ID: 1168288121

View in Genome Browser
Species Human (GRCh38)
Location 19:55344522-55344544
Sequence GAACCCTGGTTGCCAGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 304
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 288}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168288114_1168288121 20 Left 1168288114 19:55344479-55344501 CCAGTTTGGCCAGCGTTGCCCGG 0: 1
1: 0
2: 0
3: 4
4: 59
Right 1168288121 19:55344522-55344544 GAACCCTGGTTGCCAGCTGCTGG 0: 1
1: 0
2: 0
3: 15
4: 288
1168288116_1168288121 11 Left 1168288116 19:55344488-55344510 CCAGCGTTGCCCGGCTGTTTGTG 0: 1
1: 0
2: 0
3: 2
4: 47
Right 1168288121 19:55344522-55344544 GAACCCTGGTTGCCAGCTGCTGG 0: 1
1: 0
2: 0
3: 15
4: 288
1168288117_1168288121 2 Left 1168288117 19:55344497-55344519 CCCGGCTGTTTGTGCAGTTGCAC 0: 1
1: 0
2: 4
3: 27
4: 259
Right 1168288121 19:55344522-55344544 GAACCCTGGTTGCCAGCTGCTGG 0: 1
1: 0
2: 0
3: 15
4: 288
1168288118_1168288121 1 Left 1168288118 19:55344498-55344520 CCGGCTGTTTGTGCAGTTGCACT 0: 1
1: 0
2: 3
3: 4
4: 145
Right 1168288121 19:55344522-55344544 GAACCCTGGTTGCCAGCTGCTGG 0: 1
1: 0
2: 0
3: 15
4: 288

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168288121 Original CRISPR GAACCCTGGTTGCCAGCTGC TGG Intronic
900529402 1:3145333-3145355 GGGCCCAGGTCGCCAGCTGCAGG - Intronic
901053207 1:6436057-6436079 GAACACTCTTTGCCAGCTGCTGG - Intronic
901192732 1:7422215-7422237 GATGCCTGGTTTCCAGCTGTGGG + Intronic
902055319 1:13595853-13595875 GAAGCCTGGTGGACAGCGGCAGG + Intronic
902481045 1:16712029-16712051 GAACACTCTTTGACAGCTGCTGG + Intergenic
903489578 1:23718137-23718159 GAACTATGGTTGCCAGGGGCTGG + Intergenic
904116802 1:28168580-28168602 GAACGGTGGTTGCCAGGGGCTGG + Intronic
905486910 1:38305841-38305863 GAATGCTGGTTGCCAGAGGCTGG + Intergenic
905506917 1:38487207-38487229 GAACCATGGTTACCAGGGGCAGG - Intergenic
905619400 1:39429930-39429952 GGAACTTGGTGGCCAGCTGCCGG - Exonic
905674474 1:39816157-39816179 GAACCCTCCATCCCAGCTGCAGG + Intergenic
907225117 1:52938966-52938988 GATCAGTGGTTGCCAGGTGCTGG - Intronic
907309994 1:53533743-53533765 GGACCTTGGCAGCCAGCTGCAGG - Intronic
913091508 1:115479383-115479405 CAAGCCTGGATGGCAGCTGCGGG - Intergenic
917637089 1:176947837-176947859 GAACCCTGGGTGTCAGGTGTTGG - Intronic
917705898 1:177634257-177634279 GGACCCTCCTTGCCAGGTGCGGG - Intergenic
918117429 1:181509022-181509044 GAACGATGGTGGTCAGCTGCTGG + Intronic
920951838 1:210579324-210579346 GAATGGTGGTTGCCAGGTGCCGG + Intronic
922538993 1:226404824-226404846 GAACCCAGTTCACCAGCTGCTGG - Intronic
923022929 1:230178939-230178961 GATCGCTGGTTGCCAGGGGCTGG - Intronic
923475327 1:234326284-234326306 GAATGCTGGTTGCCAGTGGCTGG + Intergenic
923568011 1:235091240-235091262 GAGCCCTGGTTTCCTGCTGTGGG - Intergenic
924210383 1:241759891-241759913 GAATGCTGGTTGCCAGGAGCTGG - Intronic
