ID: 1168288357

View in Genome Browser
Species Human (GRCh38)
Location 19:55345494-55345516
Sequence GAGGATGAGGATGCGGGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1864
Summary {0: 1, 1: 0, 2: 12, 3: 198, 4: 1653}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168288350_1168288357 2 Left 1168288350 19:55345469-55345491 CCAGTAGGGGTCTCGGGGAGGCG 0: 1
1: 0
2: 0
3: 4
4: 73
Right 1168288357 19:55345494-55345516 GAGGATGAGGATGCGGGAGGTGG 0: 1
1: 0
2: 12
3: 198
4: 1653
1168288342_1168288357 29 Left 1168288342 19:55345442-55345464 CCACAAAGAGGTGATGAGGGGCT 0: 1
1: 0
2: 2
3: 21
4: 183
Right 1168288357 19:55345494-55345516 GAGGATGAGGATGCGGGAGGTGG 0: 1
1: 0
2: 12
3: 198
4: 1653

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168288357 Original CRISPR GAGGATGAGGATGCGGGAGG TGG Intronic
900149094 1:1170531-1170553 GAGGAGGAGGAGGGAGGAGGGGG - Intergenic
900204461 1:1426152-1426174 GAGGAGGAGGAGGGGGGAGGTGG + Exonic
900333986 1:2151916-2151938 GAGGTGGAGGCTGCAGGAGGAGG - Intronic
900409137 1:2504975-2504997 GCGGCTGTGGCTGCGGGAGGAGG - Exonic
900417381 1:2541221-2541243 GAGGCTGGGGAGGCGGGAGCAGG + Intergenic
900488707 1:2935727-2935749 GGGGATGAGGACTGGGGAGGAGG - Intergenic
900522308 1:3111566-3111588 GAGGAAGGGGAAGAGGGAGGAGG + Intronic
900725554 1:4214195-4214217 GAGGAGGAGGAAGGAGGAGGAGG - Intergenic
900725555 1:4214198-4214220 GAGGAGGAGGAGGAAGGAGGAGG - Intergenic
900725556 1:4214201-4214223 GAGGAGGAGGAGGAGGAAGGAGG - Intergenic
900785554 1:4647517-4647539 GATGATGATGATGGGGGTGGTGG + Intergenic
900929724 1:5729009-5729031 GGGGATGGGGAGGCGGGGGGAGG - Intergenic
901168852 1:7239871-7239893 GAGAATGAGAATGAGAGAGGAGG + Intronic
901194066 1:7430412-7430434 GAGGATGATGATGATGGTGGAGG + Intronic
901214844 1:7549420-7549442 GGGAATAAGGATGAGGGAGGTGG - Intronic
901300782 1:8198726-8198748 GAGGATGAATATGAAGGAGGAGG - Intergenic
901420318 1:9146329-9146351 GAGGAGGAGGAAGGGGGCGGGGG - Intergenic
901652406 1:10750610-10750632 GAGGCTGAGGCTGGGCGAGGTGG + Intronic
901755982 1:11441863-11441885 GAGGAGGAAGATGAGGGAGGAGG + Intergenic
901755987 1:11441882-11441904 GAGGAGGAAAATGAGGGAGGAGG + Intergenic
901835620 1:11922375-11922397 GAGATTTATGATGCGGGAGGAGG + Intronic
901881358 1:12195691-12195713 GAGGAGGAGGACAAGGGAGGGGG + Intronic
902188219 1:14741312-14741334 GGGCATGAGGATGCTAGAGGAGG + Intronic
902204736 1:14859859-14859881 AAGGATAAGGATGCGGCAGTGGG + Intronic
902213857 1:14922879-14922901 GAAGGTGAGGATGCGGGGGCGGG + Intronic
902343601 1:15800149-15800171 GAGGAGGAGGATGAAGGTGGGGG + Intergenic
902517277 1:16996266-16996288 GAGGATGAAGATGCTGTAGATGG + Exonic
902676803 1:18014477-18014499 GGGGATGAGGTTGCAGGGGGTGG - Intergenic
902804170 1:18850554-18850576 GAGGATGAGGATCAGGATGGCGG + Intronic
902829327 1:19000065-19000087 GAGGAGGAGGAAAGGGGAGGGGG + Intergenic
903225848 1:21893963-21893985 CAGGATGAGGCAGAGGGAGGAGG + Intronic
903234551 1:21941332-21941354 GAGGAAGAGGAGGCAGGAGGTGG + Intergenic
903501889 1:23805030-23805052 GAGAATGAGGATGGGGAAGGGGG - Intronic
903705136 1:25280041-25280063 GAGGATGAGGGGGCAGGGGGAGG + Intronic
903722089 1:25413280-25413302 GAGGATGAGGGGGCAGGGGGAGG - Intronic
903752917 1:25640301-25640323 AAGAATGAGGATGGGGGAGAGGG - Intronic
903967534 1:27099980-27100002 GAGGAGGAGGATGAGGCAGAGGG + Exonic
904087068 1:27916731-27916753 GAGGAGGAGGAGGAGAGAGGTGG - Intergenic
904087081 1:27916777-27916799 GAGGAGGAGGAGGGTGGAGGAGG - Intergenic
904087087 1:27916793-27916815 GAGGAGGAGGAGGAGAGAGGAGG - Intergenic
904087093 1:27916819-27916841 GAGGAGGAGGAGGGTGGAGGAGG - Intergenic
904463220 1:30692693-30692715 GAGGATGTGGAAGGGAGAGGAGG + Intergenic
904930129 1:34081416-34081438 GAAGAAGAGGGAGCGGGAGGGGG - Intronic
905037976 1:34929750-34929772 GAGGGAGAGGAAGAGGGAGGGGG + Intergenic
905319060 1:37102884-37102906 GAGGAAGAGGAGGGAGGAGGAGG + Intergenic
905575805 1:39043748-39043770 AAGGAGGAGGAGGCGGCAGGAGG + Intergenic
905665760 1:39762061-39762083 GATGATGAGGACGCGTGGGGCGG - Intronic
905863797 1:41366214-41366236 GCTGATGGGGGTGCGGGAGGAGG + Intronic
906069959 1:43008916-43008938 GAGGATGGGAATGTGGGAGGAGG + Intergenic
906146608 1:43564291-43564313 GAGGATGGAGCTGCTGGAGGTGG + Intronic
907368538 1:53982195-53982217 GAGGAGGAGGAGGTGGGTGGAGG - Intergenic
907417924 1:54327177-54327199 GAGCATTAGGAAGCGGGAGAAGG - Intronic
907454035 1:54563820-54563842 GAGGCTGAGGGAGCGGGGGGCGG + Intronic
907753659 1:57288301-57288323 GATGAAGAGGATGGGGGATGGGG + Intronic
907814853 1:57908467-57908489 GCCCATCAGGATGCGGGAGGAGG - Intronic
907880635 1:58546542-58546564 GGGGATGGGGGTACGGGAGGAGG - Intronic
907909249 1:58812866-58812888 GAGGAGGATGATGGAGGAGGAGG - Intergenic
908082652 1:60597888-60597910 GGGGTTGAAGATGAGGGAGGTGG - Intergenic
908107067 1:60855981-60856003 GAGGAAGAGGATTTGGGAGACGG - Intergenic
908438484 1:64130467-64130489 GAGGGTGAGGATCCAGGAAGGGG - Intronic
908444576 1:64188916-64188938 GACAATTAAGATGCGGGAGGAGG + Intergenic
908516440 1:64897451-64897473 GAGCAGGAGGACGAGGGAGGAGG + Intronic
908516467 1:64897492-64897514 GGGGAGGAGGAGGGGGGAGGGGG + Intronic
908826088 1:68134064-68134086 GAGCATGGGAATGCTGGAGGTGG + Intronic
908960783 1:69694739-69694761 GAGGAAGAGGAAGTGGGGGGGGG - Intronic
909494144 1:76259517-76259539 GAGAATGATGATGATGGAGGTGG - Intronic
909723584 1:78807063-78807085 AAGGGTGAGGAGGCAGGAGGGGG + Intergenic
910332968 1:86097441-86097463 GAGGAAGAGGAGGGGGGAGGAGG - Intronic
910332979 1:86097467-86097489 GAGGAGGAGGAGGGAGGAGGAGG - Intronic
911015393 1:93326453-93326475 GAGAATGAGGATGAGGGAGGAGG + Intergenic
911031736 1:93496234-93496256 GAGGAGAAGGAAGGGGGAGGTGG - Intronic
911064657 1:93777473-93777495 GAGGAAGAGGAAGGAGGAGGAGG - Intronic
911995193 1:104758033-104758055 GAAGAGGGGGATGGGGGAGGTGG + Intergenic
912164866 1:107031060-107031082 AAGAATGAGGATGAGGGAGGAGG - Intergenic
912168545 1:107069446-107069468 GAGGATGAGGAGGGGGGAGGAGG + Intergenic
912331311 1:108822516-108822538 GAGGATGTGGCAGCTGGAGGTGG + Intronic
912512940 1:110200884-110200906 GAGGAGGAGGAGGCAGGGGGAGG - Exonic
912512941 1:110200887-110200909 GAGGAGGAGGAGGAGGCAGGGGG - Exonic
912514935 1:110211387-110211409 GACGAAGAGGAGGCAGGAGGCGG - Intronic
912993434 1:114510925-114510947 GAGGAGGAGGAGGAGGAAGGCGG - Exonic
913071552 1:115303539-115303561 GATGATGATGATGACGGAGGAGG - Intronic
913083591 1:115413113-115413135 GAGGAGGAGGAGGAGGGAGGAGG + Intergenic
913083592 1:115413116-115413138 GAGGAGGAGGAGGGAGGAGGAGG + Intergenic
913137926 1:115910822-115910844 GGGGATGAGGCTGGGGGAAGTGG - Intergenic
913153125 1:116065588-116065610 GATGAGGAGGAAGAGGGAGGAGG - Intronic
913179209 1:116303379-116303401 GTGGATGAAGATGCCGGTGGAGG - Intergenic
913254936 1:116944725-116944747 GAGCCTGAGCCTGCGGGAGGGGG + Exonic
914196787 1:145451883-145451905 GAGGAGGAGGGAGGGGGAGGGGG + Intergenic
914450708 1:147788926-147788948 GAAGATGGGGTTGAGGGAGGAGG + Intergenic
914993102 1:152515474-152515496 GAGGAGGAGGAGGCGGGCGCCGG - Exonic
915035309 1:152918732-152918754 AAGGAGGAGGAGGAGGGAGGAGG + Intergenic
915035310 1:152918735-152918757 GAGGAGGAGGAGGGAGGAGGAGG + Intergenic
915035319 1:152918758-152918780 GAGGAGGAGGAGGAGGGAGGAGG + Intergenic
915107222 1:153542089-153542111 GAGGTTGTGGATTGGGGAGGGGG + Intergenic
915345025 1:155193021-155193043 GAGGAGGAGGAAGAGGTAGGAGG - Intergenic
915599392 1:156913063-156913085 GAAGATGAGGAGTGGGGAGGAGG + Intronic
915648181 1:157288698-157288720 CAGGATGGGGGTGAGGGAGGAGG + Intergenic
915662484 1:157415808-157415830 CAGGATGGGGGTGAGGGAGGAGG - Intergenic
916226724 1:162496327-162496349 GAGGAGGAGGTTGCGGTGGGCGG + Intergenic
