ID: 1168283782

View in Genome Browser
Species Human (GRCh38)
Location 19:55320562-55320584
Sequence TGTAGGGAAAGCCTTTACTG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 137}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168283767_1168283782 27 Left 1168283767 19:55320512-55320534 CCTGCAGCGGCGATCCCCCCAAA 0: 1
1: 0
2: 0
3: 4
4: 36
Right 1168283782 19:55320562-55320584 TGTAGGGAAAGCCTTTACTGAGG 0: 1
1: 0
2: 2
3: 16
4: 137
1168283775_1168283782 3 Left 1168283775 19:55320536-55320558 CCCTACCCTCGGGCAGAATTACC 0: 1
1: 0
2: 0
3: 4
4: 56
Right 1168283782 19:55320562-55320584 TGTAGGGAAAGCCTTTACTGAGG 0: 1
1: 0
2: 2
3: 16
4: 137
1168283773_1168283782 10 Left 1168283773 19:55320529-55320551 CCCAAATCCCTACCCTCGGGCAG 0: 1
1: 0
2: 0
3: 8
4: 145
Right 1168283782 19:55320562-55320584 TGTAGGGAAAGCCTTTACTGAGG 0: 1
1: 0
2: 2
3: 16
4: 137
1168283774_1168283782 9 Left 1168283774 19:55320530-55320552 CCAAATCCCTACCCTCGGGCAGA 0: 1
1: 0
2: 0
3: 6
4: 110
Right 1168283782 19:55320562-55320584 TGTAGGGAAAGCCTTTACTGAGG 0: 1
1: 0
2: 2
3: 16
4: 137
1168283771_1168283782 12 Left 1168283771 19:55320527-55320549 CCCCCAAATCCCTACCCTCGGGC 0: 1
1: 0
2: 1
3: 10
4: 136
Right 1168283782 19:55320562-55320584 TGTAGGGAAAGCCTTTACTGAGG 0: 1
1: 0
2: 2
3: 16
4: 137
1168283772_1168283782 11 Left 1168283772 19:55320528-55320550 CCCCAAATCCCTACCCTCGGGCA 0: 1
1: 0
2: 0
3: 15
4: 158
Right 1168283782 19:55320562-55320584 TGTAGGGAAAGCCTTTACTGAGG 0: 1
1: 0
2: 2
3: 16
4: 137
1168283776_1168283782 2 Left 1168283776 19:55320537-55320559 CCTACCCTCGGGCAGAATTACCT 0: 1
1: 0
2: 0
3: 5
4: 75
Right 1168283782 19:55320562-55320584 TGTAGGGAAAGCCTTTACTGAGG 0: 1
1: 0
2: 2
3: 16
4: 137
1168283777_1168283782 -2 Left 1168283777 19:55320541-55320563 CCCTCGGGCAGAATTACCTGATG 0: 1
1: 0
2: 0
3: 2
4: 46
Right 1168283782 19:55320562-55320584 TGTAGGGAAAGCCTTTACTGAGG 0: 1
1: 0
2: 2
3: 16
4: 137
1168283778_1168283782 -3 Left 1168283778 19:55320542-55320564 CCTCGGGCAGAATTACCTGATGT 0: 1
1: 0
2: 1
3: 4
4: 60
Right 1168283782 19:55320562-55320584 TGTAGGGAAAGCCTTTACTGAGG 0: 1
1: 0
2: 2
3: 16
4: 137
1168283769_1168283782 13 Left 1168283769 19:55320526-55320548 CCCCCCAAATCCCTACCCTCGGG 0: 1
1: 0
2: 0
3: 12
4: 154
Right 1168283782 19:55320562-55320584 TGTAGGGAAAGCCTTTACTGAGG 0: 1
1: 0
2: 2
3: 16
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168283782 Original CRISPR TGTAGGGAAAGCCTTTACTG AGG Exonic
903803695 1:25989134-25989156 TGTACGTAAAGCCTCTAATGCGG - Intronic
905248096 1:36628650-36628672 TGTAGAGGAAGCCTAGACTGGGG + Intergenic
905369618 1:37476073-37476095 GGGAGGGAAAGCCTTTTATGAGG + Intronic