1063973463 10:11397276-11397298 GAGCCCTGGGGGACAGCTGCTGG - Intergenic
1063997340 10:11632353-11632375 GAATGGTGGTTGCCAGCAGCTGG - Intergenic
1064918057 10:20484426-20484448 GAACCTTGGATGGCAGATGCTGG - Intergenic
1065008730 10:21402901-21402923 GAACCCTGGCTTCCAGTTGGCGG - Intergenic
1065619407 10:27565038-27565060 GAAGACTGGTTGCCAGAGGCTGG - Intergenic
1066643891 10:37585453-37585475 GAACAGTGGTTGCCTGGTGCTGG + Intergenic
1067053648 10:43039148-43039170 GGACCCTGGAGTCCAGCTGCTGG - Intergenic
1067262754 10:44708685-44708707 GGAGTCTGCTTGCCAGCTGCAGG + Intergenic
1067748365 10:48953374-48953396 GAACCCTGGATGATAGCTGTTGG - Intronic
1070248125 10:74750777-74750799 GAACCCAGGCTGCCTGCTTCTGG + Intergenic
1070468758 10:76755441-76755463 GAACTGTGGTTGCCAGTGGCTGG - Intergenic
1073480593 10:103784027-103784049 CCACCCTGGTGCCCAGCTGCAGG + Intronic
1074470786 10:113724853-113724875 GAACGGTGGTTGCCAGGGGCTGG - Intronic
1074855650 10:117471532-117471554 GAATGCTGGTTGCCAGGGGCTGG - Intergenic
1075324729 10:121522108-121522130 GAACGGTGGTTGCCAGGGGCTGG + Intronic
1075329087 10:121559705-121559727 GAACCCTGCTTGCAAGGTGAAGG + Intronic
1075697346 10:124447073-124447095 ACGCCCTGGCTGCCAGCTGCTGG - Exonic
1076592310 10:131592201-131592223 GAATGGTGGTTGCCAGCAGCTGG - Intergenic
1077224970 11:1435712-1435734 GCACCCTGGCTCCCAGCTGAGGG + Intronic
1078626097 11:12960002-12960024 GAATGCTGGTTGCCAGGGGCTGG - Intergenic
1079753512 11:24228053-24228075 GAACCCTGCTTGAAAGCCGCAGG - Intergenic
1081442409 11:43094685-43094707 GAATCGTGGTTGCCAGAGGCTGG + Intergenic
1081569807 11:44282800-44282822 GATCACTGGTTGCCAGGTGTAGG + Intronic
1083184610 11:61009843-61009865 GGACCCTGGCTGCCAGCGACTGG - Exonic
1083281822 11:61631498-61631520 GAATGCTGGTTGCCAGGGGCTGG - Intergenic
1083304181 11:61754188-61754210 GAACCCTTGTTCACACCTGCTGG + Intronic
1084036408 11:66513984-66514006 GAAGCCTGGTTTCCAAATGCAGG - Intronic
1084207694 11:67605477-67605499 GAGTCCTGGCTGCCAGCCGCAGG - Intronic
1084598993 11:70133753-70133775 AAACCCTGAGTCCCAGCTGCAGG - Intronic
1084747138 11:71180040-71180062 GAACACTGGTTGTCAGCTCCCGG - Intronic
1085164733 11:74388127-74388149 GAATGATGGTTGCCAGATGCTGG + Intronic
1085198975 11:74690043-74690065 GACCCCTGGCTTCCAGCTGTTGG - Intergenic
1085669523 11:78449636-78449658 GAAACCTGGTTGTAAGCTTCTGG - Intronic
1088939170 11:114436440-114436462 GAATCGTGGTTGCCAGGGGCTGG + Intronic
1089541051 11:119189142-119189164 GAGACCTGGCTGCCAGCTTCAGG - Exonic
1089948475 11:122502663-122502685 GAACAGTGGTTGCCAGGGGCTGG - Intergenic
1090170021 11:124593211-124593233 GAACAATGGTTACCAGCGGCAGG + Intergenic
1090361437 11:126175440-126175462 GACCCCTAGTTCTCAGCTGCTGG + Intergenic
1091849724 12:3685703-3685725 GAATGCTGGTTGCCAGGGGCTGG + Intronic
1094559810 12:31541577-31541599 GAACCCTTGTAGACAGCTGGTGG + Intronic