916289136 1:163144635-163144657 GAGGAGGAGGAGGAGGGAGCTGG + Intronic
916332047 1:163628290-163628312 GGGGAGGAGGAGGGGGGAGGGGG - Intergenic
916332070 1:163628329-163628351 GAGGAGGAGGGAGGGGGAGGAGG - Intergenic
916332072 1:163628335-163628357 GGGGAGGAGGAGGAGGGAGGGGG - Intergenic
916507679 1:165442905-165442927 GAGGAAGAGGAGGCAGGAAGAGG - Intronic
916636319 1:166673247-166673269 GAGGAAGAGAATCAGGGAGGGGG + Intergenic
916677048 1:167072880-167072902 GAGGATGAGGGTGTGGGAAGAGG + Intronic
916787264 1:168095693-168095715 GAGGAGGAGGATGGTTGAGGAGG + Intronic
916890484 1:169107875-169107897 GATGATGATGATGTTGGAGGAGG - Intronic
917141907 1:171842640-171842662 GAAGATGATGCTGGGGGAGGGGG - Intronic
917409341 1:174742067-174742089 GAGGAGGGGGAGGGGGGAGGAGG + Intronic
917482349 1:175423281-175423303 GAGGCTGAGGAAGATGGAGGAGG - Intronic
917524217 1:175773041-175773063 GAGGAGGAGGAGGAGGGAGAAGG + Intergenic
917667739 1:177241513-177241535 GTGGAAGAGAATGCGAGAGGAGG - Intronic
917719689 1:177775664-177775686 GAGGGTGAGGGTGCAGGAAGGGG - Intergenic
917841828 1:178986414-178986436 GAGGGTGAGGAGGCGGGTGAGGG + Intergenic
917858826 1:179124990-179125012 GGGGATGAGGATGTGGGGAGTGG - Intronic
918069506 1:181124573-181124595 GAGGAAGAGGAAGGAGGAGGAGG - Intergenic
918444358 1:184602115-184602137 GAGGGTGAGGATGGTGGTGGTGG - Intronic
918535174 1:185565914-185565936 GAGGAGGGGGGTGAGGGAGGTGG - Intergenic
919449336 1:197751873-197751895 GAGGAGGAGGAGGAGGGAGGAGG + Intronic
919449337 1:197751876-197751898 GAGGAGGAGGAGGGAGGAGGAGG + Intronic
919470936 1:197978452-197978474 GAGGCTGGGGATGGGGGAGAGGG - Intergenic
919748617 1:201023450-201023472 GCGGCTGCGGCTGCGGGAGGCGG + Exonic
919763353 1:201111938-201111960 GAGGAGGAGGGTGGGGGAGGAGG - Intronic
919763355 1:201111944-201111966 GAGGAAGAGGAGGAGGGTGGGGG - Intronic
919763364 1:201111966-201111988 GACGAGGAGGGTGGGGGAGGAGG - Intronic
919906933 1:202084918-202084940 GAGGAGGAGGAATCGCGAGGTGG + Intergenic
919949301 1:202347907-202347929 GAGGAGGAGGAGGAGGGAGAAGG + Intergenic
920033974 1:203053834-203053856 GTGGATGAGGATGAGCCAGGGGG + Exonic
920040181 1:203090388-203090410 GAGGATGAGGTCGGGGGTGGGGG + Intergenic
920159838 1:203988106-203988128 CAGGGTGAGGACGTGGGAGGAGG + Intergenic
920228662 1:204455867-204455889 GATGATGGGGATGCGGTGGGTGG + Exonic
920278964 1:204829047-204829069 AGGGTTGAGGATGCGGGAAGGGG - Intronic
920371300 1:205481073-205481095 GAAGATGGGGCTGGGGGAGGGGG - Intergenic
920387781 1:205580542-205580564 GAGGGTGGGGCTGGGGGAGGGGG + Intronic
920448596 1:206039473-206039495 GAGGAAGAGGATGGAGAAGGGGG + Intronic
920511691 1:206556844-206556866 GAGGAAGTGGATGGGGGAGAAGG + Intronic
921397083 1:214679856-214679878 GAGGAGGAGAAGGGGGGAGGAGG - Intergenic
922199906 1:223393229-223393251 GAGGCTGGGGATGGGGGTGGTGG - Intergenic
922307477 1:224356915-224356937 GAGGAGGAGGATGGAGGCGGTGG + Exonic
922315208 1:224435184-224435206 GAAGGTGAGGATGGGGCAGGGGG + Intronic
922574888 1:226654943-226654965 GAGGAGGAAGAGGAGGGAGGAGG + Intronic
922719638 1:227893652-227893674 GAGGAGGAGAATGCAGGAGCTGG + Intergenic
923051985 1:230395760-230395782 GAGTGTGAGGAGGGGGGAGGAGG - Intronic
923052153 1:230396409-230396431 GATGGTGGGGATGGGGGAGGAGG - Intronic
923063560 1:230498301-230498323 GAGGATGATGATGGTGGTGGTGG - Intergenic
923299717 1:232630078-232630100 GAGGAGGAGGAGGACGGAGGAGG - Intergenic
923432460 1:233936525-233936547 GAGGAGGAGGAAGAAGGAGGAGG - Intronic
923432468 1:233936568-233936590 GAGGAGGAGGAAGAGGAAGGAGG - Intronic
923534429 1:234838174-234838196 GAGGAGGAGGAGGAGGGGGGCGG + Intergenic
923920887 1:238563784-238563806 GAGCATGAGGAAGCTGGGGGAGG + Intergenic
924467424 1:244311199-244311221 GAGGAGGAGGAAGAGGGAAGAGG - Intergenic
924481174 1:244435650-244435672 GAGGAAGAGGAGGATGGAGGAGG - Intronic
924556429 1:245122894-245122916 GAGGATGACGGTGGGGGAAGGGG - Intronic
924864870 1:247967889-247967911 GAGGAAGAGGACGAGGAAGGAGG - Intronic
924941052 1:248812653-248812675 GAGGATGAGGAAGCAGGAGCTGG - Intronic
1062824572 10:558302-558324 CAGGGTCAGGAAGCGGGAGGTGG - Intronic
1062903650 10:1165242-1165264 GAGGATGAGGACAGGGGATGAGG - Intergenic
1063159445 10:3408713-3408735 GAGGAGGAGGAGGAGGGAGGAGG + Intergenic
1063159457 10:3408765-3408787 GAGGAGGAGGAGGGAGGAGGAGG + Intergenic
1063159483 10:3408855-3408877 GAGGAGGAGGAGGAGGGAGGAGG + Intergenic
1063173369 10:3529754-3529776 GAGGAAGAGGAGGAGGGAGGAGG - Intergenic
1063401623 10:5751991-5752013 TGGGAGGAGGATGGGGGAGGGGG - Intronic
1063460127 10:6210089-6210111 GAGGGTGATGAGGCGGGTGGGGG + Intronic
1063964852 10:11338923-11338945 CAGGGTGAGGATGGGGGTGGGGG - Intergenic
1064086463 10:12349477-12349499 GAGGGGGAGGAGGCGCGAGGTGG + Exonic
1064541977 10:16414561-16414583 GAGGGTGAGGAGGTGGGTGGGGG + Intergenic
1064635269 10:17358777-17358799 GATGATGAGGAAGAAGGAGGAGG + Intronic
1064707295 10:18086283-18086305 GAGGAAGTAGATGGGGGAGGTGG - Intergenic
1065223754 10:23522194-23522216 GGGGAGGACGATGAGGGAGGGGG + Intergenic
1065623816 10:27610619-27610641 GAGGAAGAGGAAGAAGGAGGAGG - Intergenic
1065623827 10:27610672-27610694 GAGGAGGAGGAAGGAGGAGGAGG - Intergenic
1065623828 10:27610675-27610697 GAGGAGGAGGAGGAAGGAGGAGG - Intergenic
1065883508 10:30058333-30058355 GGGAATGAGGACACGGGAGGCGG + Intronic
1066226882 10:33392496-33392518 GAGAATGAGGATGAGGAAGAGGG - Intergenic
1066513008 10:36122728-36122750 GAGGAGGAGGAGGAGAGAGGAGG - Intergenic
1067150390 10:43728104-43728126 GAGGGTGGGGATGCGGGGCGCGG + Intergenic
1067782508 10:49219088-49219110 GAGACTGAGGATGCAAGAGGTGG - Intergenic
1068478405 10:57558086-57558108 GAGGAAGAAGAAGCAGGAGGAGG + Intergenic
1068794273 10:61061045-61061067 AAGGGTGAGGAGGTGGGAGGGGG - Intergenic
1068908231 10:62351126-62351148 GAGGATGAGGATGTGAGATTTGG - Intergenic
1069312275 10:67052655-67052677 GAGGATGAGGAGAAAGGAGGAGG + Intronic
1069610265 10:69768136-69768158 GAGGCTGAGGACGTGAGAGGCGG - Intergenic
1069615102 10:69801845-69801867 GAGGAGGAGGAGGAGGGAGGGGG + Intergenic
1069694464 10:70376656-70376678 GGGGAGAAGGATGCTGGAGGGGG - Intronic
1070494464 10:77009110-77009132 GAAGCTGAGGTTGGGGGAGGAGG + Intronic
1070555008 10:77520735-77520757 GGGAATGAGGATGAGGGAGCAGG - Intronic
1070953064 10:80446262-80446284 GAAGATGAGGCTGCGGCTGGAGG - Intergenic
1071203813 10:83251733-83251755 GAAGAGGAGGAGGAGGGAGGAGG + Intergenic
1071495858 10:86167276-86167298 GAGGATGAGCATCAGGGAGAAGG + Intronic
1072000940 10:91195070-91195092 GAGAGTGAGGATGGGGAAGGTGG + Intronic
1072083268 10:92054508-92054530 GAGGTGGAGGTTGTGGGAGGTGG - Intronic
1072562223 10:96586874-96586896 GAGGAGGCGGCGGCGGGAGGAGG - Exonic
1072934863 10:99702386-99702408 GAGGAAGGTGAAGCGGGAGGAGG + Intronic
1073291379 10:102414911-102414933 GAGGACGACGATGAGGCAGGTGG - Exonic
1073387986 10:103143537-103143559 GAGGCTGAGGCTGAGGTAGGAGG - Intronic
1073597720 10:104817404-104817426 GAGGAGGGGGAAGGGGGAGGAGG - Intronic
1073597722 10:104817410-104817432 GAGGAGGAGGAGGGGGAAGGGGG - Intronic
1073671177 10:105591807-105591829 GAGGGTGAGGAGGAAGGAGGAGG + Intergenic
1074100797 10:110353719-110353741 GGGGGTGAGGTTGGGGGAGGGGG - Intergenic
1074348943 10:112716122-112716144 GAGGATGAGGATCCGAGGTGAGG + Intronic
1074360912 10:112823599-112823621 GGGGAGGATGGTGCGGGAGGAGG - Intergenic
1074527923 10:114277850-114277872 GAAGATGAGGGGGCAGGAGGAGG + Intronic
1074533934 10:114315293-114315315 TGGGATGGGGATGGGGGAGGCGG + Intronic
1075077321 10:119359974-119359996 GAGGCTGAGGAGGCGGAGGGAGG + Intronic
1075077469 10:119360747-119360769 GTGGAAGAGGAGGAGGGAGGAGG - Intronic