908335452 1:63118452-63118474 TTTAGAGAAAGGCTTTGCTGAGG - Intergenic
912211619 1:107563206-107563228 TTTAGGAAATGCCTTTCCTGAGG - Intergenic
913015006 1:114723985-114724007 TGTAGTGAATGGCATTACTGAGG - Exonic
914702174 1:150144835-150144857 AGTAGGGAAAACCTGTAGTGGGG - Exonic
915805902 1:158849663-158849685 TTTAGTCACAGCCTTTACTGCGG - Intergenic
918031921 1:180822843-180822865 GGTAGAGAAAGCCTTTGCTTTGG - Intronic
918840537 1:189531005-189531027 TTTAAGGAAAACGTTTACTGTGG + Intergenic
919911555 1:202114094-202114116 TGTACTGAAAGCCTTTCATGTGG - Intergenic
922024153 1:221735176-221735198 TGTACCAAAGGCCTTTACTGGGG - Intronic
923496473 1:234530031-234530053 TCTAGGGAAAGTTTTTCCTGTGG - Intergenic
923516047 1:234698761-234698783 GGTTGGGAAAGCCTTTACCAAGG - Intergenic
923607583 1:235458501-235458523 TGTAAGGAAACCCCTTACTAGGG - Intronic
1063711345 10:8482224-8482246 AATGGAGAAAGCCTTTACTGTGG + Intergenic
1064680798 10:17809281-17809303 TTTAGGGAAAGCCTCTACTGAGG - Intergenic
1066670009 10:37827195-37827217 AATAGGGCAAGCCTTTACTAGGG + Intronic
1067216387 10:44307813-44307835 TGTAGCAAGAGCCTTTAATGTGG + Intergenic
1067254215 10:44619410-44619432 TGTAGGGAAAACTCTTGCTGAGG - Intergenic
1072552112 10:96486976-96486998 TGCAGGGAAATCCTTTACGAAGG + Intronic
1075062239 10:119265273-119265295 GGTAGAGAAAGCCTTTGCTGAGG + Intronic
1082755546 11:57072469-57072491 TGGAGGTAAAGTCTTTACAGAGG - Intergenic
1084830680 11:71766577-71766599 TTCAGGGAAAGCCTTCACTTTGG - Intergenic
1088478077 11:110264991-110265013 TTTAGGGAAAGCCTTTTCTATGG - Intronic
1089400285 11:118160476-118160498 CCTAGGGAAGGCCTTGACTGGGG + Intergenic
1093796737 12:23321871-23321893 TGAGGGCAAGGCCTTTACTGTGG - Intergenic
1094117614 12:26934395-26934417 TGTAGGGAAAGCCTAGAATGGGG + Intronic
1094330959 12:29292775-29292797 TGTAGGGCCAGCCTTTTCAGTGG + Intronic
1095329142 12:40936856-40936878 TGTAGGGATGGGCTTTCCTGTGG - Exonic
1096512961 12:52141990-52142012 TGTGGGGAAAGGCTTCAATGAGG + Intergenic
1101346922 12:103894495-103894517 TGAAGCCAGAGCCTTTACTGGGG - Intergenic
1101684770 12:107008089-107008111 TATAGGGAAAGCCCACACTGCGG - Intronic
1102365179 12:112327741-112327763 TGTAAGGAAAGCATTTCCTGTGG - Intronic
1107838981 13:44436318-44436340 TGTGGGGAAAGCCTGTTCTCTGG + Intronic
1108256346 13:48615128-48615150 TTTAGTGAAAGGCTATACTGGGG - Intergenic
1109160460 13:58967298-58967320 TGCAGGTAAAGCGTTTAATGTGG - Intergenic
1109647243 13:65274528-65274550 TTTAAGGAGAACCTTTACTGGGG - Intergenic
1109875842 13:68403758-68403780 TTTAGGGAAGACCTTTATTGAGG + Intergenic
1113668485 13:112158854-112158876 TATAGGCAAAGCCTGTACTAGGG - Intergenic
1115915787 14:38312440-38312462 TTCGAGGAAAGCCTTTACTGAGG + Intergenic