1097094733 12:56537362-56537384 GAACAGTGGTTGCCAGAGGCTGG - Intronic
1097166066 12:57087409-57087431 GATCCCGGGCTGCCAGCCGCTGG - Intronic
1097334078 12:58362716-58362738 GAACTATGGTTCTCAGCTGCTGG - Intergenic
1100565489 12:95790459-95790481 GGCCCCTGGCTCCCAGCTGCCGG - Exonic
1101954702 12:109203028-109203050 GAACAATGGTTGCCAGGGGCTGG - Intronic
1103901799 12:124307285-124307307 GAACCCTGGCTGCCCACTGCTGG + Intronic
1105429320 13:20322926-20322948 GAATCATGGTTGCCAGGGGCTGG + Intergenic
1106193698 13:27475784-27475806 GAACGGTGGTTGCCAGGGGCTGG - Intergenic
1106333083 13:28757149-28757171 GAATGGTGGTTGCCAGATGCTGG - Intergenic
1108095670 13:46898093-46898115 GACCACAGGGTGCCAGCTGCAGG - Intergenic
1108511692 13:51162012-51162034 GAAGCCTGCATGCCAGCAGCAGG + Intergenic
1111959497 13:94794439-94794461 GAACCGTGGTTGCCAGGGGTTGG + Intergenic
1112714290 13:102165840-102165862 GATTCCTGGTTGCCAGAGGCTGG + Intronic
1115694673 14:35883845-35883867 GAACACTGGCTGCCAGCAGAGGG + Intronic
1117315449 14:54567275-54567297 GAAGCCTGCTTCCCAGGTGCGGG - Intronic
1118813192 14:69290399-69290421 GAACCCAGGCTGCCTGCAGCTGG + Intronic
1119142774 14:72282943-72282965 GAATCGTGGTTGCCAGGGGCTGG - Intronic
1121025483 14:90612969-90612991 GAACGCTGTTTCCCAGCTGGTGG - Intronic
1121472687 14:94167493-94167515 GAACCCTGGTTTCAAGCTCATGG + Intronic
1121530878 14:94652406-94652428 GAATGCTGGTTGCCAGGTGCTGG - Intergenic
1122149450 14:99717124-99717146 GGACCTGGGTTCCCAGCTGCAGG - Intronic
1122257494 14:100489655-100489677 GAGTCCAGGCTGCCAGCTGCAGG - Intronic
1123982996 15:25620999-25621021 GAATGGTGGTTGCCAGCGGCTGG + Intergenic
1124423723 15:29544320-29544342 TAACAGTGGTTGCCAGCAGCTGG + Intronic
1124547623 15:30646259-30646281 GAAGCCTGGTGGCCACCTCCTGG - Exonic
1124913938 15:33950183-33950205 GAACAGTGGTTGCCAGAGGCTGG + Intronic
1124996918 15:34732447-34732469 GAACCCTGGTTGCTACTTACAGG - Intergenic
1125919685 15:43518093-43518115 GGCCCCTGGGTGTCAGCTGCTGG + Intronic
1126461674 15:48921282-48921304 GAACAGTGGTTGCCAGGGGCTGG + Intronic
1126805257 15:52341592-52341614 GTCCCTTGGTTGCCAACTGCTGG + Intronic
1129431962 15:75505632-75505654 GCATCCTGGTAACCAGCTGCTGG + Intronic
1131079231 15:89520848-89520870 GAACGGTGGTTGCCAGGGGCGGG + Intergenic
1131521204 15:93117362-93117384 GAATGGTGGTTGCCAGCGGCTGG + Intergenic
1132349470 15:101130490-101130512 GAACAGTGGTTGCCAGGGGCTGG + Intergenic
1132634916 16:939271-939293 GAACCCTGGGTGCAGGCTGGCGG + Intronic
1132858071 16:2056314-2056336 GAGCCCTGTGTGCCACCTGCTGG + Intronic
1133702457 16:8321742-8321764 GAACGGTGGTTGCCAGGGGCTGG - Intergenic
1135477214 16:22787278-22787300 GAACAGTGGCTGCCAGCAGCTGG - Intergenic
1135501998 16:23004128-23004150 GAACGGTGGTTGCCAGGGGCTGG + Intergenic
1139776686 16:69320830-69320852 GCACCCGGGCTGCCAGCAGCAGG - Intronic