1075111097 10:119585197-119585219 GAGGATGAGGCAGAGGCAGGAGG + Intronic
1075549366 10:123380713-123380735 GAGGATGATGATGATGGTGGTGG - Intergenic
1075575204 10:123572768-123572790 GAGGAGGAGGAGAGGGGAGGAGG + Intergenic
1075575210 10:123572784-123572806 GAGGAGGAGGAGAGGGGAGGAGG + Intergenic
1075759580 10:124845904-124845926 GAGAATGAGGATGAGGATGGCGG - Intergenic
1075930661 10:126292567-126292589 GAGGAAGAGGAGGCAGGTGGAGG - Intronic
1076252716 10:128996591-128996613 GAGGATGGGGATGGGGCATGCGG - Intergenic
1076474470 10:130742831-130742853 GAGGCTGGGGATGCAGGATGGGG - Intergenic
1076501485 10:130939753-130939775 GAGGGTGAGGCTGGAGGAGGAGG + Intergenic
1076609326 10:131711331-131711353 GAGGAGGAGGCTCAGGGAGGAGG - Intergenic
1076736442 10:132461254-132461276 GAGGAGGAGGATGAAGGAGGAGG - Intergenic
1077207920 11:1353004-1353026 GGGGATGAGGGTGAGGGTGGGGG - Intergenic
1077334614 11:1997827-1997849 GAGGAGCAGGGTGAGGGAGGGGG - Intergenic
1077372780 11:2191281-2191303 GAGGATGAGGGAGGGGAAGGAGG + Intergenic
1077392603 11:2307028-2307050 GAGGAAGAGGAGGAAGGAGGAGG + Intronic
1077460804 11:2708464-2708486 GGGGCTGAGGAGGCTGGAGGTGG + Intronic
1077483840 11:2829960-2829982 GAGGATGAGAAGGAAGGAGGAGG + Intronic
1077491714 11:2863863-2863885 GAGGAGGAGGAGGAGGGAGGAGG + Intergenic
1077761750 11:5107722-5107744 GAGGAGGGGGAGGGGGGAGGAGG + Intergenic
1077998914 11:7477073-7477095 GAGGAGGAGGAAGGAGGAGGAGG + Intergenic
1078151337 11:8761998-8762020 AAGAGTGAGGATGAGGGAGGAGG - Intronic
1078168225 11:8909413-8909435 GAGGAAGAGGAAGGAGGAGGAGG + Intronic
1078406772 11:11077032-11077054 CAGGATGAGGCTGGGGGCGGTGG - Intergenic
1078473957 11:11614381-11614403 GAGGAGGAGGAGGAGGGAGGAGG + Intronic
1078703686 11:13717148-13717170 GGGGATGGGGAGGCGCGAGGGGG - Intronic
1078735004 11:14011763-14011785 GTGGATGAGGATGGAAGAGGAGG + Intronic
1078757489 11:14224690-14224712 GAGGATGAAGATGAGGATGGTGG + Intronic
1079077499 11:17393217-17393239 GAGGAGGAGGATGAGGCATGTGG + Intronic
1079101774 11:17546502-17546524 GAGGATGATGATGATGGTGGTGG - Intergenic
1079249162 11:18774513-18774535 GAGGAGGAGGGGGCTGGAGGGGG + Intronic
1079410282 11:20181104-20181126 GAAGAAGAGGAAGAGGGAGGAGG - Intergenic
1079445575 11:20553713-20553735 GAGGAGGAGGAAGGAGGAGGAGG - Intergenic
1079445576 11:20553716-20553738 GAGGAGGAGGAGGAAGGAGGAGG - Intergenic
1079721015 11:23814576-23814598 GAAGAGGAGGATGGTGGAGGAGG - Intergenic
1079810948 11:24999359-24999381 GAGGAAGAGGAGGAAGGAGGAGG + Intronic
1080540016 11:33257010-33257032 AAGGATGAAGATGCGGAAGCAGG - Intronic
1081197603 11:40180405-40180427 GAGGAAGAGGATAGGGTAGGAGG - Intronic
1081688096 11:45056605-45056627 GAGGATGGGGAGCCAGGAGGAGG - Intergenic
1081732252 11:45379877-45379899 GAGGATAAGGATGCAGGCTGGGG - Intergenic
1081773928 11:45665299-45665321 GAGGAGGAGGGCGCGGGAGGCGG - Exonic
1081831797 11:46121133-46121155 GAGGAGGAGGAGGAGGGAGAAGG - Intronic
1082097559 11:48143791-48143813 GAGGAGGAGGAGAGGGGAGGGGG - Intronic
1082097573 11:48143824-48143846 GAGGAGGAGGAGAGGGGAGGGGG - Intronic
1082669797 11:56020884-56020906 GAGCAGGAGGAGGAGGGAGGAGG + Intergenic
1082708721 11:56526858-56526880 GAGGATTATGATGAGGGAGCTGG + Intergenic
1082762089 11:57136894-57136916 GAGGAGGAGGAAGAGGAAGGAGG + Intergenic
1082762091 11:57136900-57136922 GAGGAAGAGGAAGGAGGAGGAGG + Intergenic
1083175313 11:60946278-60946300 GAGGATGGGGCTGGGGGCGGTGG - Intronic
1083318140 11:61828744-61828766 GAGGAGGAGGATTGGGGAGGGGG - Intronic
1083448549 11:62727174-62727196 GGGGAGGAGGCGGCGGGAGGCGG - Exonic
1083540167 11:63506805-63506827 GAGGATGAGGGTGTGGGGGTAGG + Intronic
1083601936 11:63954218-63954240 TAGGATGAGGGTGCAGGAGGTGG - Intronic
1083732858 11:64662306-64662328 GAGGAGGAGGAGGAGGAAGGAGG + Intronic
1083732859 11:64662309-64662331 GAGGAGGAGGAGGAAGGAGGAGG + Intronic
1083732860 11:64662312-64662334 GAGGAGGAGGAAGGAGGAGGAGG + Intronic
1083767050 11:64846543-64846565 CAGGATCAGGTTGAGGGAGGAGG + Intergenic
1083799563 11:65038673-65038695 GAGGAAGAGGATGGGGAAGGAGG + Exonic
1083823897 11:65187562-65187584 GAGGATGAGGGTATGGGAGGCGG + Intronic
1083831802 11:65238270-65238292 GAGGATGAGGGTATGGGAGGCGG + Intergenic
1083913050 11:65721027-65721049 GAGGAGGGGGAGGGGGGAGGGGG - Intergenic
1084014089 11:66368595-66368617 GAGGAAGAGGGTGCTGTAGGTGG + Exonic
1084030579 11:66478353-66478375 GAGGGTGGGGATGCTGCAGGAGG + Intergenic
1084145211 11:67261606-67261628 GAGGATGAGGATGAGGGCGAGGG + Intergenic
1084145215 11:67261612-67261634 GAGGATGAGGGCGAGGGCGGGGG + Intergenic
1084171627 11:67403916-67403938 GAGGAGGAGGAAGTGAGAGGAGG + Intronic
1084471760 11:69365746-69365768 GAGGGTGAGGAGTGGGGAGGAGG + Intronic
1084552156 11:69851074-69851096 GAGGATGAGGACAGCGGAGGAGG + Intergenic
1084571665 11:69963420-69963442 GAGGAGGAGGAGGGGGAAGGGGG + Intergenic
1084760680 11:71268741-71268763 GAGGAGGAGGAGAAGGGAGGAGG + Intergenic
1084908639 11:72369413-72369435 TAGGATGGGGGTGGGGGAGGAGG - Intronic
1084920321 11:72464427-72464449 GAGGGGGAGGAGGGGGGAGGAGG - Intergenic
1084941329 11:72614954-72614976 GAGGAAGAGAAAGAGGGAGGAGG - Intronic
1085076733 11:73598148-73598170 GAGGAGGAGGCGGAGGGAGGAGG + Exonic
1085310037 11:75510750-75510772 GAGGAGGAGGAGGGGGGAGGGGG - Intronic
1085502671 11:77038002-77038024 GAGGAGGGGGATATGGGAGGAGG + Intronic
1085561234 11:77474142-77474164 GGGGAGGAGGAGGCGGGAGGAGG - Intronic
1085803451 11:79612801-79612823 GAGGATGGAGGTGCGGGAGGAGG - Intergenic
1085893466 11:80608855-80608877 GAAGGTGAGGATGAGGGATGAGG + Intergenic
1086598179 11:88600229-88600251 GAGGAGGAGGAAGGAGGAGGAGG - Intronic
1086598180 11:88600232-88600254 GAGGAGGAGGAGGAAGGAGGAGG - Intronic
1086625155 11:88941531-88941553 GAGGAGGAGGAGGAGAGAGGAGG + Intronic
1086998904 11:93392939-93392961 GAGGAAGAGGAGGGAGGAGGAGG - Intronic
1086998905 11:93392942-93392964 GAGGAGGAAGAGGAGGGAGGAGG - Intronic
1087076985 11:94134656-94134678 GAGAAGGAGGAAGAGGGAGGGGG - Intronic
1087833515 11:102846239-102846261 GAAGATGAGGAGAGGGGAGGAGG + Intergenic
1088087396 11:105997271-105997293 GAGGAAGAGGAAGAGGAAGGAGG + Intronic
1088371463 11:109092976-109092998 GAGCATGAGTATGAGGGAGGTGG + Intergenic
1088429951 11:109747937-109747959 GAGGAAGAGTTTGTGGGAGGAGG + Intergenic
1089095423 11:115916261-115916283 GAGGAGGAGGAGGAGCGAGGGGG - Intergenic
1089149037 11:116350701-116350723 AATGTTGAGGATGTGGGAGGAGG - Intergenic
1089257867 11:117203490-117203512 GAGGAAGAGGCTGGGGGAGGAGG + Intronic
1089286291 11:117409993-117410015 GAGGAGGAGGAGGAGGCAGGTGG - Intronic
1089365630 11:117919253-117919275 AAGGATGCGGATGTAGGAGGTGG - Intronic
1089398673 11:118152283-118152305 GAGGTTCAGGATGCTGGAGGAGG - Intronic
1089610280 11:119664961-119664983 GAGGAGGAGGAGGAGGGCGGTGG - Exonic
1089746914 11:120623977-120623999 GAGGAAGAGGGAGAGGGAGGAGG - Intronic
1090007732 11:123017645-123017667 GAGAAGGAGGAGGCTGGAGGTGG + Intergenic
1090032336 11:123217824-123217846 GAGGGTGAGGGTGGGGGGGGGGG - Intergenic
1090613965 11:128497771-128497793 GAGGTGGAGGATGGTGGAGGAGG - Intronic
1090620183 11:128553689-128553711 GAGGAGGAGGAGGAGGGTGGCGG - Intronic
1090794389 11:130122360-130122382 GATGATGAGGATGAGGAAGAAGG + Exonic
1090826224 11:130388458-130388480 AAGAATGAGGATGCGGAATGAGG + Intergenic
1090908408 11:131097054-131097076 GAGCAGGAGGCTGAGGGAGGAGG - Intergenic
1091006076 11:131955157-131955179 GAGGCTGAGGCTGAGGGTGGAGG - Intronic
1091356084 11:134938636-134938658 GGGGATGAGGATGGGTCAGGAGG + Intergenic
1202817597 11_KI270721v1_random:53009-53031 GAGGAGCAGGGTGAGGGAGGGGG - Intergenic
1091558677 12:1594443-1594465 GAGGCGGAGGATGCGGCAGGGGG - Intronic
1091568072 12:1662431-1662453 GAGGAGGGGGAGGCGGGAAGTGG - Intergenic