1116170763 14:41399221-41399243 TCTAGGCACAGTCTTTACTGTGG - Intergenic
1116846465 14:49868661-49868683 TGTAGGAAGAGCCTTTAATATGG + Intergenic
1121941231 14:98072932-98072954 TGTTTGGAATGCCTTTTCTGAGG - Intergenic
1122099969 14:99400364-99400386 CGTAGGGACAGCTTTTACCGTGG - Intronic
1131167207 15:90150881-90150903 TGTAGGTAAAGTCTTTAAAGAGG - Intergenic
1131503496 15:92994065-92994087 TTTGGGGACAGCCTTTACTTAGG + Intronic
1132424107 15:101699464-101699486 TGAACAGAAAGCCTTTACAGTGG - Intronic
1134024889 16:10946078-10946100 TGAAGGGAAAGGCTTTAGGGAGG + Intronic
1134836310 16:17364046-17364068 TGGAGATAAGGCCTTTACTGAGG - Intronic
1137590416 16:49689997-49690019 TGGAGAGGAAGCCTTTCCTGGGG - Intronic
1140624691 16:76778147-76778169 TTTAAGGAAAGATTTTACTGAGG + Intergenic
1141017733 16:80466365-80466387 AGTAAGGAAAGCCTTTCCTTTGG + Intergenic
1141579977 16:84990837-84990859 TGTAGGCATAACCTGTACTGTGG - Intronic
1142308443 16:89298709-89298731 TGTCAGGGAAGCCTTTGCTGCGG + Intronic
1142747326 17:1966435-1966457 TGTAGGAAAAGCATTCCCTGAGG + Intronic
1146516832 17:33496026-33496048 TGTAGGGAAAGACTGTGATGTGG - Intronic
1148161551 17:45453206-45453228 TGTAGGGCAAGCCTGATCTGTGG + Intronic
1148767598 17:50048227-50048249 GGTGGGAAAAGGCTTTACTGAGG + Intergenic
1150188667 17:63214592-63214614 TGTAGCTGAAGCCTTTGCTGTGG + Intronic
1150392787 17:64799851-64799873 TGTAGGGCAAGCCTGATCTGTGG + Intergenic
1155094553 18:22543407-22543429 TTTAGGGAGAGCCTTTGATGAGG - Intergenic
1156472477 18:37386291-37386313 TGAAGAGGAAGCCTTTACAGAGG + Intronic
1159341112 18:67134917-67134939 CCTAGAGAAAGCTTTTACTGTGG + Intergenic
1161063397 19:2226394-2226416 AGCCGGGAAAGCCTTTCCTGGGG - Exonic
1166945427 19:46393364-46393386 GGGAGGGAAAGCATTTAATGGGG + Intergenic
1168283782 19:55320562-55320584 TGTAGGGAAAGCCTTTACTGAGG + Exonic
925736598 2:6969258-6969280 TGGAGGGAGGGCCTTTACAGTGG + Intronic
930025828 2:47028582-47028604 TGGAAGGAAAGGCTTTCCTGAGG + Intronic
930317227 2:49812574-49812596 TGCAGTGAAAGCCTTTACCTTGG + Intergenic
930484499 2:51995349-51995371 TGTAGGCAAAGACATTATTGGGG + Intergenic
932275110 2:70445670-70445692 GGTAGGGAAAGACTTTACTGAGG + Intergenic
935688955 2:105713176-105713198 TGGAAGGAAAGCATTTTCTGGGG + Intergenic
935708688 2:105878336-105878358 TGGAGACAAAGCCTTTACAGGGG + Intronic
939978894 2:148754989-148755011 TGGAGGCAAAGCATTTTCTGTGG + Intronic
940700912 2:157041711-157041733 TGTTTGGAAAGCCTTTCCTATGG - Intergenic
942144800 2:173016437-173016459 TGTAAGGAAGGGCTTGACTGTGG + Exonic
942989545 2:182182867-182182889 GGTAAGGAAAGCCTTCACTGAGG - Intronic
943340564 2:186675677-186675699 TGTACGTAAAGTCATTACTGTGG + Exonic