1141156787 16:81602593-81602615 CACCCATGGTTGCCAGCCGCTGG - Intronic
1141637820 16:85324085-85324107 GAACCCTGGTGCACAGCTGCTGG + Intergenic
1143684541 17:8503590-8503612 GTGCCCAGGTTTCCAGCTGCTGG + Intronic
1144439076 17:15265271-15265293 GGAGCCTGGTTGGAAGCTGCAGG - Intronic
1151217296 17:72585983-72586005 GAACAGTGGTTGCCAGGGGCTGG + Intergenic
1152806351 17:82358461-82358483 GATTCCTGGTTGCCAGGGGCTGG + Intergenic
1153261379 18:3227436-3227458 GAACAGTGGTTGCCAGGGGCTGG + Intergenic
1154313613 18:13286106-13286128 GAACCATGGGTGTCAGCGGCTGG - Intronic
1154494878 18:14948270-14948292 GCCCACTGGTTCCCAGCTGCTGG - Intergenic
1157570300 18:48707885-48707907 GATCCGTGGTTGCCAGGGGCTGG - Intronic
1157886113 18:51368512-51368534 TAACACTTCTTGCCAGCTGCAGG - Intergenic
1158261946 18:55616144-55616166 GAATGATGGTTGCCAGCGGCTGG - Intronic
1159833045 18:73301816-73301838 GAACAGTGGTTGCCAGGTGCTGG + Intergenic
1160653562 19:247206-247228 GTGCCCTGGTTGCCAGCAGGGGG - Intergenic
1161150123 19:2702989-2703011 GAATCCTGCATGCCAGCTCCGGG + Intergenic
1162069656 19:8146137-8146159 GGACGCTGGCTCCCAGCTGCGGG - Exonic
1162573779 19:11487084-11487106 GCACCGTTGTTGCCAGCTCCGGG + Exonic
1163603815 19:18263674-18263696 AAGCCCTGGATGCCTGCTGCTGG + Intronic
1164736106 19:30542614-30542636 GAACACTGGTAGCCTTCTGCGGG - Intronic
1164822829 19:31263647-31263669 GAAACCTGGAAGCCTGCTGCAGG - Intergenic
1165075553 19:33278249-33278271 TAACCCTGGCTCCCTGCTGCTGG + Intergenic
1167211506 19:48136704-48136726 AAACCCTGGCTTCCTGCTGCAGG + Intronic
1167977358 19:53240662-53240684 GATCAGTGGTTGCCAGGTGCTGG + Intronic
1168288121 19:55344522-55344544 GAACCCTGGTTGCCAGCTGCTGG + Intronic
1168509796 19:56965391-56965413 GAACAGTGGTTGCCAGGGGCTGG - Intergenic
1168559984 19:57374339-57374361 GAGCCCTGCATCCCAGCTGCTGG - Intronic
1202715083 1_KI270714v1_random:37933-37955 GAACACTCTTTGACAGCTGCTGG + Intergenic
926533618 2:14082831-14082853 GAGCTCTGGCTGCCATCTGCTGG + Intergenic
927206002 2:20610973-20610995 GACCCATGGTTGCCAGGGGCTGG - Intronic
927755010 2:25701647-25701669 GGGCCCTGTTTGGCAGCTGCTGG - Intergenic
928886424 2:36153792-36153814 GCATCGTGGTTGTCAGCTGCAGG + Intergenic
929129989 2:38557754-38557776 AAATTCTGGTTGCCAGCTGGGGG - Intergenic
930146112 2:48006263-48006285 GAACCCTGGTTGGCTGAGGCAGG + Intergenic
931023445 2:58078163-58078185 GAATGCTGGTTTCCAGGTGCTGG - Intronic
931754527 2:65360648-65360670 GAACAGTGGTTGCCAGAGGCGGG + Intronic
933809522 2:86024332-86024354 GAACAGTGGTTGCCAGGGGCTGG + Exonic
935974735 2:108567032-108567054 GAACAGTGGTTGCCAGGAGCTGG - Intronic
938100392 2:128494011-128494033 GAACCCTGGTGGCAGGCTCCAGG - Intergenic
938293972 2:130165685-130165707 GAATAGTGGTTGCCAGGTGCTGG + Intronic
938859637 2:135354746-135354768 GATCCGTGGTTGCCAGGGGCTGG + Intronic