1091568151 12:1662615-1662637 GAGGAGGGGGAGGCGGGAAGTGG - Intergenic
1091568185 12:1662699-1662721 GAGGAGGGGGAGGCGGGAAGTGG - Intergenic
1091583794 12:1804727-1804749 GAGGATGGGGAAGAGGCAGGAGG - Intronic
1091603093 12:1929809-1929831 GAGGAGGAGGAAGGGGAAGGAGG + Intergenic
1091603103 12:1929843-1929865 GAGGAGAAGGAAGGGGGAGGAGG + Intergenic
1091618935 12:2071122-2071144 GAGGAGGGGGAAGCGGGAAGGGG - Intronic
1091673037 12:2466814-2466836 GGGGATGAGCATGTGGGAGAGGG - Intronic
1091985496 12:4907962-4907984 GAGGAAGAGGAAGAAGGAGGAGG + Intergenic
1092030942 12:5284636-5284658 GAGGGTGGGGATGAGGAAGGGGG - Intergenic
1092139260 12:6171616-6171638 GAGGAGGAGGAGGAGGAAGGCGG + Intergenic
1092194404 12:6540651-6540673 GAGGGTGAGGCAGCAGGAGGAGG - Intronic
1092509936 12:9144208-9144230 GAAAGTGAGGATGAGGGAGGAGG + Intergenic
1093276167 12:17130571-17130593 GAAGATGAGGATGCAGCAGATGG + Intergenic
1093467070 12:19460423-19460445 GAGGAGGAGGTTGCAGTAGGAGG - Intronic
1093523347 12:20076116-20076138 GAGGGTGAGGAAGAGGGAGAGGG - Intergenic
1093530402 12:20155030-20155052 GAAGAAGAGGAGGAGGGAGGGGG + Intergenic
1093622760 12:21312004-21312026 GAAGAAGAGGAGGAGGGAGGAGG + Intronic
1093669272 12:21853241-21853263 GAGGAAGAGGTTCCTGGAGGAGG + Intronic
1093755304 12:22845721-22845743 GAGGAAGAGGAAGAGGGAGAAGG - Intergenic
1093980465 12:25469863-25469885 AAGGATGGGGATGGGGAAGGAGG + Intronic
1094234389 12:28146890-28146912 GAGGAAGAGGAGGGGGGAGAAGG - Intronic
1094491660 12:30964420-30964442 GAGGAGGAGGAAGAGGGAGAGGG - Intronic
1094623160 12:32099470-32099492 GAGGATGGGGATGGGATAGGAGG + Intergenic
1095085189 12:38052645-38052667 GAGGAAGAGGAAGAGGAAGGGGG + Intergenic
1095476469 12:42590917-42590939 GAAGATGAGGATGTGTGTGGGGG + Intergenic
1095516088 12:43007113-43007135 GAGAGTGAAGATGAGGGAGGGGG - Intergenic
1095748098 12:45682166-45682188 GTGGATGAGGAGGTGGAAGGGGG - Intergenic
1096065316 12:48735027-48735049 GAGGAGGAGGAGGAGGAAGGAGG + Intergenic
1096065319 12:48735030-48735052 GAGGAGGAGGAGGAAGGAGGGGG + Intergenic
1096066483 12:48744743-48744765 GAAGAAGAAGATGGGGGAGGAGG + Intergenic
1096066955 12:48748691-48748713 GAGAATGAGGATGGGGGAGGAGG - Intergenic
1096463598 12:51836358-51836380 GAGGATGAGGATGGTGGGCGGGG - Intergenic
1096530471 12:52239524-52239546 CAGGCTAAGGATTCGGGAGGAGG + Intronic
1096539586 12:52297902-52297924 GAGGTTGAGGATGGGGGATATGG - Intronic
1096595006 12:52689464-52689486 GAAGAGGAGGAGGAGGGAGGAGG + Intergenic
1096595007 12:52689467-52689489 GAGGAGGAGGAGGGAGGAGGAGG + Intergenic
1096710502 12:53452218-53452240 GAGGAGGAGGAGGAGGAAGGGGG - Exonic
1096735661 12:53651833-53651855 GAGGCTGAGGCTGAGGCAGGAGG - Intronic
1096758751 12:53822229-53822251 GAGGAAGAAGAAGAGGGAGGAGG - Intergenic
1096814923 12:54196010-54196032 GGGGAGGAGGACGCGGGCGGGGG - Intergenic
1097131817 12:56816911-56816933 GAGGATGAGGGTGGGGGTGGGGG - Intergenic
1097131821 12:56816917-56816939 GAAGCTGAGGATGAGGGTGGGGG - Intergenic
1097139414 12:56887354-56887376 GAGGAAGAGGATGAAGGGGGAGG - Intergenic
1097144873 12:56933261-56933283 TGGGATCAGGATGGGGGAGGGGG - Intronic
1097190979 12:57219588-57219610 GAGGGTGTGGAGGCAGGAGGGGG - Intronic
1097191260 12:57220661-57220683 CAGGATCAGGCTGTGGGAGGGGG - Intronic
1097239372 12:57564526-57564548 GTGGATGAGGGTGTGTGAGGAGG + Intronic
1097251098 12:57632705-57632727 GAGGAGGAGGAGGCGGGAGGAGG - Intronic
1097742270 12:63257435-63257457 GAGGGTTATGATGTGGGAGGGGG - Intergenic
1097790651 12:63811915-63811937 GAGGAAGAGGAAGAGGGAGAAGG + Intergenic
1097891440 12:64781088-64781110 GAGGAGGAGGAGGCGGCGGGCGG + Intergenic
1097891443 12:64781091-64781113 GAGGAGGAGGCGGCGGGCGGGGG + Intergenic
1098009373 12:66034130-66034152 GAGGAGGAGGATACGGGGAGGGG + Intergenic
1098029120 12:66236220-66236242 GAGGATGAGGATGTGGATGTGGG + Intronic
1098116547 12:67184739-67184761 GAGGAGGAGGAGGAGGGAGGAGG + Intergenic
1098309900 12:69138234-69138256 GAGGGTGAGGATGTGGGAAGGGG - Intergenic
1098558959 12:71851176-71851198 GAGCAGGAGGAAGGGGGAGGGGG + Intronic
1098728457 12:74000045-74000067 AAGGATGAGGATGGGGGAGTTGG + Intergenic
1099093290 12:78340166-78340188 GAGGGTGAGGGTGAGGGTGGAGG + Intergenic
1099140966 12:78974945-78974967 GAGGATGATGAAGCTGGAGGCGG - Intronic
1099163850 12:79276974-79276996 GAGGAGGAGGAGGAGGGAGAAGG + Intronic
1099293585 12:80802741-80802763 GAGGAGGAGGGTGAGGCAGGAGG - Intronic
1099389299 12:82059404-82059426 GAGGAAGAGGCTGGAGGAGGAGG + Intergenic
1101245736 12:102882979-102883001 GAAGAAGAGGAGGAGGGAGGAGG + Intronic
1101642781 12:106600740-106600762 CAGCATGACGAAGCGGGAGGTGG - Intronic
1101830657 12:108253859-108253881 GAGGATGGGGGGGCGGGGGGGGG + Intergenic
1102197375 12:111034731-111034753 GAGGAGGAGGAGGAGAGAGGAGG + Intronic
1102230253 12:111257261-111257283 GAGGAAGAGGAAAAGGGAGGAGG - Intronic
1102230330 12:111257497-111257519 GAGGAGGAAGAAGAGGGAGGGGG - Intronic
1102230336 12:111257513-111257535 GAGGAGGAGAAGGAGGGAGGAGG - Intronic
1102230365 12:111257630-111257652 AAGGAGGAGGAAGAGGGAGGAGG - Intronic
1102230402 12:111257767-111257789 GAGGAGGAGGATGGAGGAAGGGG - Intronic
1102449601 12:113030998-113031020 GAGGAGGAGGAGGCGTGAGCAGG - Intergenic
1102749150 12:115277185-115277207 GAGGAGGAGGAGGAGGGAGGCGG + Intergenic
1102780852 12:115563323-115563345 AAGGATGAGGTGGCGGGAGGTGG - Intergenic
1102792324 12:115657811-115657833 GAGGACGAGGAAGAAGGAGGAGG - Intergenic
1103080914 12:118023401-118023423 GAGGAGGAGGAGGGGGGAGGAGG + Intronic
1103328931 12:120140458-120140480 GGGCAGGAGGGTGCGGGAGGGGG - Intronic
1103350347 12:120279037-120279059 GGGGAGGGGGATGGGGGAGGGGG + Intergenic
1103411675 12:120716636-120716658 GAGGATGAGGAGGAGGGAGGTGG + Exonic
1103412464 12:120722168-120722190 GAGGATGTGGAGGAAGGAGGAGG + Exonic
1103434241 12:120912529-120912551 GAGGCTGAGGCTGAGGAAGGTGG - Intergenic
1103525153 12:121562649-121562671 GAGGAGGAGGAGGAGGAAGGGGG + Intronic
1104184947 12:126421474-126421496 AAGGATGAGGGGGTGGGAGGAGG - Intergenic
1104275660 12:127325039-127325061 GATGATGAAGATGGAGGAGGAGG - Intergenic
1104316226 12:127704393-127704415 GAAGAGGAGGAGGAGGGAGGAGG + Intergenic
1104316229 12:127704396-127704418 GAGGAGGAGGAGGGAGGAGGGGG + Intergenic
1104609335 12:130215574-130215596 GAGGATAAAGAAGAGGGAGGGGG - Intergenic
1105210764 13:18255511-18255533 GAGGATGAAGATGCAGGCTGGGG + Intergenic
1105541427 13:21320322-21320344 GAAGATGATCAAGCGGGAGGAGG + Intergenic
1105542834 13:21329614-21329636 GAGTGTGAGGATGAGGGAGAAGG + Intergenic
1105982710 13:25535178-25535200 GAGGATGAGAATACAGGAGAGGG + Intronic
1106065463 13:26344030-26344052 GAGGGTGAGGTTGGGGGAAGGGG - Intronic
1106389953 13:29325476-29325498 GAAGAAGAGGAAGAGGGAGGAGG + Intronic
1106413358 13:29526038-29526060 GAGGATGAGGCCAAGGGAGGAGG + Intronic
1106447666 13:29850657-29850679 GAGGACGAGGACGGGGGCGGCGG - Exonic
1106481516 13:30140559-30140581 GAGGATGCAGCTGTGGGAGGAGG - Intergenic
1106925277 13:34606878-34606900 GAGGATGAGGGTCGGGGAGGGGG + Intergenic
1107058554 13:36131437-36131459 GAGGAGGAGGAGGAGGGAGACGG - Intergenic
1107642390 13:42456856-42456878 GAGGAGGAGGAGGCAGGAGGTGG + Intergenic
1107647728 13:42512694-42512716 GAGGAGGAGGAGGCAGGAGGTGG - Intergenic
1107879701 13:44822293-44822315 GAGGAGGAGGGGGCGGGAGAAGG - Intergenic
1107890061 13:44906260-44906282 CAGGAGGAGGAGGAGGGAGGAGG + Intergenic
1108207479 13:48105505-48105527 GAGGATGAGGAGACTGGAGTAGG + Intergenic
1108750108 13:53439845-53439867 GAAGGTGGGGATGGGGGAGGGGG - Intergenic
1108828042 13:54440198-54440220 GAGGAGGAGAAAGAGGGAGGAGG - Intergenic
1108954244 13:56132501-56132523 GAGGCAGAGGCTGAGGGAGGGGG + Intergenic
