ID: 1168283779

View in Genome Browser
Species Human (GRCh38)
Location 19:55320545-55320567
Sequence CGGGCAGAATTACCTGATGT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 1, 2: 1, 3: 4, 4: 76}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168283765_1168283779 20 Left 1168283765 19:55320502-55320524 CCTCCACTTTCCTGCAGCGGCGA 0: 1
1: 0
2: 1
3: 2
4: 111
Right 1168283779 19:55320545-55320567 CGGGCAGAATTACCTGATGTAGG 0: 1
1: 1
2: 1
3: 4
4: 76
1168283773_1168283779 -7 Left 1168283773 19:55320529-55320551 CCCAAATCCCTACCCTCGGGCAG 0: 1
1: 0
2: 0
3: 8
4: 145
Right 1168283779 19:55320545-55320567 CGGGCAGAATTACCTGATGTAGG 0: 1
1: 1
2: 1
3: 4
4: 76
1168283774_1168283779 -8 Left 1168283774 19:55320530-55320552 CCAAATCCCTACCCTCGGGCAGA 0: 1
1: 0
2: 0
3: 6
4: 110
Right 1168283779 19:55320545-55320567 CGGGCAGAATTACCTGATGTAGG 0: 1
1: 1
2: 1
3: 4
4: 76
1168283771_1168283779 -5 Left 1168283771 19:55320527-55320549 CCCCCAAATCCCTACCCTCGGGC 0: 1
1: 0
2: 1
3: 10
4: 136
Right 1168283779 19:55320545-55320567 CGGGCAGAATTACCTGATGTAGG 0: 1
1: 1
2: 1
3: 4
4: 76
1168283767_1168283779 10 Left 1168283767 19:55320512-55320534 CCTGCAGCGGCGATCCCCCCAAA 0: 1
1: 0
2: 0
3: 4
4: 36
Right 1168283779 19:55320545-55320567 CGGGCAGAATTACCTGATGTAGG 0: 1
1: 1
2: 1
3: 4
4: 76
1168283766_1168283779 17 Left 1168283766 19:55320505-55320527 CCACTTTCCTGCAGCGGCGATCC 0: 1
1: 0
2: 0
3: 1
4: 73
Right 1168283779 19:55320545-55320567 CGGGCAGAATTACCTGATGTAGG 0: 1
1: 1
2: 1
3: 4
4: 76
1168283769_1168283779 -4 Left 1168283769 19:55320526-55320548 CCCCCCAAATCCCTACCCTCGGG 0: 1
1: 0
2: 0
3: 12
4: 154
Right 1168283779 19:55320545-55320567 CGGGCAGAATTACCTGATGTAGG 0: 1
1: 1
2: 1
3: 4
4: 76
1168283772_1168283779 -6 Left 1168283772 19:55320528-55320550 CCCCAAATCCCTACCCTCGGGCA 0: 1
1: 0
2: 0
3: 15
4: 158
Right 1168283779 19:55320545-55320567 CGGGCAGAATTACCTGATGTAGG 0: 1
1: 1
2: 1
3: 4
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168283779 Original CRISPR CGGGCAGAATTACCTGATGT AGG Exonic
900368425 1:2320841-2320863 CGGGCAGGATTGCCTGGAGTGGG + Intergenic
904294894 1:29513735-29513757 TGGGCAGAATCAGCAGATGTTGG + Intergenic
912280170 1:108304632-108304654 TGGGCAGAATCTCCTGATGGAGG - Intergenic
912288056 1:108389725-108389747 TGGGCAGAATCTCCTGATGGAGG + Intronic
915554310 1:156652883-156652905 TGGGCAGAATTACCTGATGCGGG - Exonic
916397062 1:164402524-164402546 CTGGCAGAAGTACCTGAAATAGG + Intergenic
919392624 1:197006481-197006503 CAGGAAGAATCACCTGAGGTCGG + Intronic
920039161 1:203084800-203084822 TGGGCAGAAGTACCTGTGGTGGG + Intronic