939118413 2:138088111-138088133 GTAGCCTGGGTGCCAGCTTCTGG - Intergenic
939976712 2:148725975-148725997 GAATGGTGGTTGCCAGCGGCTGG - Intronic
939987187 2:148841281-148841303 GAATCATGGTTGCCAGGTACTGG - Intergenic
940273597 2:151916752-151916774 GAACAGTGGTTCCCAGCTGGAGG + Intronic
941764000 2:169276235-169276257 AAACCCTGAATGCCACCTGCTGG + Intronic
943894928 2:193345491-193345513 GAATGGTGGTTGCCAGGTGCTGG - Intergenic
946865203 2:224036314-224036336 CATCCCTGGTTGCCACCTTCTGG - Intronic
947624766 2:231612713-231612735 GCCCCCTGGTGGCCAGTTGCAGG - Intergenic
947717005 2:232345863-232345885 GAAACCTGTTTCCAAGCTGCGGG - Intergenic
947735447 2:232452184-232452206 GAAACCTGTTTCCAAGCTGCGGG - Intergenic
948191337 2:236061672-236061694 GATTCCTGCTTGCCAGGTGCAGG + Intronic
948798891 2:240421215-240421237 GGACCCTGGAAGGCAGCTGCTGG + Intergenic
1169101365 20:2952734-2952756 GAACGATGGTTGCCAGGGGCTGG - Intronic
1169162018 20:3388766-3388788 GAATGGTGGTTGCCAGGTGCTGG + Intronic
1169184992 20:3607392-3607414 GAATGGTGGTTACCAGCTGCTGG - Intronic
1169341886 20:4802662-4802684 GAACGGTGGTTGCCAGAGGCTGG + Intronic
1169972524 20:11283751-11283773 GAACGATGGTTGCCAGGGGCTGG + Intergenic
1171301686 20:24066591-24066613 GACCCGTGGTTGCCAGCTTGGGG - Intergenic
1172150380 20:32786387-32786409 GAGACCTGGTAGCCAGCTTCAGG - Intronic
1173981930 20:47231142-47231164 AATCCCTGGGTGCCTGCTGCAGG - Intronic
1174154116 20:48505725-48505747 CTACCCGGGTTGCCAGCTACCGG + Intergenic
1174154357 20:48507001-48507023 CTACCCGGGTTGCCAGCTACCGG + Intergenic
1174154742 20:48509060-48509082 CTACCCGGGTTGCCAGCTACCGG + Intergenic
1174155256 20:48511804-48511826 CTACCCGGGTTGCCAGCTACCGG + Intergenic
1175198152 20:57260345-57260367 GGACCCTGGATTCCAGATGCAGG - Intronic
1176874144 21:14110646-14110668 GAACCATGGTTACCAGAGGCTGG - Intronic
1179581963 21:42349832-42349854 GGTCCTGGGTTGCCAGCTGCTGG + Intronic
1180217980 21:46338318-46338340 GACCACTGGTTGCCAGAGGCTGG - Intronic
1180936419 22:19628145-19628167 GAATCGTGGTTGCCAGGGGCTGG - Intergenic
1180937572 22:19636188-19636210 GAACGGTGGTTGCCAGGGGCTGG + Intergenic
1180984314 22:19895476-19895498 GCTCCCTGATGGCCAGCTGCAGG - Exonic
1181683488 22:24512692-24512714 GAACGGTGGTTGCCAGGGGCTGG - Intronic
1181970235 22:26684343-26684365 AAACACTGGCTTCCAGCTGCTGG + Intergenic
1183010044 22:34938470-34938492 GAATGGTGGTTGCCAGATGCTGG + Intergenic
1183267329 22:36836735-36836757 GAACTCCTGTTGCCAGATGCAGG + Intergenic
1183911889 22:41086051-41086073 GAACAGTGGTTGCCAGGGGCTGG - Intergenic
1183986657 22:41573975-41573997 GAAGCCTGGGAGCCAGCGGCTGG + Intronic
1184275156 22:43405724-43405746 GAACCCAGGGTTCCTGCTGCTGG + Intergenic
950140081 3:10609297-10609319 GAACTCTGGCTGCCAGCAGCAGG + Intronic
950341962 3:12255139-12255161 GAACAGTGGTTGCCAGGGGCAGG - Intergenic