1109358003 13:61257442-61257464 GAGGCTGTGTATGTGGGAGGGGG - Intergenic
1109369199 13:61399155-61399177 GAGGAAGAGGAAGGAGGAGGAGG + Intergenic
1110515841 13:76411452-76411474 GAGAAGGAGGAGGGGGGAGGAGG + Intergenic
1110515857 13:76411483-76411505 GAGGAGGAGGAGGGGGGAGAAGG + Intergenic
1110515865 13:76411499-76411521 GAGAAGGAGGAGGGGGGAGGAGG + Intergenic
1110849197 13:80224644-80224666 GAGGATGAGGAAGTTGGAGGAGG + Intergenic
1111622849 13:90746713-90746735 GAGGAGAAGGAGGAGGGAGGAGG - Intergenic
1111905967 13:94256551-94256573 GAGGATGATGATGATGGAGATGG - Intronic
1112041503 13:95552656-95552678 GCGGAGGCGGAGGCGGGAGGCGG + Intronic
1112319950 13:98396473-98396495 CAGGAGGAGGATGAGTGAGGAGG + Intronic
1112505252 13:99971159-99971181 GAGGAGGAGGAGGCGGGGGAGGG + Exonic
1112877484 13:104062465-104062487 GTGGAAGAGGATGAGGGAGTAGG - Intergenic
1112924676 13:104659577-104659599 GAGCAGGAGGAAGAGGGAGGAGG - Intergenic
1113159589 13:107364970-107364992 GGGGATGGGGAAGGGGGAGGGGG - Intronic
1113159613 13:107365021-107365043 AAGGAGGAGGAGGAGGGAGGGGG - Intronic
1113259724 13:108548269-108548291 TAGGATGATGATGCTGGTGGTGG + Intergenic
1113382976 13:109820677-109820699 GAGAGTGAGGGTGGGGGAGGAGG - Intergenic
1113385359 13:109843126-109843148 GAGGATGACGGTGCTGGAGTGGG - Intergenic
1113414466 13:110117565-110117587 GAGGTTCAGAAGGCGGGAGGCGG + Intergenic
1113453746 13:110432375-110432397 GGGGGTGAGGATGAGGGAAGGGG + Intronic
1113527534 13:110992318-110992340 GAGCAAGCGGCTGCGGGAGGAGG - Intergenic
1113975568 13:114225421-114225443 GAGGAAGGGGAGGGGGGAGGGGG + Intergenic
1114201221 14:20522575-20522597 GAGAAGGAGGAGGAGGGAGGAGG + Intergenic
1114233103 14:20801555-20801577 GAGGATGAGGTTGAGGGAGGTGG + Exonic
1114271410 14:21102542-21102564 GAGGATAAGGAGGCAAGAGGAGG + Intronic
1114287086 14:21254833-21254855 GAGGCGGAGGTTGCGGTAGGCGG + Intronic
1114492188 14:23109995-23110017 GAAGATGAAGATGAGGAAGGAGG + Intergenic
1114558159 14:23573712-23573734 GAGGATCAGGCAGTGGGAGGAGG - Intronic
1114627785 14:24140805-24140827 GAGGGCGAGGATGCGTGGGGCGG - Intronic
1115094538 14:29618967-29618989 GAGAATGAGGAGGAGGAAGGGGG + Intronic
1115826129 14:37279941-37279963 GAGGCTGGGGATGAGGGTGGAGG - Intronic
1117541039 14:56746738-56746760 GATGATGAGGAGGAGGGTGGTGG + Intergenic
1117761656 14:59035413-59035435 GAGGGGGAGGAGGGGGGAGGAGG - Intergenic
1117842154 14:59870819-59870841 GAGGAAGAGGAGGGGGGAGAAGG - Exonic
1117880858 14:60312194-60312216 GAGGCTGAGGCTGAGGCAGGGGG - Intergenic
1118363128 14:65072432-65072454 CAGGATGAAGGTGGGGGAGGCGG - Intronic
1118557764 14:67044733-67044755 GAGGAGGAGGAGGAGGAAGGGGG - Intronic
1118767751 14:68921562-68921584 GAGGAGGAGGAAGAGGAAGGAGG + Intronic
1118774534 14:68965532-68965554 GGGGGTGGGGATGCTGGAGGTGG - Intronic
1118826965 14:69392508-69392530 GAGGTTGAGGGTGGGGTAGGAGG + Intronic
1119067407 14:71542656-71542678 GAGGAGGAGGAGGGAGGAGGAGG - Intronic
1119067408 14:71542659-71542681 GAGGAGGAGGAGGAGGGAGGAGG - Intronic
1119067420 14:71542698-71542720 GAGGAGGAGGAGGAGGGAGGAGG - Intronic
1119359110 14:74033007-74033029 GAGGATGAGGAAGGAAGAGGAGG - Intronic
1119479167 14:74949153-74949175 GAGGCTGAGAATGCTGGTGGGGG + Intronic
1119696046 14:76714128-76714150 GAGAAAGAGGGTGTGGGAGGAGG + Intergenic
1119731164 14:76952091-76952113 GAGGATAAGGATGCTGGAGTCGG - Intergenic
1119732031 14:76957127-76957149 GAGGCTGGGGCTGAGGGAGGGGG - Intergenic
1119738539 14:76999354-76999376 GAGGAAGAGGATGAGGGTGGGGG - Intergenic
1119777927 14:77259746-77259768 GAGGATGAGGGTGGGGGACTTGG + Intergenic
1120234646 14:81876360-81876382 GACCATGAGGATGGGGAAGGTGG + Intergenic
1120294528 14:82622988-82623010 GAGGAGGAGAATGGAGGAGGAGG + Intergenic
1120470514 14:84918055-84918077 GAGGAGGAGGAAGGAGGAGGGGG - Intergenic
1120470517 14:84918058-84918080 GAGGAGGAGGAGGAAGGAGGAGG - Intergenic
1120787997 14:88554656-88554678 GAGGATGCGGGAGCGGGAGCGGG - Exonic
1120880790 14:89413916-89413938 AAGGAGGAAGAAGCGGGAGGGGG + Intronic
1121199944 14:92108452-92108474 TAGGAGGAGGATGCAGGAGGCGG + Intergenic
1121667841 14:95686289-95686311 GAGGAGGAGGAAGGGGGAGGAGG - Intergenic
1121708221 14:96017174-96017196 CAAGGTGAGGATGCTGGAGGAGG - Intergenic
1121709448 14:96026767-96026789 GAGGAGGAGGATGCAGCAGAAGG + Intergenic
1121735709 14:96216681-96216703 GAGGAGGAGGAGGAAGGAGGAGG + Intronic
1121735717 14:96216710-96216732 GAGGAAGAGGAAGGAGGAGGAGG + Intronic
1121735721 14:96216723-96216745 GAGGAGGAGGAAGGAGGAGGAGG + Intronic
1121735725 14:96216736-96216758 GAGGAGGAGGAGGAAGGAGGAGG + Intronic
1121735726 14:96216739-96216761 GAGGAGGAGGAAGGAGGAGGAGG + Intronic
1121735730 14:96216752-96216774 GAGGAGGAGGAGGAGGAAGGAGG + Intronic
1121735731 14:96216755-96216777 GAGGAGGAGGAGGAAGGAGGAGG + Intronic
1121735732 14:96216758-96216780 GAGGAGGAGGAAGGAGGAGGAGG + Intronic
1121777062 14:96598094-96598116 GAGGAGGAGGAAGAGGGAGAAGG - Intergenic
1121841285 14:97136210-97136232 GATGATGATGATGCTGGTGGTGG - Intergenic
1121984901 14:98495774-98495796 GAGGAAGAGGAAGAGGAAGGAGG + Intergenic
1121984903 14:98495780-98495802 GAGGAAGAGGAAGGAGGAGGAGG + Intergenic
1122038176 14:98963397-98963419 GAGGAAGAGGAAGAGGAAGGAGG + Intergenic
1122056573 14:99102466-99102488 GAGCAGGAGGAAGAGGGAGGGGG - Intergenic
1122095100 14:99364702-99364724 GAGGATGATGATGGTGGTGGTGG - Intergenic
1122206016 14:100148425-100148447 GAGGAAGGGGAAGGGGGAGGAGG - Intronic
1122322218 14:100861964-100861986 GAGGAGGAAGAGGAGGGAGGAGG - Intergenic
1122324813 14:100875710-100875732 GAGGAAGGGGAGACGGGAGGTGG - Intergenic
1122409018 14:101516763-101516785 CAGCATGGGGATGCTGGAGGAGG - Intergenic
1122457099 14:101862929-101862951 GAGGCTGAGGCAGGGGGAGGGGG - Intronic
1122831537 14:104399703-104399725 GGGGGTGGGGATGCTGGAGGTGG + Intergenic
1122966996 14:105135723-105135745 GAGGTTGAGGCTGGGGCAGGAGG + Intergenic
1123539252 15:21271700-21271722 GAGGAGGAGGGTGGGGGAGAGGG - Intergenic
1123761999 15:23440547-23440569 GGAGAAGAAGATGCGGGAGGAGG - Exonic
1123986744 15:25653070-25653092 GAGGATGAAGGAGAGGGAGGAGG - Intergenic
1124158492 15:27249136-27249158 GGTGATGCGGCTGCGGGAGGTGG + Intronic
1124333958 15:28843395-28843417 GAAGATGTGGAGGCAGGAGGAGG - Intergenic
1124622569 15:31283205-31283227 GGGGATGCGTATGCGGGGGGAGG - Intergenic
1124654743 15:31499129-31499151 GAGGAGGAGGAAGTGGGTGGTGG + Intronic
1124816779 15:33001694-33001716 GAGGAGGGGGAAGGGGGAGGCGG - Intronic
1124816781 15:33001700-33001722 GAGGAGGAGGAGGGGGAAGGGGG - Intronic
1124843067 15:33262977-33262999 GAGAGTGAGGATGGGGCAGGAGG - Intergenic
1124883309 15:33661543-33661565 GTGGGTGAGGCTGGGGGAGGGGG + Intronic
1125024802 15:35019494-35019516 GAGGAGGAGGGAGGGGGAGGAGG - Intergenic
1125024804 15:35019500-35019522 GGGGAGGAGGAGGAGGGAGGGGG - Intergenic
1125024811 15:35019513-35019535 GAGGAGGAGGGAGGGGGAGGAGG - Intergenic
1125024813 15:35019519-35019541 AAGGAGGAGGAGGAGGGAGGGGG - Intergenic
1125028232 15:35051883-35051905 GAGGCTGAGGCTGAGGCAGGAGG - Intergenic
1125402383 15:39318004-39318026 AAGGAGGAGGAGGAGGGAGGAGG - Intergenic
1125568387 15:40695100-40695122 GAGAAGGCGGATCCGGGAGGCGG + Intronic
1125676157 15:41503585-41503607 GAGGAAGAGGGGGCCGGAGGAGG - Intergenic
1126052301 15:44697137-44697159 GGGGAAGAGGAAGAGGGAGGAGG - Intronic
1126498545 15:49319575-49319597 AAGGAAGAGGATGGGGAAGGAGG - Intronic
1127469819 15:59280972-59280994 GGAGGTGAGGATGGGGGAGGGGG - Intronic
1127844543 15:62857596-62857618 GAGGATGTGGTTAGGGGAGGAGG - Intergenic
1128426073 15:67543190-67543212 GAGGATGAGGGGGAGGGAAGAGG - Exonic
1128577238 15:68784393-68784415 GAGGAGGAGGATGAGGATGGTGG - Exonic