924593721 1:245427378-245427400 CAGGCAGGATCACCTGAGGTCGG + Intronic
924949120 1:248866508-248866530 CAGGAAGAATCACCTGAGGTCGG + Intergenic
1064334308 10:14424897-14424919 CAGGCAGAATTAACAGAAGTGGG - Intronic
1068958616 10:62844414-62844436 TGGGCAGAGTTACCTGGTGAGGG - Intronic
1069592807 10:69652428-69652450 CGGGCAGAGTCACCTGATGGTGG + Intergenic
1073259296 10:102176548-102176570 CGTGGAGAATACCCTGATGTGGG - Intergenic
1074992472 10:118722314-118722336 CGGGCAAGATCACCTGAGGTCGG - Intronic
1079311453 11:19370144-19370166 CTGGCACAATTACAGGATGTGGG - Intronic
1079758870 11:24302884-24302906 GGGGGAGAATCACCTGAGGTGGG + Intergenic
1081838683 11:46178922-46178944 CGGGCGGATTCACCTGAGGTTGG + Intergenic
1085680241 11:78567061-78567083 GGGTCAGAATTCCCTAATGTTGG + Intronic
1089926521 11:122264002-122264024 CGGGCAGAATGACCTCTTGTGGG - Intergenic
1090149811 11:124372059-124372081 TGGGCAGAAGTATCTGATCTGGG + Intergenic
1092743489 12:11651791-11651813 TTGGCAGATTTTCCTGATGTCGG - Intronic
1099477456 12:83124297-83124319 CTAGCAGAAAAACCTGATGTAGG - Intronic
1102803341 12:115756853-115756875 AGGGCCGATTTTCCTGATGTGGG + Intergenic
1108032818 13:46254318-46254340 CGGGCATATTTACAGGATGTTGG + Intronic
1126579892 15:50233074-50233096 TGGGCTAAATTCCCTGATGTAGG + Intronic
1133326088 16:4943258-4943280 CGGGTAGAATTAGCAGATTTAGG + Intronic
1137321003 16:47382270-47382292 CTGGCAGAATTATTTGATATAGG - Intronic
1148713993 17:49702502-49702524 CGGGGGGAATCACCTGAGGTTGG + Intronic
1158594521 18:58804511-58804533 CTGGCAGGATCACCTGAGGTTGG + Intergenic
1160218378 18:76953956-76953978 CATGCAGAATAACCTGCTGTGGG + Intronic
1163965586 19:20744469-20744491 CGGGCGAAATCACCTGAGGTTGG - Intronic
1164224980 19:23236292-23236314 CAGGCTTCATTACCTGATGTGGG - Intronic
1167274094 19:48525088-48525110 CAGGCAGGATCACCTGAGGTCGG + Intergenic
1168283779 19:55320545-55320567 CGGGCAGAATTACCTGATGTAGG + Exonic
926590470 2:14735004-14735026 GGGGCAGATTTGTCTGATGTGGG + Intergenic
929971306 2:46579621-46579643 CGGGCAGAATTACCTGAGGTTGG + Intronic
930829059 2:55724034-55724056 AGGGCAGAGTTTCCTGCTGTGGG - Intergenic
933338276 2:80987576-80987598 CAGGGAGAATTCCCTGATTTGGG - Intergenic
936277084 2:111108602-111108624 CGGGCGGTATCACCTGAGGTCGG - Intronic
937892284 2:126948039-126948061 GGGGCAGGATTGCCTGGTGTTGG - Intergenic
940593536 2:155761261-155761283 TGGGGAGAAATACCTAATGTAGG + Intergenic
947526753 2:230881677-230881699 GTGGGAGAATTACCTGAGGTTGG - Intergenic
1172356897 20:34286603-34286625 CGGGGGGAATCACCTGAGGTCGG + Intronic
1173982508 20:47235783-47235805 TGGGCAGGATTGCCTGTTGTTGG - Intronic
1178337915 21:31760221-31760243 CGGGCAGGATAACTTGAGGTCGG + Intergenic