950542977 3:13623166-13623188 TGACCCTGCTTGCCAGCAGCCGG + Intronic
950636511 3:14319065-14319087 TAACCCAGCTTCCCAGCTGCAGG - Intergenic
950928933 3:16770210-16770232 AGACCCTGCTTCCCAGCTGCAGG + Intergenic
952473905 3:33685782-33685804 GAATAGTGGTTGCCAGCAGCTGG + Intronic
953548175 3:43879830-43879852 GATCACTGGTTGCCAGAAGCTGG + Intergenic
953762008 3:45695839-45695861 GAACGGTGGTTGCCAGGGGCTGG - Intronic
954700255 3:52447115-52447137 CCCCCCTGCTTGCCAGCTGCAGG + Intergenic
955392845 3:58533847-58533869 GACCCTTGACTGCCAGCTGCTGG + Intronic
956850573 3:73224693-73224715 GAAACATGGCTGCCAGCTGTGGG + Intergenic
956850651 3:73225210-73225232 GCATCCTGGTTGGCACCTGCTGG - Intergenic
959449293 3:106480047-106480069 GATCCCTGGGTCCCAGCTACTGG - Intergenic
959783254 3:110262115-110262137 GAATGCTGGTTGCCAGGAGCTGG + Intergenic
961143902 3:124578398-124578420 GCTCCCTGGTTGCTAACTGCAGG - Intronic
961460702 3:127048400-127048422 GAACACTGGTTGTCAGGGGCTGG - Intergenic
962281179 3:134053162-134053184 GTCCCCTGGCAGCCAGCTGCAGG - Intergenic
963088548 3:141460935-141460957 CACCCCTGCTTCCCAGCTGCTGG + Intergenic
964284734 3:155105608-155105630 GAAACCTGGTGGCCAGCGTCTGG - Intronic
965005066 3:163010739-163010761 GAATCATGGTTGCCAGAGGCTGG + Intergenic
965134324 3:164741952-164741974 GAAGCCTGGTGGGCAGCTGTTGG + Intergenic
967552174 3:190809429-190809451 TAACACTGGTTGCAAGCTGGGGG - Intergenic
968372999 4:12175-12197 GTACCCTGGTTGCCAGCAGGCGG - Intergenic
968599455 4:1502156-1502178 GCTCCCTGGGAGCCAGCTGCAGG + Intergenic
969394743 4:6912911-6912933 GAACCCAGGCAGCCTGCTGCTGG + Intronic
969922922 4:10557561-10557583 GAACCATGGCTGACAGCAGCGGG - Intronic
971511738 4:27434980-27435002 GAATGTTGGTTGCCAGCGGCTGG + Intergenic
971537282 4:27769344-27769366 GATCAGTGGTTGCCAGATGCTGG - Intergenic
972614378 4:40684021-40684043 GAACAGTGGTTACCAGCGGCTGG - Intergenic
976071812 4:81249707-81249729 GAACAATGGTTGCCAGGGGCTGG + Intergenic
979768239 4:124489554-124489576 GAATGGTGGTTGCCAGCTGCTGG + Intergenic
981558192 4:146017981-146018003 GAAGGATGGTTGCCAGATGCCGG - Intergenic
981562708 4:146065035-146065057 GAACCATGGTTGCCAGGGGCTGG + Intergenic
982049827 4:151489591-151489613 CAGCCCTGCTTGCCAGCTGCTGG + Intronic
982503099 4:156184171-156184193 GAATGCTGGTTGCCAGGGGCTGG - Intergenic
985462396 4:190120392-190120414 GTACCCTGGTTGCCAGCAGGCGG + Intergenic
987594222 5:19974809-19974831 GCACCCTGGATCCCAGCTGATGG - Intronic
987677327 5:21091247-21091269 GAACCCTGTTTATTAGCTGCAGG - Intergenic
989443509 5:41501510-41501532 GAATGCTGGTTGCCAGAGGCTGG + Intronic
992349826 5:75917019-75917041 GAACCCTAGTTGCCAACAACAGG + Intergenic
992439691 5:76787447-76787469 CAACTCTGGTTCCCAGCTGCAGG + Intergenic
992881692 5:81116698-81116720 GAAAGCTGGTTGCCAGGGGCCGG - Intronic
993646697 5:90472023-90472045 GAACCCAGGTTTCCAGTTGATGG - Intronic
