ID: 1168283770

View in Genome Browser
Species Human (GRCh38)
Location 19:55320526-55320548
Sequence CCCCCCAAATCCCTACCCTC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 272}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168283767_1168283770 -9 Left 1168283767 19:55320512-55320534 CCTGCAGCGGCGATCCCCCCAAA 0: 1
1: 0
2: 0
3: 4
4: 36
Right 1168283770 19:55320526-55320548 CCCCCCAAATCCCTACCCTCGGG 0: 1
1: 0
2: 1
3: 27
4: 272
1168283763_1168283770 12 Left 1168283763 19:55320491-55320513 CCAAGCTAGGGCCTCCACTTTCC 0: 1
1: 0
2: 2
3: 14
4: 184
Right 1168283770 19:55320526-55320548 CCCCCCAAATCCCTACCCTCGGG 0: 1
1: 0
2: 1
3: 27
4: 272
1168283762_1168283770 22 Left 1168283762 19:55320481-55320503 CCTGGGCAATCCAAGCTAGGGCC 0: 1
1: 0
2: 1
3: 7
4: 78
Right 1168283770 19:55320526-55320548 CCCCCCAAATCCCTACCCTCGGG 0: 1
1: 0
2: 1
3: 27
4: 272
1168283765_1168283770 1 Left 1168283765 19:55320502-55320524 CCTCCACTTTCCTGCAGCGGCGA 0: 1
1: 0
2: 1
3: 2
4: 111
Right 1168283770 19:55320526-55320548 CCCCCCAAATCCCTACCCTCGGG 0: 1
1: 0
2: 1
3: 27
4: 272
1168283766_1168283770 -2 Left 1168283766 19:55320505-55320527 CCACTTTCCTGCAGCGGCGATCC 0: 1
1: 0
2: 0
3: 1
4: 73
Right 1168283770 19:55320526-55320548 CCCCCCAAATCCCTACCCTCGGG 0: 1
1: 0
2: 1
3: 27
4: 272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168283770 Original CRISPR CCCCCCAAATCCCTACCCTC GGG Intronic
900742678 1:4340210-4340232 CTCCCCAACTCCCTCCCCTGTGG - Intergenic
902299799 1:15493811-15493833 CACCCCAAATCCCCAGCCCCAGG + Intronic
902375043 1:16026608-16026630 GCCCCCGAGTCCCTAACCTCAGG - Exonic
902380014 1:16048415-16048437 GCCCCCGAGTCCCTAACCTCAGG - Exonic
903776900 1:25799496-25799518 GCCCCCCAACCCCCACCCTCCGG - Intergenic
904912043 1:33942351-33942373 CACCCCAAATCCTCTCCCTCAGG - Intronic
905361933 1:37426809-37426831 CCTCAGTAATCCCTACCCTCAGG + Intergenic
906230459 1:44158277-44158299 TCCCCCAAATCTATAACCTCAGG + Intergenic
907412526 1:54292652-54292674 CCACCCCAATCCCAGCCCTCAGG + Intronic
911752110 1:101507345-101507367 GCTCCCAAATTCCTAGCCTCAGG - Intergenic
913470859 1:119184264-119184286 TCACCCAAACCCCTAGCCTCTGG + Intergenic
915586486 1:156846503-156846525 CCCTCCAAATGCCTACCTGCAGG + Exonic
915818304 1:158993678-158993700 TCCTCCAACTCTCTACCCTCAGG + Intergenic
916954701 1:169820036-169820058 ACCCCCAAATTCCTGTCCTCTGG + Intronic
917022935 1:170610086-170610108 CCCCAAAACTCCCTACTCTCAGG - Intergenic
918590278 1:186233190-186233212 GCCCCCAAATCACCACTCTCTGG + Intergenic
920742151 1:208591156-208591178 CCCCCTAACTCCCCACCCTCGGG + Intergenic
921161210 1:212473226-212473248 ACCCCCAACTCCCCACCATCTGG - Intergenic
921283061 1:213585994-213586016 CCCCCCAGATACCAGCCCTCAGG + Intergenic
924017890 1:239747571-239747593 CCTATCAAATCCCTACCCTTCGG + Intronic