1128770553 15:70278548-70278570 CAGGATGGGGATGGGGGAGTGGG + Intergenic
1128976875 15:72160810-72160832 GAGGATGAGGAGGTTGGACGTGG - Exonic
1128998180 15:72312176-72312198 CAGGAAGAGGCTGCAGGAGGTGG + Intronic
1129109161 15:73327738-73327760 GAGGATGAGCATAGGGGTGGTGG - Intronic
1129232378 15:74203899-74203921 CAGGATGGGGATGGGGGTGGGGG + Intronic
1129265790 15:74392435-74392457 GGGCTTGAGGATGCAGGAGGAGG - Intergenic
1129300342 15:74621747-74621769 GAGGAGGAGGAGGAGGGAGTCGG + Intronic
1129406399 15:75321835-75321857 GAGGATGAGGATGAAGGAGGAGG - Intergenic
1129446881 15:75625234-75625256 GGGGAAGGGGATGGGGGAGGGGG - Intronic
1129672652 15:77615876-77615898 GAGCAAGAGGATGCTGGCGGGGG - Exonic
1129676813 15:77636201-77636223 GAGGCTGAGGAGGCAGGAGGTGG + Intronic
1130059567 15:80559783-80559805 GATGATGAGGATGTTGAAGGGGG + Intronic
1130094271 15:80844393-80844415 CAGGATGAGGGGGCAGGAGGGGG + Intronic
1130179735 15:81612928-81612950 CAGGAGGAGGAGGCGGGAGCAGG - Intergenic
1130226104 15:82059185-82059207 GAGGAAGAGGAGTGGGGAGGAGG - Intergenic
1130455642 15:84104171-84104193 GAGGATTAGGATTTGGGAAGAGG + Intergenic
1130510650 15:84586469-84586491 GAGGAAGAGTAAGGGGGAGGGGG - Intergenic
1130553888 15:84909510-84909532 GAGGATGAGGATGCTACTGGTGG + Intronic
1130558482 15:84940534-84940556 GAGGAAGAGGATGAGGGGGAAGG - Intronic
1130662966 15:85845146-85845168 GGGGATGTGGCTGGGGGAGGTGG + Intergenic
1130721061 15:86386167-86386189 GAGGAAGAGGGAGGGGGAGGAGG - Intronic
1130721101 15:86386258-86386280 GAGGAGGAGGAGGAGGGAGGAGG - Intronic
1130959800 15:88652333-88652355 GAGGGGGAGGAGGGGGGAGGAGG - Intronic
1131068805 15:89451163-89451185 GAGGGGTGGGATGCGGGAGGGGG + Intergenic
1131139825 15:89968115-89968137 AAGGAGGAGGAGGAGGGAGGAGG + Intergenic
1131139828 15:89968118-89968140 GAGGAGGAGGAGGGAGGAGGGGG + Intergenic
1131225896 15:90624215-90624237 GCGGAGGAGAATGCGGGAGAAGG - Intronic
1131229172 15:90647484-90647506 GAGGATGAGGAGGGGTGTGGAGG - Intergenic
1131229232 15:90647651-90647673 GAGGAGGAGGAGGGGTGAGGAGG - Intergenic
1131284704 15:91047757-91047779 GAGGAGGAGGAAGGAGGAGGAGG - Intergenic
1131284705 15:91047760-91047782 GAGGAGGAGGAGGAAGGAGGAGG - Intergenic
1131426393 15:92348477-92348499 GAGGATGAGGAAGAGCGAGAGGG - Intergenic
1131901062 15:97088514-97088536 GAGGAGGAGGAAGGAGGAGGAGG - Intergenic
1131901063 15:97088517-97088539 GAGGAGGAGGAGGAAGGAGGAGG - Intergenic
1131901067 15:97088530-97088552 GAGGAGGAGGAAGGAGGAGGAGG - Intergenic
1131901068 15:97088533-97088555 GAGGAGGAGGAGGAAGGAGGAGG - Intergenic
1131901073 15:97088549-97088571 GAGGAGGAGGATGAAGGAGGAGG - Intergenic
1131901080 15:97088578-97088600 GAGGAGGAGGAAGGAGGAGGAGG - Intergenic
1131901081 15:97088581-97088603 GAGGAGGAGGAGGAAGGAGGAGG - Intergenic
1131901095 15:97088630-97088652 GAGGAGGAGGAAGGAGGAGGAGG - Intergenic
1131901096 15:97088633-97088655 GAGGAGGAGGAGGAAGGAGGAGG - Intergenic
1131901100 15:97088646-97088668 GAGGAGGAGGAAGGAGGAGGAGG - Intergenic
1131901101 15:97088649-97088671 GAGGAGGAGGAGGAAGGAGGAGG - Intergenic
1131901105 15:97088662-97088684 GAGGAGGAGGAAGGAGGAGGAGG - Intergenic
1131901107 15:97088668-97088690 GAGGAAGAGGAGGAGGAAGGAGG - Intergenic
1131901112 15:97088687-97088709 GAGGAGGAGGAAGAGGAAGGAGG - Intergenic
1131901115 15:97088700-97088722 GAGGAGGAGGAAGGAGGAGGAGG - Intergenic
1131901117 15:97088706-97088728 GAGGAAGAGGAGGAGGAAGGAGG - Intergenic
1132021000 15:98362494-98362516 GAAGCTGAGGATGGGGGTGGGGG - Intergenic
1132078600 15:98845408-98845430 GAGGAAGAGGGAGGGGGAGGAGG - Intronic
1132385550 15:101397736-101397758 AAGGCTGAGGAAGGGGGAGGAGG - Intronic
1132482925 16:175571-175593 GAGGAGGTGGAGGAGGGAGGAGG - Intergenic
1132709168 16:1258868-1258890 GAGGCTCAGGATGGAGGAGGGGG - Exonic
1132989801 16:2786869-2786891 GGGGGTGAGGATGGGGGAGGGGG - Intronic
1132989810 16:2786887-2786909 GGGGGTGAGGATGAGGGAGGGGG - Intronic
1132989817 16:2786905-2786927 GGGAGTGAGGATGAGGGAGGGGG - Intronic
1132989842 16:2786975-2786997 AGGGATGAGGATGAGGGAAGGGG - Intronic
1132989851 16:2787010-2787032 GGAGGTGAGGATGAGGGAGGGGG - Intronic
1132989902 16:2787181-2787203 GGGGCTGAGGATGGAGGAGGGGG - Intronic
1132989921 16:2787233-2787255 AGGGGTGAGGATGAGGGAGGGGG - Intronic
1132989959 16:2787351-2787373 GGGGGTGAGGATGAGGGAGGGGG - Intronic
1132989983 16:2787421-2787443 GGGGGTGAGGATGAGGGAAGTGG - Intronic
1133392664 16:5422475-5422497 AAGGAGGAGGGAGCGGGAGGAGG + Intergenic
1133392763 16:5422801-5422823 GAGGAGGAGGAGGAGGGAGTGGG + Intergenic
1133392765 16:5422807-5422829 GAGGAGGAGGGAGTGGGAGGAGG + Intergenic
1133392795 16:5422920-5422942 GAGAAGGAGGATGAGGGAGAGGG + Intergenic
1133392798 16:5422926-5422948 GAGGATGAGGGAGAGGGAAGGGG + Intergenic
1133417300 16:5616582-5616604 GAGGAGGAGGAGGAGGGAGAGGG - Intergenic
1133520234 16:6549397-6549419 GAGGAGGAGGAGGGAGGAGGAGG + Intronic
1133582616 16:7160828-7160850 GAGGAGGAGGAGGAAGGAGGAGG - Intronic
1133582617 16:7160831-7160853 GAGGAGGAGGAGGAGGAAGGAGG - Intronic
1134066604 16:11232477-11232499 GAGGAGGGGGAGGGGGGAGGAGG + Intergenic
1134066611 16:11232490-11232512 GGGGAGGAGGAGGGGGGAGGAGG + Intergenic
1134111026 16:11515735-11515757 GAGGAGGAGGAAAAGGGAGGAGG + Intronic
1134111037 16:11515773-11515795 GAGGAGGAGGAAAAGGGAGGAGG + Intronic
1134449399 16:14354221-14354243 GAGGAGGAGGAAGGGGGAGGGGG + Intergenic
1134555763 16:15163173-15163195 GAGGGTGAGGATGTGGTAGATGG - Intergenic
1134624428 16:15713849-15713871 GATGTTGAGGATGCGCGACGGGG + Intronic
1134692063 16:16197603-16197625 GAGGAGGAGGAGGGGGAAGGAGG + Intronic
1134846999 16:17448694-17448716 GAGGAGGAAGAGGGGGGAGGAGG + Intronic
1134916345 16:18074884-18074906 GAGGGTGAGGATGTGGTAGATGG - Intergenic
1135060643 16:19268675-19268697 GAGGCTGAGGCTGAGGCAGGTGG - Intergenic
1135191803 16:20360560-20360582 GAGGATGAGGATGAGGTAAGGGG - Exonic
1135649940 16:24197333-24197355 CAGGAAGAAGATGAGGGAGGTGG + Intronic
1135960216 16:26988716-26988738 GTGGATGAGGAGGCGGGGGAGGG - Intergenic
1135986053 16:27185132-27185154 GAGCAGGAGGAAGCGGCAGGGGG + Intergenic
1136136022 16:28257458-28257480 GAGGAGGAGGAGGAAGGAGGAGG - Intergenic
1136136023 16:28257461-28257483 GAGGAGGAGGAGGAGGAAGGAGG - Intergenic
1136347731 16:29687053-29687075 GGGGATGAGGATAAGGGAAGGGG - Intronic
1136403535 16:30030843-30030865 GAGGAGGAGGATGCGGATGGGGG + Exonic
1136451919 16:30358385-30358407 GAGGCTGAGGAGGCTGGAGGAGG + Exonic
1136546653 16:30958381-30958403 GCCGGTGAGGAGGCGGGAGGGGG + Intronic
1136555647 16:31006352-31006374 GAGGATGAGAAAGGGGCAGGGGG - Intronic
1136559981 16:31033555-31033577 GGGGCTGAGGCTGCGGGAGCTGG + Exonic
1136610566 16:31362779-31362801 GAGGATGAGGGTAGGGGAGGTGG + Intronic
1137617494 16:49856218-49856240 GAGGAGGAGGGTGAGGGTGGCGG - Intronic
1137740686 16:50769803-50769825 GAGGTTAAGGATGGGGCAGGAGG - Intronic
1137854059 16:51775812-51775834 GAGAAGGAGGAGGTGGGAGGAGG - Intergenic
1137878837 16:52025076-52025098 GAGGAGGAGGAAGAAGGAGGAGG - Intronic
1138066422 16:53946068-53946090 GTGGAGGAGGATGGGGGAAGGGG + Intronic
1138126163 16:54440462-54440484 GAGGAGGAGGAAGGAGGAGGAGG - Intergenic
1138126164 16:54440465-54440487 GAGGAGGAGGAGGAAGGAGGAGG - Intergenic
1138153926 16:54685713-54685735 GAGGAAGAGGAAGAGGGAAGAGG - Intergenic
1138217177 16:55214553-55214575 GAGGATGAGGAGAGGGGAGAGGG + Intergenic
1138476034 16:57271055-57271077 CAGGAGGACGATGCTGGAGGTGG + Intronic
1138520483 16:57568301-57568323 GACGATGATGATGATGGAGGTGG - Intronic
1138584244 16:57960185-57960207 GAGGATTGGGATGGGTGAGGTGG - Intronic
1138830881 16:60373512-60373534 GAGGAGGAGGAGGAGGAAGGTGG - Intergenic