1182493360 22:30689069-30689091 CGGGTGGAATCACCTGAGGTTGG - Intergenic
951317116 3:21201595-21201617 AGGGCGGGATTACCTGATGGAGG + Intergenic
957820633 3:85369539-85369561 CGGGTGGAATCACCTGAGGTCGG + Intronic
963767489 3:149352776-149352798 CGGGCAGAGCTACATGTTGTGGG - Intergenic
964800880 3:160556058-160556080 CGGGCCGGATCACCTGAGGTTGG - Intronic
965561237 3:170063963-170063985 CGGGCAGAATTTCCTGAAACTGG + Intronic
967084303 3:186079992-186080014 TGGGCAGAGTTGCCTGAGGTGGG + Exonic
970900271 4:21150733-21150755 AGGGCAGAATTACAGAATGTGGG - Intronic
983049708 4:163031785-163031807 CGTGCAGAATTACATGTTGATGG + Intergenic
997876505 5:137552868-137552890 CTGGGAGAAATACCTAATGTAGG + Intronic
1000896412 5:166860692-166860714 CTGTCAGAATTTCCTGATTTTGG + Intergenic
1001154299 5:169259671-169259693 CAGGCAAAATTAACTCATGTTGG + Intronic
1004018556 6:11755049-11755071 CGGGAAGAATGACTTGATGCTGG - Intronic
1007662137 6:43493341-43493363 GGGCCACAATTACCTGAAGTAGG + Intronic
1010709644 6:79158915-79158937 CAGGCAGAATTCTCTGCTGTTGG + Intergenic
1011514371 6:88136260-88136282 AGGGCACAAATACCTGATTTAGG - Intergenic
1012562542 6:100601079-100601101 CAGGCAGAATTAAATTATGTGGG - Intronic
1018593696 6:165455082-165455104 CAGGCAGAATTACTAGATTTGGG + Intronic
1022446552 7:30475555-30475577 GGGGCAGAGTTCCCTGATGAGGG - Intronic
1024393637 7:48842632-48842654 CGAGGAGAATACCCTGATGTGGG + Intergenic
1025173526 7:56782950-56782972 CGGGCGAAATCACCTGAGGTCGG + Intergenic
1025698577 7:63795221-63795243 CGGGCAAAATCACCTGAGGTCGG - Intergenic
1026199097 7:68198584-68198606 CTGGACGAATTACCTGAGGTCGG - Intergenic
1034582521 7:152057602-152057624 CGGCCAGAATTAGATGATTTTGG + Intronic
1034754188 7:153599162-153599184 CAGTCAGAATTATCAGATGTTGG + Intergenic
1037188757 8:16096961-16096983 GGGGCAGATTTACCTTAAGTAGG - Intergenic
1040597460 8:48853123-48853145 CAGGCAGTATTAACTGATGCAGG - Intergenic
1051894497 9:21974116-21974138 CGGGGGGAATCACCTGAGGTCGG - Intronic
1053153895 9:35760722-35760744 AGGGCAGAATTACCTGGTTGGGG - Intergenic
1056644664 9:88400363-88400385 CAGGCAGAATTTATTGATGTGGG + Intronic
1056744519 9:89288382-89288404 AGGGCAGCATCACCTGAGGTTGG + Intergenic
1057606374 9:96500594-96500616 CATGGAGAATAACCTGATGTGGG + Exonic
1058642589 9:107101858-107101880 TGGGCAGAATCAGCTCATGTGGG - Intergenic
1062451701 9:136618484-136618506 CCGGCAGAAGTGCCTGGTGTGGG - Intergenic
1187585898 X:20661591-20661613 CGGGCAGCCTCACCTGATGTTGG - Intergenic
1189629995 X:42942783-42942805 TGGGCAGAATTAGTTGATATGGG - Intergenic
1189944421 X:46163670-46163692 CTGGCATAAGTAGCTGATGTTGG + Intergenic