1063015867 10:2076512-2076534 TCCCCCAAAACCCTCCACTCAGG + Intergenic
1065180575 10:23120662-23120684 CCCCCAAAATCACTCCACTCCGG - Intronic
1066166302 10:32791202-32791224 CTACCCAAAACACTACCCTCTGG + Intronic
1066513951 10:36134262-36134284 CCTCCCAAATCCATTCCCTCAGG + Intergenic
1067525973 10:47038893-47038915 CCCCACAGATCCCCTCCCTCAGG + Intergenic
1068676608 10:59775995-59776017 TCCCCCAACCCTCTACCCTCTGG - Intergenic
1070637304 10:78139676-78139698 CGCCCCAAATTCCCACCATCTGG - Intergenic
1071405169 10:85323000-85323022 CCCACCAAATCCATCCCCTCTGG - Intergenic
1073760778 10:106626193-106626215 CCTCCCCAGTTCCTACCCTCAGG - Intronic
1074681792 10:115914415-115914437 ACCCCCAAATCCCTGCTCTTTGG - Intronic
1074874348 10:117602602-117602624 CCCACCAACTCCCAACCCTTGGG - Intergenic
1075445385 10:122509415-122509437 CCCCCCACATCCCTGCCCGCTGG - Intronic
1075594074 10:123715166-123715188 CCCACCCTATCCCTAGCCTCAGG + Intronic
1076097794 10:127746549-127746571 CCTCCCCAATCCCTCCCCTTTGG - Intergenic
1077445606 11:2589233-2589255 ATCCCCAAACCCCTTCCCTCTGG - Intronic
1078475483 11:11625534-11625556 ACCCCCAAATCCTGACACTCTGG - Intergenic
1078752123 11:14175284-14175306 ACCCCCAAATTCCTGTCCTCTGG + Intronic
1080028510 11:27636830-27636852 ACCCCCAAATTCCTGTCCTCTGG + Intergenic
1081523327 11:43904289-43904311 CTTCCCAAATCCCTTTCCTCAGG - Intronic
1082204124 11:49410934-49410956 CCCCCCAACTCCCTGCCGACAGG - Intergenic
1085680644 11:78571753-78571775 CCTCCCAGAGCCCTGCCCTCTGG + Intronic
1085861620 11:80242662-80242684 TCCCCCAAAGCCCTACCACCAGG - Intergenic
1086563211 11:88192883-88192905 CCCCCCAACCCTCCACCCTCAGG + Intergenic
1088594553 11:111430635-111430657 CCCCCCAAATCCCTAAGCCAAGG - Intronic
1088707195 11:112474548-112474570 CCCCCCAAACCCTGACCCTCTGG - Intergenic
1089167662 11:116489540-116489562 ACCCCAAACTCCCTATCCTCTGG + Intergenic
1089957626 11:122586510-122586532 CCCCTGTAATCCCAACCCTCTGG + Intergenic
1091905890 12:4188900-4188922 CTCCCCCAACCCCTGCCCTCAGG - Intergenic
1092486785 12:8909011-8909033 CCTCCCAAATCCCAACACTTTGG + Intergenic
1093926259 12:24911337-24911359 CGCCACAAATCACAACCCTCTGG + Intronic
1097825517 12:64171513-64171535 CACCCCCAATCCCAACACTCAGG + Intergenic
1099315460 12:81078036-81078058 GCCCCCTACTCCCTTCCCTCAGG + Exonic
1100295040 12:93253287-93253309 ACCCCCAAATTCCTGTCCTCTGG + Intergenic
1101477375 12:105063648-105063670 CCCACCCAAACCCTACCTTCAGG - Intronic
1101745950 12:107541758-107541780 CCCCCTCATCCCCTACCCTCAGG - Intronic
1101804155 12:108048784-108048806 CCTACCAAATCCCTTCCTTCTGG - Intergenic
1101882481 12:108634792-108634814 CCCCCCTATTCCCTCCCTTCTGG - Intergenic
1102955410 12:117055492-117055514 CCCCCAAAATCCCTGCCTCCTGG + Intronic
1103952282 12:124557837-124557859 CCTCCCAAATCCTGACCCTGTGG + Intronic
1104973299 12:132541107-132541129 CCCACCACATCCCTACCCCGAGG + Intronic