1139165560 16:64561267-64561289 GAGGAAGAGGAAGAGGAAGGAGG + Intergenic
1139165589 16:64561479-64561501 GAGGAGGAGGAAGAAGGAGGAGG + Intergenic
1139165749 16:64563313-64563335 GAGGAGGAGGAAGAAGGAGGAGG + Intergenic
1139165767 16:64563370-64563392 GAGGAAGAGGAGGAAGGAGGAGG + Intergenic
1139246254 16:65447270-65447292 GAGGATGAGGGTAGTGGAGGAGG + Intergenic
1139424920 16:66873693-66873715 GGGGAGGAGGAGGGGGGAGGAGG - Intergenic
1139424996 16:66873874-66873896 GAGGAGGAGGAAGGAGGAGGAGG - Intergenic
1139425063 16:66874057-66874079 GAGGTAGAGGAGGAGGGAGGAGG - Intergenic
1139465786 16:67153363-67153385 GTTGATGAGGATGGGGGTGGGGG - Intergenic
1139658564 16:68404541-68404563 GAGGGTGGGTATGCAGGAGGTGG + Intronic
1139946282 16:70644735-70644757 GAGGAAGAGGAGGAGGGAGGAGG + Intronic
1139946290 16:70644758-70644780 GAGGAAAAGGAGGAGGGAGGAGG + Intronic
1139946298 16:70644781-70644803 GAGGAAAAGGAGGAGGGAGGAGG + Intronic
1139946340 16:70644947-70644969 GAGGAAGAGGAGGAGGAAGGAGG + Intronic
1140387993 16:74559454-74559476 GAGGGTAAGGCTGGGGGAGGAGG + Intronic
1140814764 16:78611352-78611374 GAGGTTGAGGATGGGGCTGGGGG + Intronic
1141263676 16:82476239-82476261 GAGGAGGAGAAGGAGGGAGGAGG - Intergenic
1141372456 16:83500509-83500531 GAGGGGGAGGAGGAGGGAGGAGG - Intronic
1141372466 16:83500531-83500553 GAGGAGGAGGGAGAGGGAGGAGG - Intronic
1141372472 16:83500547-83500569 GAGGAGGAGGGAGAGGGAGGAGG - Intronic
1141378736 16:83556320-83556342 TAGTATGAGGAAGCAGGAGGAGG + Intronic
1141466817 16:84211552-84211574 GAGGGTGAGGCTGGGGGCGGTGG - Intergenic
1141527191 16:84618729-84618751 GAGAATGAGGAAGGGGGAGAGGG - Intergenic
1141541350 16:84725185-84725207 GAGAATGGGGGAGCGGGAGGCGG - Intronic
1141635118 16:85310513-85310535 GAGAAGGAGGAGGTGGGAGGAGG - Intergenic
1141670326 16:85488239-85488261 GAGGACGAGGATGCTAGATGGGG - Intergenic
1141703581 16:85653202-85653224 GAGGAGGGGGAGGGGGGAGGAGG - Intronic
1141703594 16:85653227-85653249 GAGGAGGAGGAGGGGGGAGGAGG - Intronic
1141703595 16:85653230-85653252 GAGGAGGAGGAGGAGGGGGGAGG - Intronic
1141703605 16:85653252-85653274 GAGGAGGAGGAGGGGGTAGGAGG - Intronic
1141703616 16:85653280-85653302 GAGGAGGAGGAGGGGGTAGGAGG - Intronic
1141703624 16:85653299-85653321 GAGGAGGAGGAGGGGGTAGGAGG - Intronic
1141711419 16:85701427-85701449 GAGGAGGAGGAGGAGAGAGGAGG - Intronic
1141775670 16:86121462-86121484 GAGGAGGAGGAGGAGGGAGGAGG - Intergenic
1141775800 16:86121884-86121906 GAGGAGGAGGAGGCAGGAGTAGG - Intergenic
1141845232 16:86603936-86603958 GAGGAGGAGGAGGAGGGAGAAGG - Intergenic
1141896777 16:86963400-86963422 GGGGATGCGGACGCTGGAGGTGG + Intergenic
1141992445 16:87618295-87618317 GAGGAAGAGGAGGCAGGAGGAGG + Intronic
1142237143 16:88927701-88927723 GGGGAGGAGGAGGCGGAAGGGGG - Intronic
1142259324 16:89035235-89035257 GAGAATGAAGAGGAGGGAGGGGG - Intergenic
1142604417 17:1073701-1073723 GAGGAAGAGGATGATGGACGAGG + Intronic
1142715722 17:1745844-1745866 CAGGATGAGGTTGGGGCAGGTGG - Exonic
1142889353 17:2932956-2932978 GAGGCTGGGATTGCGGGAGGAGG + Intronic
1142891880 17:2949013-2949035 GGGGAGGAGGATGCTGGAGGAGG - Intronic
1143165417 17:4895045-4895067 AAGGAGGAGGAGGTGGGAGGAGG - Intronic
1143180202 17:4979907-4979929 GAGGGTGGGGGTGAGGGAGGGGG + Exonic
1143188237 17:5023474-5023496 GAGGATGAGAATGAAGAAGGTGG + Exonic
1143193776 17:5059795-5059817 GAGGAGGAGGAGGGGGGAGGAGG - Intergenic
1143193777 17:5059798-5059820 GAGGAGGAGGAGGAGGGGGGAGG - Intergenic
1143361406 17:6374634-6374656 AAGGAGGAGGCTGCTGGAGGAGG + Intergenic
1143370650 17:6436890-6436912 GAGGAGGAGGAGGAGGGAAGAGG + Intergenic
1143483412 17:7239494-7239516 GAGGAGGAGGAGGAGGGAGCAGG - Exonic
1143564011 17:7710574-7710596 GGGGATCAGGAGGTGGGAGGTGG + Exonic
1143583211 17:7838330-7838352 GAGGAGGAGGAGGAGGGAGGGGG + Intergenic
1143635280 17:8160889-8160911 GAAGATGAGGAAGAGGGAGAGGG + Intronic
1143902005 17:10181436-10181458 AAAGAAGAGGATGGGGGAGGAGG + Intronic
1144026043 17:11276603-11276625 GAGGATGATGATGGTGGTGGTGG - Intronic
1144453811 17:15402905-15402927 GGGGATGAGGTTTAGGGAGGTGG + Intergenic
1144552802 17:16256422-16256444 GAGGCAGAGGAATCGGGAGGTGG - Intronic
1144580468 17:16456179-16456201 GAGGAAGAGGAGGAAGGAGGAGG + Intronic
1144749513 17:17638696-17638718 GAGGAAGAGGCTGGGTGAGGTGG + Intergenic
1144808828 17:17985500-17985522 GAGGATGGGGGTTAGGGAGGTGG + Intronic
1144821091 17:18075236-18075258 GAGGATGAGGATAGGGGGAGAGG + Intergenic
1145056490 17:19706943-19706965 GAGGAGGAGGATGCAGGAACAGG + Intronic
1145204556 17:20976060-20976082 GGGGAAGAGGATGATGGAGGAGG - Intergenic
1145973006 17:28967956-28967978 AATGCTGAGGATGCAGGAGGGGG + Intronic
1146027143 17:29331380-29331402 AAGGATGAGGAAGCAGGAGGGGG - Intergenic
1146266110 17:31453977-31453999 GGGGATGCGGTTGTGGGAGGAGG - Intronic
1146499433 17:33351859-33351881 GGGGATGAGGATGGGGGAGTCGG + Intronic
1146948409 17:36889753-36889775 GAGGAGGAAGATGAGGGTGGTGG + Intergenic
1147159031 17:38560019-38560041 GAGAACAAGGATGGGGGAGGGGG + Intronic
1147459667 17:40560237-40560259 GAGGGTCAGGATACGGGAAGAGG - Intronic
1147498816 17:40942567-40942589 GAGGAGGAAGATGAAGGAGGAGG - Intergenic
1147498827 17:40942619-40942641 GAAGAAGAGGAGGGGGGAGGAGG - Intergenic
1147598428 17:41731661-41731683 GAAGCTGAGGCTGCTGGAGGAGG - Exonic
1147950711 17:44106191-44106213 GGGGATGAGGCAGGGGGAGGGGG + Intronic
1147992488 17:44343685-44343707 GAGGATGAGGCAGGGGCAGGGGG - Intergenic
1148271458 17:46265395-46265417 GAGGAGGAGGAGGAAGGAGGAGG - Intergenic
1148355385 17:46972225-46972247 GAGGAGGAAGAAGCGGGTGGCGG - Intronic
1148574536 17:48700145-48700167 AAGGAGGAGGAAGGGGGAGGAGG + Intergenic
1148674686 17:49438560-49438582 GAGGAGCTGGATGGGGGAGGGGG + Intronic
1148778536 17:50109241-50109263 GAGGATGAGGAGGCTGGCAGGGG - Intronic
1148810694 17:50289062-50289084 GAGGCTGAGGCTGAGGCAGGAGG - Intergenic
1149429341 17:56584843-56584865 GGGGATGAGGATGGGGTCGGGGG + Intergenic
1149451206 17:56751365-56751387 GAGGAAGAGGGTGCGGACGGAGG + Intergenic
1149451212 17:56751387-56751409 GAGGAAGAGGGTGCGGACGGAGG + Intergenic
1149632843 17:58141787-58141809 GAGGGAGAGGAAGAGGGAGGGGG - Intergenic
1149696130 17:58617440-58617462 GAGGATAAGGAGGCAGGAGTTGG + Intronic
1150816543 17:68396492-68396514 AAGGAAGAGGAAGCAGGAGGAGG + Intronic
1150833288 17:68542169-68542191 GAGGATGGGGAGGAGAGAGGAGG + Intronic
1150890549 17:69144258-69144280 GAGGAAGAGGAGGAAGGAGGAGG - Intergenic
1151282539 17:73087687-73087709 AAGGATGGGGTTGTGGGAGGAGG + Intronic
1151418904 17:73984812-73984834 GAGGGTGAGGTGGGGGGAGGTGG - Intergenic
1151427509 17:74040625-74040647 GAGGATGATGTTGCTGGAGTTGG - Intergenic
1151505051 17:74522078-74522100 GAGGAGGAAGAGGTGGGAGGGGG + Exonic
1151620305 17:75240936-75240958 GAGGATTGGGATGCCTGAGGAGG + Exonic
1151629546 17:75301234-75301256 GCAGATGAGGATGTGGAAGGGGG - Intergenic
1151699890 17:75737510-75737532 GAGGAGGAGGCAGGGGGAGGTGG - Intronic
1151823335 17:76509109-76509131 GAGGATTAGGAAGGGGGAGGTGG + Intergenic
1151826604 17:76527463-76527485 GAGGATGAGGATGGGCCAGGAGG + Exonic
1151852194 17:76697652-76697674 GAGGAGGTGGAGGCGGGAGGGGG + Intronic
1151860839 17:76760376-76760398 GAGAAGGAGGAGGAGGGAGGGGG + Intronic
1152000092 17:77639935-77639957 GAGGAAGAGGAAGAAGGAGGAGG - Intergenic
1152036601 17:77877147-77877169 GAGGAGGAGGTTGAGGGAGGAGG + Intergenic
1152043047 17:77917429-77917451 GAGGAGGAGGAGGAGGGAGGAGG + Intergenic
1152043048 17:77917432-77917454 GAGGAGGAGGAGGGAGGAGGAGG + Intergenic
1152124552 17:78438431-78438453 GAGGAGGAGGAGGAGGGAGGAGG + Intronic
1152179009 17:78806225-78806247 GAGGATGGTGAGGGGGGAGGTGG + Exonic