996560450 5:124822814-124822836 GAACTATGGTTACCAGCGGCTGG + Intergenic
997271853 5:132546326-132546348 GAAGCGTGGTTGCAAGGTGCTGG - Intronic
997694654 5:135851637-135851659 GTACCCTGGCTGCCAGAGGCAGG - Intronic
999231119 5:150062436-150062458 GAATCATGGTTGCCAGGGGCTGG - Intronic
1001083772 5:168685795-168685817 GAAGCCTGGTGGGCAGCGGCAGG + Exonic
1001635128 5:173204623-173204645 GAACCCTGGTCCCTTGCTGCTGG - Intergenic
1002084463 5:176763605-176763627 GAATCATGGTTGCCAGGGGCTGG - Intergenic
1002121095 5:177005805-177005827 GAACACTGGAGTCCAGCTGCTGG + Intronic
1002360669 5:178668218-178668240 GAATGGTGGTTGCCAGCGGCTGG + Intergenic
1003043861 6:2714919-2714941 GAACAGTGGTTGCCAGGGGCTGG + Intronic
1007351084 6:41273919-41273941 GCTCCCTGGCTGCCAGCTTCTGG - Intronic
1012548343 6:100446639-100446661 GAGCTCTGGGTGCCACCTGCGGG - Intronic
1013616398 6:111847132-111847154 GGCCCCTGGTTCCCAGCAGCTGG + Intronic
1016788551 6:148041062-148041084 GCAGCCTGGATGACAGCTGCTGG + Intergenic
1016873433 6:148840838-148840860 GCACCCGGGTGTCCAGCTGCTGG - Intronic
1017828231 6:158099392-158099414 GAACCCGGGTTGCTCACTGCAGG - Intergenic
1018041834 6:159931397-159931419 GAATGCTGGTTGCCAGAGGCTGG + Intergenic
1018124660 6:160670037-160670059 GAACCCTGGTTCCCACTTACTGG - Intergenic
1018558144 6:165071844-165071866 AATCCCTGGTTGCCAGGTGATGG + Intergenic
1018591357 6:165426994-165427016 GAACCCTTGTGCACAGCTGCTGG + Intronic
1019620627 7:1990208-1990230 GAACCCTGGCTGCAAGGTGAGGG + Intronic
1020153963 7:5706396-5706418 GAACCCTGGGTGCCAGAGGCTGG - Intronic
1020567342 7:9814503-9814525 ACACCCTGCTTGCAAGCTGCTGG - Intergenic
1020804007 7:12766001-12766023 CAACCCTGCCTCCCAGCTGCTGG - Intergenic
1021436731 7:20626132-20626154 GAACCGCGGTTGCCAGGGGCTGG + Intronic
1023288126 7:38640614-38640636 GAATGGTGGTTGCCAGGTGCTGG + Intergenic
1026234608 7:68515822-68515844 GAATGCTGGTTGCCAGGAGCTGG + Intergenic
1026970583 7:74465187-74465209 ACACCCTGGCTGCCAGCTGTGGG + Intronic
1027706137 7:81535867-81535889 GAAGCCTGGTTGCCTCCGGCCGG - Intergenic
1028976032 7:96915199-96915221 GAATAGTGGTTGCCAGGTGCTGG - Intergenic
1029242578 7:99174551-99174573 GAATGGTGGTTGCCAGGTGCTGG - Intronic
1029435572 7:100562345-100562367 GGACCCGGGGTGCCCGCTGCAGG + Exonic
1030866297 7:114705112-114705134 GAATGCAGGTTGCCAGGTGCAGG - Intergenic
1032487183 7:132296807-132296829 GAAGCCTCGTGCCCAGCTGCAGG + Intronic
1033916173 7:146329131-146329153 GAACCCTGGTGTCCTGCTGGTGG - Intronic
1034046488 7:147934033-147934055 GAATGCTGGTTGCCAGGGGCTGG + Intronic
1034567969 7:151930418-151930440 GAAGCCAGTTTGGCAGCTGCTGG + Intergenic
1034993689 7:155564972-155564994 GAACCGTGGGTGCCAGGGGCTGG + Intergenic
1035167153 7:156998654-156998676 GAAGGCTGGTTACCAGCAGCTGG + Intronic
1035513093 8:207001-207023 GTGCCCTGGTTGCCAGCAGGGGG - Intergenic