1105068541 12:133219838-133219860 GCCCCCAAATCCCCATCCACAGG + Intronic
1105436066 13:20379539-20379561 CCCCCCAAAGCCCTGTTCTCAGG + Intergenic
1105689505 13:22821987-22822009 CCACCCAAATTCCTGCCTTCTGG - Intergenic
1107196778 13:37661807-37661829 CCCGCCCACCCCCTACCCTCTGG - Intronic
1107885336 13:44870447-44870469 CCCGCCCCATCCCTACCCACGGG - Intergenic
1111088689 13:83412458-83412480 CCACCCAACTCCCTGCCCTGTGG - Intergenic
1112781652 13:102907132-102907154 TCTCCCCAATCCCTATCCTCAGG - Intergenic
1112809681 13:103203434-103203456 GCCCCCAGAGCCCCACCCTCAGG - Intergenic
1113866594 13:113530193-113530215 CCCCCAACCTCCCCACCCTCCGG - Intronic
1114365588 14:22024261-22024283 CTCCCCAAATCCCTCCTCTCTGG + Intergenic
1115688899 14:35824686-35824708 CCCCCCACCTCCCTCCCGTCCGG + Intergenic
1117242522 14:53849124-53849146 CAGCCCTAATCCCTACCCTGGGG + Intergenic
1119415015 14:74464151-74464173 CTACCCACAACCCTACCCTCTGG - Intergenic
1119529635 14:75350724-75350746 CTCCCCTATTCCCCACCCTCTGG - Intergenic
1119899082 14:78244608-78244630 CACCCCACCTCCCAACCCTCTGG + Intronic
1120520528 14:85522578-85522600 TCCCCCAAATCCCACTCCTCAGG + Intergenic
1120592562 14:86392877-86392899 TCCCCCATATCCCTTACCTCAGG - Intergenic
1121023416 14:90596765-90596787 CCCTGAAAATCCCTACCCTGAGG - Intronic
1121112779 14:91323788-91323810 TCCCCCAAATCCCTTGCCTCTGG - Intronic
1121120857 14:91375126-91375148 CCGCCCAGATCACCACCCTCAGG - Intronic
1123782093 15:23638704-23638726 TCCCCCACATCCTTAACCTCTGG - Intergenic
1124550063 15:30672019-30672041 CCCCCAATATCCCTAACCCCTGG - Intronic
1125041742 15:35195805-35195827 CCCCCTAAAGCCCTACCTCCTGG + Intergenic
1125680536 15:41527609-41527631 CCCCCCAACTCCCGTTCCTCTGG - Intronic
1125874998 15:43136225-43136247 CTCTCCCAATCCCTATCCTCTGG - Intronic
1127820452 15:62650118-62650140 CCAGCCAAATCCCTTTCCTCGGG - Exonic
1128249708 15:66155739-66155761 CCTCCCTCATCCCAACCCTCAGG + Intronic
1128255264 15:66191481-66191503 CCCCCGCAACCCCGACCCTCAGG - Intronic
1129169420 15:73798604-73798626 CCCTCCAAAGCCCTGCCCTTGGG + Intergenic
1129392707 15:75228624-75228646 CCCCCAAAATGCACACCCTCTGG + Intergenic
1129846016 15:78768022-78768044 CCCGCCAACTCCCCACCCCCAGG - Intronic
1130025297 15:80265911-80265933 CCTCCCTAAGCCCTAGCCTCTGG + Intergenic
1130599103 15:85264145-85264167 CCCACCAACTCCCCACCCCCAGG - Intergenic
1131584917 15:93682886-93682908 GCTCCCCATTCCCTACCCTCAGG - Intergenic
1132089144 15:98933713-98933735 CCTCCCAAATCTCTACCCATTGG + Intronic
1133616737 16:7484002-7484024 CCCCCCCATTCCCTAACCCCTGG + Intronic
1134249437 16:12564007-12564029 CTCCTCAACTCCCTACCCTGGGG - Intronic
1134291263 16:12903956-12903978 CCCCCAAAATCTCTTCTCTCTGG - Intronic
1134533082 16:15000329-15000351 CCTCCCAAATCCATAACGTCCGG + Intronic
1134820666 16:17244254-17244276 CCCCCCAAGGCCCCACCCCCAGG - Intronic