1152200574 17:78943582-78943604 GAGGATGGCGATGGGGGAGCTGG - Intergenic
1152238390 17:79149979-79150001 GGGGATGGGGATGGGGGTGGGGG + Intronic
1152259945 17:79261464-79261486 GAGGCAGAGGATGCAGGTGGAGG + Intronic
1152315948 17:79580270-79580292 GAGGAGGAGGATGGGGGGGGAGG - Intergenic
1152598373 17:81249250-81249272 GGGGAAGAGGAGGAGGGAGGAGG + Intronic
1152659334 17:81535228-81535250 GGGGATGGGGATGATGGAGGAGG - Intronic
1153185234 18:2478829-2478851 GAGGAGGAGGAAGATGGAGGAGG + Intergenic
1153185239 18:2478854-2478876 GAGGAAGAAGATGGAGGAGGAGG + Intergenic
1153185248 18:2478895-2478917 GAGGAGGAAGAAGAGGGAGGAGG + Intergenic
1153185252 18:2478911-2478933 GAGGAGGAGGAAGAAGGAGGAGG + Intergenic
1153575537 18:6516541-6516563 GAGGAAGAGGAGGAGGGAGGAGG + Intronic
1153680644 18:7497355-7497377 GAGAAGGAGGAAGGGGGAGGAGG + Intergenic
1154031193 18:10755866-10755888 GAGGATGAGGAGGCAGGATGGGG + Intronic
1154031205 18:10755906-10755928 GAGGGTGAGGAGGAGGGATGGGG + Intronic
1154031231 18:10756006-10756028 GAGAATGAGGAGGAGGGATGGGG + Intronic
1154031353 18:10756625-10756647 GAGGATGAGGAGGAGGGGTGGGG + Intronic
1154031538 18:10757507-10757529 GAAGATGAGGAGGAGGGATGGGG + Intronic
1154141206 18:11826241-11826263 GAGGAGGAGGAGCGGGGAGGGGG + Intronic
1154141218 18:11826273-11826295 GAGGAGGAGGAGCGGGGAGGGGG + Intronic
1154141240 18:11826337-11826359 GAGGAGGAGGAGCGGGGAGGGGG + Intronic
1154155346 18:11940018-11940040 GAGGCTGAGGCTGAGGCAGGTGG + Intergenic
1154162239 18:11989303-11989325 GAGGAAGAGGAGGCAGGAGGGGG + Intronic
1154171740 18:12057313-12057335 GAGGATGAGAATGAAGAAGGTGG - Intergenic
1154215973 18:12416415-12416437 GAGGCTGAGGTTGAGGCAGGAGG - Intronic
1154236485 18:12610787-12610809 GAGAATGAGGATGAGAGAAGAGG - Intronic
1155066490 18:22273651-22273673 GAGGAGGAGGAGGGAGGAGGAGG - Intergenic
1155066491 18:22273654-22273676 GAGGAGGAGGAGGAGGGAGGAGG - Intergenic
1155066507 18:22273694-22273716 GAGGAGGAGGAGGGAGGAGGAGG - Intergenic
1155066508 18:22273697-22273719 GGGGAGGAGGAGGAGGGAGGAGG - Intergenic
1155066548 18:22273795-22273817 AAGGAGGAGGATGGAGGAGGAGG - Intergenic
1155066582 18:22273890-22273912 GAGGAGGAGGAAGGAGGAGGAGG - Intergenic
1155066608 18:22273968-22273990 GAGGAGGAGGAGGGAGGAGGAGG - Intergenic
1155066623 18:22274010-22274032 GAGGAAGAGGAGGAGGGAGGAGG - Intergenic
1155069707 18:22303946-22303968 GGGGATGAGAATACGGGTGGTGG - Intergenic
1155140357 18:23039167-23039189 GAGGAGGAGGAAGAAGGAGGAGG + Intergenic
1155507596 18:26548289-26548311 GAGGAGGAGGAGGACGGAGGTGG - Intronic
1156292403 18:35759452-35759474 GAGGCTGGGGAGGGGGGAGGGGG + Intergenic
1156482657 18:37445872-37445894 GAGGAGGAGGATGGTGGTGGTGG - Intronic
1157239653 18:45997589-45997611 GAGGACGAGGGGGCGGGAGGTGG - Intronic
1157426978 18:47592477-47592499 GAGGATGAGGAGGAGTGGGGAGG - Intergenic
1157514269 18:48299692-48299714 GAGGATGAAGAGGCTGAAGGAGG + Intronic
1157599981 18:48887908-48887930 CAGGAAGAGGATGGGAGAGGTGG - Intergenic
1157648522 18:49303044-49303066 GTGGATGAGGATGAAGGAGTGGG - Intronic
1157811626 18:50701169-50701191 GAGGATGGGGGTGGGGGTGGGGG - Intronic
1157874468 18:51259738-51259760 GAGGATGAGGGTGGGGAGGGAGG - Intergenic
1158089398 18:53693005-53693027 GAGGATGAGGATGAGGGTGAGGG + Intergenic
1158446287 18:57524751-57524773 GAGGAAGAGGAAGGAGGAGGAGG + Intergenic
1158525500 18:58209337-58209359 GAGGAGGAGGGGGCAGGAGGAGG - Intronic
1158525501 18:58209340-58209362 GAGGAGGAGGAGGGGGCAGGAGG - Intronic
1158559944 18:58505318-58505340 GAGGGTGCGGTTGGGGGAGGAGG - Intronic
1158610358 18:58935086-58935108 GAGGAGGAGGAGTGGGGAGGAGG - Intronic
1158610364 18:58935102-58935124 GAGGAGGAGGAGTGGGGAGGAGG - Intronic
1158610370 18:58935118-58935140 GAGGAGGAGGAGTGGGGAGGAGG - Intronic
1158610376 18:58935134-58935156 GAGGAGGAGGAGTGGGGAGGAGG - Intronic
1158610382 18:58935150-58935172 GAGGAGGAGGAGTGGGGAGGAGG - Intronic
1158610388 18:58935166-58935188 GAGGAGGAGGAGTGGGGAGGAGG - Intronic
1158610394 18:58935182-58935204 GAGGAGGAGGAGAGGGGAGGAGG - Intronic
1158610433 18:58935296-58935318 GAGGAGGAGTAAGGGGGAGGAGG - Intronic
1158843052 18:61409276-61409298 GGAGATGAGGATGCGGGGTGGGG - Intronic
1159079783 18:63724201-63724223 GAAGAAGAGGAAGAGGGAGGAGG - Intronic
1159580952 18:70234474-70234496 CAGGATGTGAATGGGGGAGGGGG - Intergenic
1159586658 18:70288986-70289008 GAGGAGGAGGAGGAAGGAGGCGG + Exonic
1159644520 18:70901593-70901615 GAGGGTGTGGTTGGGGGAGGTGG + Intergenic
1159684054 18:71394532-71394554 GAGGGTGAGGTGGTGGGAGGAGG - Intergenic
1160016084 18:75141759-75141781 GAGGATGAGGAAGCTCCAGGAGG - Intergenic
1160033409 18:75281366-75281388 GAGGAGGAGGGTGCTGGAGAGGG + Intronic
1160231358 18:77052043-77052065 GAGGATGAGGAGGCTGGAGAAGG + Intronic
1160335242 18:78032866-78032888 GAGGAAGAGGAGGAGGAAGGGGG - Intergenic
1160448624 18:78946971-78946993 GAGGAAGAGGAGGGAGGAGGAGG + Intergenic
1160448661 18:78947073-78947095 GAGGAAGAGGAAGGAGGAGGAGG + Intergenic
1160475122 18:79177191-79177213 GAGGAGGAGGAGGCGGAAGAGGG - Intronic
1160809425 19:1007057-1007079 GAGGATGTTGATGGGGAAGGAGG + Intronic
1160845195 19:1163191-1163213 TACAATGAGGATGCTGGAGGGGG + Intronic
1160845624 19:1164809-1164831 GAGGAGCAGGAGGAGGGAGGAGG + Intronic
1160905521 19:1450096-1450118 GCGGGGGAGGATGCGGGATGAGG - Intronic
1160965304 19:1744716-1744738 GGGGAAGAGGAGGAGGGAGGGGG - Intergenic
1160965736 19:1746201-1746223 GAGGAGGAGGAGGATGGAGGAGG + Intergenic
1160965769 19:1746291-1746313 AAGGGGGAGGATGGGGGAGGAGG + Intergenic
1160965800 19:1746372-1746394 GAGGAGGAGGAGGATGGAGGAGG + Intergenic
1160965801 19:1746375-1746397 GAGGAGGAGGATGGAGGAGGAGG + Intergenic
1161030747 19:2056747-2056769 GGGGAGGAGGAGGGGGGAGGAGG - Intergenic
1161509650 19:4663375-4663397 TAGAATGAGGATGGGGTAGGTGG - Intronic
1161607356 19:5222449-5222471 GAGGAGGAGGAAGAGGGGGGAGG + Intronic
1161684803 19:5697486-5697508 GAGGCTGAGGCAGAGGGAGGAGG + Intronic
1161794858 19:6380804-6380826 GGGGATGGAGATGCGGGTGGAGG - Intronic
1161837041 19:6654815-6654837 GAGGAGGAGGTGGCAGGAGGAGG - Intergenic
1161978172 19:7617517-7617539 GAGGGTGAGGCAGTGGGAGGGGG - Intronic
1161989038 19:7673504-7673526 AAGGATGAGGAGGAGGAAGGAGG - Intergenic
1162076581 19:8191949-8191971 GAGGAAGAGGAAGCAGAAGGAGG + Intronic
1162147292 19:8620636-8620658 GAAGATGAGGATGAGGCAGGAGG + Intergenic
1162184421 19:8893910-8893932 GATGATGATGATGGGGGTGGCGG - Intronic
1162339206 19:10081735-10081757 GAGAAGGAGGAGGAGGGAGGAGG + Intergenic
1162339211 19:10081751-10081773 GAGGAGGAGGAAGGAGGAGGAGG + Intergenic
1162349020 19:10137699-10137721 AAGGCTGAGGACTCGGGAGGAGG + Intronic
1162515102 19:11142859-11142881 GAGGATGGGGATGTGGCTGGTGG + Intronic
1162811690 19:13167916-13167938 CAGGATGAGGTGGCGGTAGGTGG + Intergenic
1162812490 19:13172661-13172683 GAGGAGGAGGAAGCAGGAGAGGG - Intergenic
1162833518 19:13301556-13301578 GAGGAGGAGAATGGGGGAAGAGG + Intronic
1162954700 19:14091319-14091341 GGCGCTGAGGATGCGGGAAGGGG + Intergenic
1163153017 19:15425802-15425824 GAGGAGGAGGAGGAGGGAGGAGG + Intronic
1163153018 19:15425805-15425827 GAGGAGGAGGAGGGAGGAGGAGG + Intronic
1163172774 19:15544034-15544056 GAGGGTGAGGATGTGGGGTGAGG + Exonic
1163276104 19:16285303-16285325 GAGGAGGAGGAAGAAGGAGGAGG + Intergenic
1163436918 19:17301423-17301445 GAGGATGCGGATGATGGTGGAGG + Exonic
1163452416 19:17386208-17386230 GAAAATGAGGCTGCGGGAAGGGG - Intergenic
1163495889 19:17646497-17646519 GAGGCTGAGGCTGAGGCAGGCGG - Intronic
1163545047 19:17936378-17936400 GAGGATGGGGATGGGGGAGCAGG - Intronic
1163553965 19:17982361-17982383 GAGGATGAGGGAGAGGGAGCTGG - Intronic
1163611545 19:18304432-18304454 GTGGAGGAGGATGGAGGAGGAGG + