 6:126063813-126063835 TCCTCCCAGATTTCTACCCTGGG - Intergenic
1015274306 6:131368377-131368399 CCCCCCAAAATCAATACCCTGGG + Intergenic
1016041072 6:139432359-139432381 TCCCCTCACATCCTTACCCATGG + Intergenic
1016310549 6:142728829-142728851 GCCCCCCACCTCCCCACCCTGGG - Intergenic
1017057771 6:150453472-150453494 TCCCCCCATATGGCCACCCTTGG + Intergenic
1019417733 7:935057-935079 TCCCCTCAAATCCCCACACCTGG - Intronic
1019654750 7:2185210-2185232 TCCCCCCTAGTCCCAGCCCTGGG + Intronic
1022114469 7:27250086-27250108 TCCCCCCACATCCCCAACCCCGG + Intergenic
1022573445 7:31475193-31475215 TCCCCTCCCACCCCTACCCTTGG - Intergenic
1026431959 7:70356700-70356722 TCCCCCCACCTCCCCACCCCTGG + Intronic
1026576902 7:71579513-71579535 TCCTCCCAACTCCCTAGACTAGG - Intronic
1026953979 7:74365322-74365344 TCCCCTGAAATGCCTGCCCTTGG - Intronic
1027130129 7:75584798-75584820 TCCACCTAAAATCCTACCCTAGG + Intronic
1027420362 7:78012481-78012503 TTCCCCCAGCTCCCTCCCCTTGG + Intergenic
1029256360 7:99272379-99272401 TCACTCCACATCCCTGCCCTTGG + Intergenic
1032540729 7:132700713-132700735 TTCCCCCAATTCCCTCCCCAAGG + Intronic
1033932132 7:146537057-146537079 TCTCCCCAAATCCATGCCTTAGG - Intronic
1034084032 7:148307268-148307290 TATCCCCAGATCCCTACCCCAGG - Intronic
1034818938 7:154198979-154199001 TCCTCCCAAATCCTTCACCTGGG + Intronic
1035373178 7:158392055-158392077 TCCTCACAATTCCCTCCCCTGGG - Intronic
1036753370 8:11456879-11456901 TCCCCCCATTTCCCTAACCCAGG - Intronic
1037059749 8:14492986-14493008 ACCCCCCAACTCTCTAACCTGGG + Intronic
1037472683 8:19225783-19225805 TCCCCCCTGATCTCTGCCCTTGG - Intergenic
1039178555 8:34837482-34837504 GCCTCCCAAATCCCTCTCCTGGG + Intergenic
1039864838 8:41491245-41491267 CTCCCCCAAATCCCCACCCCGGG + Intronic
1049748913 8:144274437-144274459 TGGCCCCAAATCACTCCCCTAGG + Intronic
1050745689 9:8873416-8873438 TCCTCTTCAATCCCTACCCTTGG - Intronic
1051288674 9:15523328-15523350 TCCTCCCAATTCCTAACCCTTGG + Intergenic
1051608469 9:18939295-18939317 GCCCCCCAACACCCTACCCATGG + Intronic
1051809948 9:21037182-21037204 TCTCCCCAGCTCCCTACCCCAGG - Intergenic
1052953466 9:34232571-34232593 TGCCCCCTACTCCCAACCCTTGG - Intronic
1056710166 9:88986056-88986078 TTTCCCCTAATCCCTTCCCTTGG - Intergenic
1057976014 9:99607125-99607147 TCCCCCCACACCGCTTCCCTTGG + Intergenic
1058005954 9:99914442-99914464 TGGCCCCAAATGCATACCCTTGG + Intronic
1058756164 9:108084802-108084824 ACCCACCAAATCCCAACCATGGG - Intergenic
1061181982 9:129029722-129029744 TGACCCCAAATGCCTTCCCTTGG + Intergenic
1062389996 9:136330070-136330092 TCACCCCAAAGCCCTGCTCTGGG - Intronic
1185457454 X:318088-318110 TCCCCTCAAAGCCCCGCCCTGGG + Intronic
1186461944 X:9754768-9754790 TTCCCCCACATCCCCACCGTGGG + Intronic
1188092278 X:25977733-25977755 TCCCCACAAAACCCTATCCAAGG + Intergenic
1189318554 X:40073381-40073403 CCCCACCAATTCCCTACCCCAGG - Exonic
1190134291 X:47781274-47781296 TCCTCCCATATCCCTCCCCAGGG - Intergenic
1190889167 X:54554081-54554103 TTGCCCCTATTCCCTACCCTCGG - Intronic
1192844923 X:74896617-74896639 TCCCACTAATTCCTTACCCTGGG + Intronic
1194209471 X:91053698-91053720 TTCACCCATATCCCAACCCTAGG - Intergenic
1197753245 X:129979905-129979927 GCCCCCCACTTCCCCACCCTGGG - Intergenic
1198880011 X:141270573-141270595 TTCCCCCATATCCCTGCCCCTGG + Intergenic
1200080414 X:153573503-153573525 TCCCCCAAGAGCCCTGCCCTAGG + Intronic