1134825671 16:17282264-17282286 CCCCCGACTTCCCTACCCCCTGG + Intronic
1136570344 16:31093159-31093181 CTCCCCACATCCCCACCCGCAGG + Intronic
1136735246 16:32461400-32461422 CCCCCCCACTCCCCGCCCTCTGG + Intergenic
1137710328 16:50562564-50562586 CTCCCCAACTCCACACCCTCTGG - Intronic
1138230492 16:55332384-55332406 TCCCCCTAACCCCCACCCTCTGG - Intergenic
1139496866 16:67326556-67326578 CCCCCCAAATCCTTCCCGGCTGG + Intronic
1139505255 16:67395316-67395338 TTCCCCAAATCCCTCCCCACTGG + Intronic
1139862951 16:70040399-70040421 CCTCCCAAATCCATAACGTCCGG - Intergenic
1139954501 16:70686624-70686646 CCCCCCAAATGCCCAGCCTTGGG - Intergenic
1141430453 16:83968342-83968364 CCCCACATACCCCTCCCCTCCGG + Intergenic
1141823478 16:86463486-86463508 CCCCCCACATCCCTCACCCCTGG - Intergenic
1143318905 17:6054963-6054985 CCCCCCAAGCCCATACACTCAGG - Intronic
1143590634 17:7884611-7884633 CCTCCGAAACCCCCACCCTCGGG - Intronic
1144274913 17:13657107-13657129 ACGAACAAATCCCTACCCTCAGG + Intergenic
1146454450 17:32998025-32998047 CCCCCCAAACACCTGCCCACAGG - Intergenic
1146560523 17:33864980-33865002 CCCCTCAACCCCCCACCCTCTGG - Intronic
1147256297 17:39184383-39184405 CCCCACAAACCCCCACCCCCAGG - Exonic
1147652714 17:42071501-42071523 CCCCAAAGACCCCTACCCTCAGG + Intergenic
1147867408 17:43562291-43562313 TCCTCAAAATTCCTACCCTCAGG + Intronic
1147908618 17:43840722-43840744 CCTTCCCCATCCCTACCCTCGGG - Intergenic
1148094686 17:45044216-45044238 CCCCCTACATCACTGCCCTCAGG + Intronic
1148212068 17:45814635-45814657 CCCCCCAAGTCCCTGTCCCCGGG + Intronic
1148217847 17:45843521-45843543 GCCCCCAAATCCCTCCCTTCTGG + Intergenic
1148852534 17:50561809-50561831 CCCCCCATCCGCCTACCCTCCGG - Intronic
1153094904 18:1389794-1389816 CTCCCCAACTCCCTACCTCCAGG + Intergenic
1155270484 18:24137065-24137087 CACCCCAAATCCTTACCCTATGG - Intergenic
1161407342 19:4097937-4097959 GCCCCCAAGTCCTTATCCTCAGG - Intronic
1161986465 19:7657591-7657613 CTCCACAAATCCCCAGCCTCCGG - Intergenic
1162534239 19:11253623-11253645 CCCCCCAAATACTTACCCCCAGG + Exonic
1163667679 19:18610826-18610848 CCCCCCCACTTCCTACCCCCCGG - Intronic
1163689449 19:18730704-18730726 CCTCCCAACTCCCTAGTCTCAGG + Intronic
1165126780 19:33603678-33603700 GACCCCAATTCCCTACACTCTGG - Intergenic
1168283770 19:55320526-55320548 CCCCCCAAATCCCTACCCTCGGG + Intronic
1168417397 19:56177230-56177252 GTCCCCAAATCCCTGCCCTCTGG + Intronic
925955674 2:8961763-8961785 CCCCTCAAATCTCCACCCGCAGG + Intronic
927703778 2:25284735-25284757 CCCCCAAAATCTCTCCCCTAAGG + Intronic
930048263 2:47192888-47192910 CCCCCCAAAAGCTTCCCCTCTGG - Intergenic
930185801 2:48411037-48411059 TCCCCCCCATCCCTATCCTCAGG + Intergenic
930681190 2:54258216-54258238 CCTCCCCACTCCCTACCCCCAGG - Intronic
931446498 2:62331390-62331412 CCCCCAAAATTCCTCCTCTCTGG - Intergenic