945160619 2:206886491-206886513 TGTAGGGAAGATCTATACTGGGG + Intergenic
945498978 2:210544827-210544849 TTTAGGGAATGTATTTACTGAGG + Intronic
946446616 2:219745606-219745628 GGTTGGGAAAGGCTTTACAGAGG + Intergenic
946547067 2:220755829-220755851 TGTAGGGAAAGCCTTCATATGGG + Intergenic
946865443 2:224038582-224038604 TGTGGGGAAAGCCTTTAACTTGG - Exonic
947516456 2:230809112-230809134 AGTGGGGAAAGCCTGTACAGAGG + Intronic
1168745509 20:236351-236373 TGGAGGTAAAGCCTTTAAAGAGG + Intergenic
1175745292 20:61452315-61452337 TGTAAGGAAATCCTTAAATGAGG - Intronic
1178738038 21:35170613-35170635 TTTAGGGAATGTCTTTAATGTGG - Intronic
1179538353 21:42067297-42067319 TGTAGGTAAGGCCATTACTGGGG - Intronic
1179945429 21:44670942-44670964 GGTGGGGAAAGCCTGTACTCAGG - Intronic
1184387580 22:44185166-44185188 CCTAGGAAAAGCCTTTATTGGGG + Intronic
1185179336 22:49350175-49350197 CGTGGGCAAAGCCTTTACTGTGG + Intergenic
949790987 3:7791873-7791895 TGTAGGGAAGGCCTTTCCTATGG - Intergenic
953453606 3:43024332-43024354 TGCAGCTGAAGCCTTTACTGTGG - Intronic
963611448 3:147473690-147473712 TGAAGGGAAAACCATGACTGAGG - Intronic
965239797 3:166181022-166181044 TATAATGAAAGCATTTACTGTGG + Intergenic
967280342 3:187816348-187816370 TGGATGGAAAGCCTTTCCTCTGG - Intergenic
970717243 4:18940669-18940691 TGGAGGTAGAGCCTTTACGGAGG - Intergenic
970827476 4:20293815-20293837 TGGAGAGAGAGCCTTCACTGTGG + Intronic
972337790 4:38123191-38123213 TGTAGGGAAAGCCTTTCCCCAGG + Intronic
973540684 4:51932371-51932393 TGTGTGGAAAGCCTTCACTTTGG + Intergenic
973975786 4:56261103-56261125 TGTAGGGGTATCCTTTGCTGAGG + Intronic
977274443 4:94958617-94958639 TGTAGACAAAGCCTTTAAAGAGG - Intronic
977893140 4:102335012-102335034 TGTGGGTAGGGCCTTTACTGTGG - Intronic
979286937 4:118936863-118936885 TTTAAGGAAAGCCTGTAATGAGG + Intronic
980890124 4:138805906-138805928 TGTAGGGAAAGCCGAAACTCAGG + Intergenic
981745772 4:148050937-148050959 AGGAGGCAATGCCTTTACTGTGG + Intronic
984999202 4:185468284-185468306 TGTAGATAAAGCCCTTACTGAGG + Intronic
986553157 5:8981404-8981426 GGGAGCCAAAGCCTTTACTGGGG - Intergenic
987634707 5:20525323-20525345 TGTAGTGTCAGCATTTACTGAGG + Intronic
990275826 5:54195116-54195138 TGTAGTGTAAGCCTTAAGTGGGG - Intronic
994181761 5:96775451-96775473 TGTAGGAAAACCCTTTTCTTAGG - Intronic
994275599 5:97833016-97833038 TGTGGGAGAAGCCTTTATTGTGG - Intergenic
996175980 5:120358552-120358574 TGTAGGCAATGCCTTTTCTTTGG + Intergenic
997622787 5:135309786-135309808 TGCAGGCAAAGCCTTTGCTGTGG + Intronic
997700255 5:135892807-135892829 ATTAGAGAAAGCCTTTTCTGGGG + Intronic
998572616 5:143276877-143276899 TGAATGGAAAGCCTCTAATGAGG - Intergenic
999039489 5:148391429-148391451 AGTAGGGGAAGCTTTTACAGAGG + Intronic