1038426288 8:27466050-27466072 GGACCCTGGGTGCCAGCTATGGG + Intronic
1039352583 8:36779283-36779305 GAACCCGGGATTCAAGCTGCAGG + Intergenic
1041085006 8:54248643-54248665 GAATCCTGGTTACCAGGGGCTGG + Intergenic
1043307334 8:78812062-78812084 GAACCATGGTTACCAGGAGCTGG - Intergenic
1044561487 8:93616996-93617018 GAACAGTGGTTGCCAGGGGCTGG + Intergenic
1045776976 8:105816011-105816033 GAACGATGGTTGCCAGAGGCTGG - Intergenic
1046053427 8:109051061-109051083 AATCCCTGGTTGCCAGAGGCTGG + Intergenic
1046770451 8:118112028-118112050 GCTCCCGGGTTGCAAGCTGCCGG + Intergenic
1046942163 8:119941832-119941854 AAACCCTGGTTTCCAGCTCTAGG + Intronic
1049777612 8:144413794-144413816 GCTCGCTGGGTGCCAGCTGCAGG + Exonic
1049826564 8:144672542-144672564 GCACCCTGGCTGCCAGGAGCTGG + Intergenic
1050044713 9:1530831-1530853 GAACCGTGGTTACCAGGGGCGGG + Intergenic
1050821855 9:9889091-9889113 GAATGATGGTTGCCAGGTGCTGG + Intronic
1051242667 9:15076403-15076425 GAATGCTGGTTGCCAGGGGCTGG + Intergenic
1053115873 9:35501692-35501714 GAACCATGGTTGGCTGCTACTGG - Intronic
1055460218 9:76512296-76512318 GAAAGTTGGTTGCCAGCGGCTGG - Intergenic
1057140769 9:92725632-92725654 GGACCCTGGTGGTCAGCTACAGG - Intronic
1057299563 9:93870061-93870083 GAAGCCTGAGAGCCAGCTGCTGG + Intergenic
1057473989 9:95383252-95383274 CAACCCTGTTTACGAGCTGCTGG + Intergenic
1057914785 9:99047451-99047473 GCTCCCTGGTAGCCAGGTGCTGG - Intronic
1059515592 9:114891687-114891709 GAAGGATGGTTACCAGCTGCTGG + Intergenic
1060063060 9:120478354-120478376 GAACAGTGGTTGCCAGGGGCTGG + Intronic
1060100418 9:120835759-120835781 GATTCCTGGTTGCCAGAGGCTGG + Intronic
1060105434 9:120870047-120870069 GAGCTCTGCCTGCCAGCTGCCGG + Intronic
1060276336 9:122185811-122185833 GTACCCTGGTTTCCCACTGCTGG + Intronic
1061058049 9:128234752-128234774 GAATGGTGGCTGCCAGCTGCCGG - Intronic
1061503344 9:131016225-131016247 GAATGCTGGTTGCCAGGGGCTGG + Intronic
1061583777 9:131553974-131553996 GAGCCCTGGCTTCAAGCTGCTGG + Intergenic
1186413735 X:9365398-9365420 GAACGATGGTTGCCAGGGGCTGG - Intergenic
1186600431 X:11030766-11030788 TAACGCTGGTTGCCAGCTGGGGG + Intergenic
1192617081 X:72637229-72637251 GAACAGTGGTTGCCAGAGGCTGG - Intronic
1193873962 X:86837222-86837244 GAACGGTGGTTACCAGATGCTGG + Intergenic
1195995933 X:110731783-110731805 GAACACTGGATGCCAGGAGCTGG + Intronic
1196993709 X:121357236-121357258 GAATGCTGGTTGCCAGAGGCTGG - Intergenic
1198646676 X:138815163-138815185 GAATGCTGGTTGCCAGGGGCTGG + Intronic
1198744215 X:139873250-139873272 GAACAGTGGTTGCCAGGGGCTGG + Intronic
1199084612 X:143614515-143614537 GAATCCTGGTTACCAGGAGCAGG + Intergenic
1199334537 X:146602765-146602787 GAATCCTGGTTGCCAGGGTCTGG - Intergenic
1199828970 X:151529957-151529979 GATTCATGGTTGCCAGGTGCTGG - Intergenic
1201476861 Y:14391693-14391715 GGACCCTCTGTGCCAGCTGCAGG + Intergenic