932764638 2:74462047-74462069 AACCCCAAGACCCTACCCTCTGG - Exonic
933314993 2:80704850-80704872 GCCCCCAGTTCCCTACCCTGAGG - Intergenic
933540108 2:83629339-83629361 CCCCCCAACCCCCTAGCCTCTGG + Intergenic
934090595 2:88547348-88547370 TCCCCCAGATCCCTAAGCTCTGG - Intergenic
937367362 2:121273333-121273355 CCCTCCTCATCCCTTCCCTCAGG + Intronic
937916360 2:127100981-127101003 CCCCGCACATTCCTACCCTTGGG - Intronic
938042632 2:128088438-128088460 CCCCCAAAACCCCTAGCCTGTGG - Intergenic
938114406 2:128593641-128593663 CCGCCCCAATCCCTCTCCTCTGG - Intergenic
941022570 2:160424350-160424372 CCCCCCCAATCTCTCACCTCTGG - Intronic
942188050 2:173443434-173443456 CCACCCAAATCTCTGCCCCCAGG - Intergenic
942221777 2:173775948-173775970 TCTCCCAAATCCCTGCCCACTGG + Intergenic
942630820 2:177947127-177947149 CCCCCCACCTCCCTCCCTTCCGG - Intronic
944177409 2:196848464-196848486 CCCCCCAAATTCCCATCCTTTGG + Intronic
944840797 2:203621864-203621886 CTCCCCAAGTCACTCCCCTCTGG - Intergenic
944969919 2:204980651-204980673 TCCTCCAAATCCATACCCCCAGG + Intronic
945121250 2:206459748-206459770 CCTCCCAAATCCTTCCCATCTGG + Intronic
945285405 2:208077055-208077077 CCTCCCAACTCCCTAACCTAAGG - Intergenic
945639266 2:212402341-212402363 CCCGCCCAATCCCTAACCTGTGG - Intronic
946019587 2:216632320-216632342 CCCCCCAGACCCCTCCACTCTGG - Intergenic
946871758 2:224091317-224091339 CCCCCAAAATCTCTTCCCCCGGG - Intergenic
949080175 2:242089714-242089736 GCCTCCAAATCCTTACCATCCGG + Intergenic
1170780282 20:19419613-19419635 CCCTTCACATCCCTCCCCTCAGG - Intronic
1172520469 20:35562509-35562531 CCCCCCAGATCCCTAAGATCTGG - Intergenic
1174506017 20:51018136-51018158 CCTCCCAAATCCCACCCCACAGG - Intronic
1175887719 20:62302233-62302255 CCTCCCAGATCCCTCCCCTCCGG + Intronic
1179272429 21:39861706-39861728 CACCCCAATCCCCCACCCTCTGG - Intergenic
1179498392 21:41790550-41790572 CTCCCCCATTCCCTAGCCTCAGG - Intergenic
1179571754 21:42282639-42282661 TCCCCCAAAGCCATACCCCCAGG - Intronic
1179910397 21:44444373-44444395 CCCCTCAAATCCCCATCCCCAGG - Intergenic
1181090953 22:20472328-20472350 CGCCTCTAATCCCAACCCTCTGG + Intronic
1181631921 22:24156070-24156092 CCCGCCAAGTTCCTACCCGCCGG - Intronic
1183233235 22:36596275-36596297 CCTCCCGAATCCCTGCCGTCAGG - Intronic
1184212446 22:43043919-43043941 ACCCCCAACTCCCTGACCTCTGG + Intronic
1184264380 22:43339235-43339257 CCCCCCACACCCCTACCCACAGG - Exonic
1184375722 22:44111383-44111405 CCCCTAAAATCCCGACCCGCTGG - Intronic
1184686466 22:46098595-46098617 CTCCCCACATCCCTCCCTTCTGG + Intronic
952031119 3:29143922-29143944 GCCACCAGATCCCTACCTTCAGG + Intergenic
954399191 3:50311235-50311257 CCCCCCAACTCCCTCCCGGCCGG + Intronic
954436316 3:50498269-50498291 CCCCCCAAGTCCCACCCATCCGG + Intronic
954702306 3:52456583-52456605 CCCACCCACTCCCTACCCTGCGG - Intronic