1000492476 5:161931640-161931662 TGTAGGAACAGCATTTTCTGTGG - Intergenic
1006563879 6:34937487-34937509 TGTAGGTAAGGCCCTTACTGTGG + Intronic
1007693662 6:43718387-43718409 TGTAGGGAGAGAATTGACTGTGG + Intergenic
1007816696 6:44530022-44530044 TGCAAGGAAGGCATTTACTGAGG + Intergenic
1012712099 6:102619677-102619699 TTGAGGGAAAGCCTTTATTAAGG - Intergenic
1019266164 7:118608-118630 TGTGGTCAAAGCCTTCACTGGGG - Intergenic
1020944185 7:14580271-14580293 TATAGGGAAAGACCTCACTGAGG - Intronic
1022427127 7:30279496-30279518 TGTAGGGCTTGCCTTTACGGGGG + Intergenic
1023542547 7:41281628-41281650 TGTAGGGAAAGAAGTTAGTGAGG - Intergenic
1023859968 7:44212732-44212754 TCTTGGGAAAGCCTCTCCTGGGG + Exonic
1027628561 7:80574790-80574812 GGTAGGGAGAGCCTTTCCTCAGG + Intronic
1031604555 7:123752661-123752683 TGTAGTGACACCCTTTACTGTGG + Intergenic
1033548373 7:142423082-142423104 TTCAGGGATAGCCTATACTGTGG + Intergenic
1033719820 7:144047388-144047410 GATAGGGAAAGGCTTTGCTGTGG - Intergenic
1034544178 7:151779025-151779047 TGTAAGGAAAGCATTTATGGGGG - Intronic
1035232229 7:157472267-157472289 TGTAGGGACAAAGTTTACTGAGG + Intergenic
1036625860 8:10470930-10470952 TGCAGGCAGAGTCTTTACTGTGG - Intergenic
1039733693 8:40306954-40306976 AGTAGGAAAAGCCTGTTCTGTGG - Intergenic
1040077224 8:43247806-43247828 TGTAGATAAATTCTTTACTGGGG + Intergenic
1041331230 8:56727686-56727708 TGTAGAGAAAGTCTCTAATGTGG - Intergenic
1044486231 8:92757541-92757563 TGTAGGTAAAGCCTATACATGGG - Intergenic
1046780727 8:118211750-118211772 TGGAGGGAAAGCTTTTCATGGGG - Intronic
1047858499 8:128938432-128938454 AATAGGGAAAGCCTTTCCAGAGG - Intergenic
1048944269 8:139429757-139429779 TGTTGGGCAAGGCTTTTCTGTGG - Intergenic
1050802722 9:9636219-9636241 TGTCGGGAAAGACTTTCCTGAGG - Intronic
1050858082 9:10387379-10387401 TTAAGGAAAAGGCTTTACTGGGG + Intronic
1051166254 9:14265335-14265357 TGGAGATAAAGCCTTTACGGAGG + Intronic
1055114344 9:72590922-72590944 GGTTGGGAAAGGCTTTCCTGGGG + Intronic
1056076312 9:83044482-83044504 TGTAGGGCAAGCCTTTTCTTGGG + Intronic
1057475180 9:95393926-95393948 TGTAGGGAAAGACTTTATGGAGG + Intergenic
1186095804 X:6100425-6100447 TGTGTGGAAAGCATTTACTTTGG + Intronic
1187900180 X:24020748-24020770 TCTAGGAAAAGCCTCTATTGGGG + Intronic
1189101035 X:38189968-38189990 TGTAAGTACAGCCTTCACTGAGG - Intronic
1189216989 X:39334347-39334369 TGTATGGAAATCCATTTCTGAGG - Intergenic
1189422092 X:40865067-40865089 TGTAAGGGAAGCCTATATTGTGG - Intergenic
1190634213 X:52418571-52418593 TGTATGGAAAGTATTTATTGAGG - Intergenic
1200102799 X:153696452-153696474 TGTCGGGGAAGCCTTTCTTGGGG - Exonic
1200267809 X:154655233-154655255 TGTCGGGGAAGCCTTTCTTGGGG - Intergenic