955954190 3:64271593-64271615 AGCCCCAAGTCCCTGCCCTCAGG + Intronic
957811484 3:85228483-85228505 CACACCAAATCCCTATCCACAGG - Intronic
958488234 3:94739591-94739613 TCCTCCAAATGCCTACCCTCTGG - Intergenic
961730417 3:128960920-128960942 ACCCCCAAACCCCTTCCCTCCGG + Intronic
962580451 3:136793069-136793091 CTCCCCAACTCCCCACCCCCAGG + Intergenic
963105899 3:141646917-141646939 CCTCCCTTCTCCCTACCCTCTGG + Intergenic
963804954 3:149714009-149714031 CCCCCCAGATCCCACCGCTCTGG + Intronic
964661972 3:159130083-159130105 CCCTCCCCATCCCTAACCTCTGG + Intronic
964801660 3:160565127-160565149 CGCCCCTAATCCCCACACTCGGG + Intronic
965545193 3:169908686-169908708 CCCTCCAAAATCCTACTCTCTGG - Intergenic
965550271 3:169957954-169957976 ACCCCCAAATCCCTTTCCTTAGG + Intergenic
965596920 3:170419316-170419338 GCTCCCAAATCCTTATCCTCTGG + Intronic
966594127 3:181711406-181711428 CCCCCCAACTCCAGCCCCTCTGG - Intergenic
966855965 3:184193895-184193917 CCCCCCAGACCCCCACCCCCGGG - Exonic
967930400 3:194686676-194686698 CCCCCCAACTCCCTACCACAGGG + Exonic
968279707 3:197467006-197467028 CCTCCCAAATCCATGCCCACAGG - Intergenic
969301572 4:6300312-6300334 CTCCCCACTTCCCTCCCCTCAGG - Intronic
969828374 4:9776067-9776089 CCCAGCAGATCCCTTCCCTCGGG - Intronic
970942897 4:21656213-21656235 CACCCCATATCTCTACCTTCAGG + Intronic
974186236 4:58450769-58450791 CCAGCCAAATGCATACCCTCTGG - Intergenic
981088832 4:140711442-140711464 CCCCTCAGATCCCTTCTCTCAGG + Intronic
981361519 4:143851076-143851098 CTCCCCCACACCCTACCCTCTGG - Intergenic
981372264 4:143972070-143972092 CTCCCCCACACCCTACCCTCTGG - Intergenic
981381342 4:144075269-144075291 CTCCCCCACACCCTACCCTCTGG - Intergenic
982137216 4:152282896-152282918 CTCCGCAAAGCCCTTCCCTCTGG + Intergenic
983615233 4:169696699-169696721 CCTCCCCAACCCCTAGCCTCTGG + Intronic
983926679 4:173410177-173410199 CCCCACAAACCTCTACGCTCTGG - Intergenic
984901546 4:184590919-184590941 GCCCCCAAATCCCTGCACCCTGG + Intergenic
985533014 5:444685-444707 CCCCTTAAATCCCGACACTCAGG - Intronic
985758154 5:1731423-1731445 CCCCCCAAAACCATCCCCTAAGG + Intergenic
988550148 5:32193540-32193562 CCCCAAAAATGCCTACCCGCTGG + Intergenic
990287215 5:54311663-54311685 CCCCCCCCATCCCCACCCTCAGG + Intergenic
990942856 5:61220775-61220797 CCCCCAAGATTCCTGCCCTCTGG - Intergenic
991066384 5:62429170-62429192 CCCCCCAATTCCCCAGCCTAGGG + Intronic
993177960 5:84512875-84512897 TCCTCCAAACCACTACCCTCTGG + Intergenic
994732089 5:103504460-103504482 CCCCTCACCTCCCTATCCTCAGG + Intergenic
995689315 5:114805882-114805904 TCACCCAAATCCCAGCCCTCAGG + Intergenic
997024974 5:130048818-130048840 CCACTCAACTCCCTAGCCTCTGG - Intronic
997403507 5:133622055-133622077 CCCCCCTTATCCCTAATCTCTGG + Intergenic
998002395 5:138635390-138635412 CCCCCCAACTCCCTCCTCACAGG + Intronic
998142153 5:139706059-139706081 CCCCCAAGAACCCTACCCCCTGG + Intergenic
998414852 5:141938705-141938727 TCCCCCACACCCCTACCCACTGG + Exonic
999377033 5:151094049-151094071 GCCTCCACATCCCCACCCTCTGG + Intergenic
1000963864 5:167631778-167631800 CCCCTCGACTCCCCACCCTCAGG + Intronic
1001130795 5:169061867-169061889 CCACCCCACTCCCTACCCTCTGG + Intronic
1001933365 5:175688310-175688332 TCCCACAAGTCCCAACCCTCTGG + Intergenic
1001999969 5:176191980-176192002 ACCCCCAGATCCCCACCCTCAGG + Intergenic
1003144974 6:3502545-3502567 CCCCACAAATCCCTCCCCGAAGG - Intergenic
1003313420 6:4988485-4988507 CCCCCAACATCCCTAATCTCAGG + Intergenic
1003394152 6:5739028-5739050 CCCCCACCATCACTACCCTCTGG + Intronic
1004330638 6:14717428-14717450 CCCCCAAACTCCTTACCCTTTGG + Intergenic
1005805279 6:29468531-29468553 CTCCCCACATCCACACCCTCAGG - Intergenic
1006091565 6:31631771-31631793 CCCCCGAAAACCCCTCCCTCTGG - Exonic
1006631343 6:35432331-35432353 CCACCCAGATCCCACCCCTCAGG + Intergenic
1007418603 6:41706252-41706274 CCCCCCACCTCCCTGCTCTCAGG - Intronic
1007680365 6:43629290-43629312 CCCCCCACCTCCCTGGCCTCCGG + Intergenic
1008498263 6:52154539-52154561 CCCCCTAAATCCCTACAGACAGG + Intergenic
1009059536 6:58381626-58381648 CCCCCCATATCATTGCCCTCCGG + Intergenic
1009231378 6:61065790-61065812 CCCCCCATATCATTGCCCTCCGG - Intergenic
1014753721 6:125280658-125280680 CCTCCCAAATTCCTCCTCTCTGG + Intronic
1014869064 6:126568877-126568899 CCCTCCAAATCCCTTACCCCTGG - Intergenic
1015607219 6:134970460-134970482 CCCCTAAAATCCCCAGCCTCTGG + Intronic
1016770606 6:147846211-147846233 TCCCCGAAATCCCTAACCTTTGG - Intergenic
1017085330 6:150708030-150708052 CCCCCCAAATCTCTACCCCCAGG + Intronic
1018376394 6:163217507-163217529 CCCCGGGAACCCCTACCCTCGGG - Intronic
1020427194 7:8081189-8081211 CCCCCCACCTCCCTACCCCAAGG + Intronic
1021731876 7:23603691-23603713 ACCCCCAAATTTCTATCCTCTGG + Intronic
1023027233 7:36061879-36061901 CCCCCCATATTCCTTCCCACAGG + Intergenic
1024287228 7:47768719-47768741 CCAACAAAATGCCTACCCTCAGG - Intronic
1024505917 7:50161235-50161257 GCCCCTCACTCCCTACCCTCCGG + Intergenic
1024771061 7:52723919-52723941 CCCCCCCTACCCCTACCCCCCGG + Intergenic
1025799380 7:64771040-64771062 CTCCCCATATTCCCACCCTCAGG + Intergenic
1028698938 7:93753230-93753252 CTCCCCATTTCCCTAACCTCAGG - Intronic
1030364021 7:108625966-108625988 ACCCCCAAATTCCTGTCCTCTGG + Intergenic
1030806437 7:113925842-113925864 TCCTCCAAAACCCCACCCTCTGG + Intronic
1031204650 7:118741204-118741226 CCCCCTAAACCCCTAACCTCTGG - Intergenic
1031975639 7:128091905-128091927 CCCCTCAACTCGGTACCCTCTGG - Intronic
1032096198 7:128939458-128939480 ACCCCCAAATCCCACCCCTCCGG - Intronic
1032679712 7:134168980-134169002 CCTCCAAAAAGCCTACCCTCAGG + Intronic
1033167384 7:139052274-139052296 CCCCCCACCCCCCTCCCCTCTGG + Intronic
1035092670 7:156327521-156327543 CACCCCAAATCCCTTCTCTTTGG + Intergenic
1035538218 8:407977-407999 GCCTCCAAATCCTTACCATCCGG + Intronic
1035559386 8:593489-593511 CCTCTCACATCCCTCCCCTCAGG - Intergenic
1035559499 8:593975-593997 CCCTTCACATCCCTCCCCTCAGG - Intergenic
1035783400 8:2245795-2245817 CCCCCCAAATCCCCCACCACTGG + Intergenic
1035808723 8:2473791-2473813 CCCCCCAAATCCCCCACCACTGG - Intergenic
1036958308 8:13215100-13215122 AGCCCCAAATCCCTGCCCTTTGG + Intronic
1037029311 8:14083442-14083464 AGCCCCAACTCCCTGCCCTCTGG + Intergenic
1037608326 8:20455969-20455991 AGCCCCAAATCTCTACCCTCTGG + Intergenic
1037610890 8:20475248-20475270 GCTCCCCAATCCCTGCCCTCTGG + Intergenic
1038858157 8:31355889-31355911 CCACCCCAATCCCCAGCCTCTGG + Intergenic
1039594687 8:38780981-38781003 TCCCCCAAATCCCTAGACTAAGG + Intronic
1040102851 8:43520551-43520573 CACCCTAAATCTTTACCCTCAGG - Intergenic
1043194350 8:77272694-77272716 TTCGCCAAATCCCTAGCCTCTGG + Intergenic
1043688715 8:83123373-83123395 CCACCAAAATTCCTACCCTTTGG + Intergenic
1043706443 8:83357082-83357104 ACCCCCAAATTCCTATCCTCTGG + Intergenic
1044198300 8:89404129-89404151 ACCCCCAAATTCCCACCCTCTGG - Intergenic
1044875952 8:96666533-96666555 CCTCCCTGATCCCTACACTCTGG - Intronic
1048026977 8:130596166-130596188 CACCCCAAATCCTCACCCTCAGG - Intergenic
1048057506 8:130882028-130882050 CCCCCCATATCCTTACCCGGAGG + Intronic
1048228429 8:132613273-132613295 CAACCCAAATGCCTACCATCTGG + Intronic
1048240247 8:132733989-132734011 CCACCCAAACCCCTATCCCCTGG - Intronic
1051679597 9:19593745-19593767 CCCCCCAAAGCCCCGCCCTTTGG - Intronic
1052062379 9:23976227-23976249 TCCCCCAACTCCCTAGCCTCTGG - Intergenic
1056191144 9:84185378-84185400 GCCTCCCAATCCCTACCCTCAGG - Intergenic
1056223564 9:84472990-84473012 TCCCACCAATCCCTAGCCTCTGG - Intergenic
1057710265 9:97434998-97435020 TCACCCAAATCCTTAACCTCTGG - Intronic
1057822718 9:98344841-98344863 CCCCACAAATCTCTACCGACTGG + Intronic
1057969514 9:99540760-99540782 CTGCCCAAATCCCTGCCCTTAGG + Intergenic
1058789427 9:108427261-108427283 TCCTCCAAACCTCTACCCTCTGG - Intergenic
1060594496 9:124840168-124840190 CCCCCCAGACCCCCACCCTGTGG - Intergenic
1061821923 9:133233758-133233780 CCGCCCACAGCCCCACCCTCGGG - Intergenic
1185677189 X:1858488-1858510 CCCCCCAGATCCATACACTTTGG + Intergenic
1187275855 X:17816252-17816274 CCCGCCAACTCCCCACCCCCAGG + Intronic
1189375210 X:40461207-40461229 CTCCCCAGATCCCAACCCTGTGG - Intergenic
1190478243 X:50849518-50849540 ACCCCCAAATTCCTGTCCTCTGG + Intergenic
1190582957 X:51906245-51906267 CCGACAAGATCCCTACCCTCTGG + Intergenic
1190858679 X:54322362-54322384 CTCCCCAACTCCCCAACCTCTGG + Intronic
1197965080 X:132051739-132051761 CCCCCCAAGCCCCCACCCCCTGG + Intergenic
1198542275 X:137652540-137652562 CCCCCCAACTCTGTACCCACTGG - Intergenic
1199991472 X:152989883-152989905 ACCCCCAAATATCTACCCTGTGG - Exonic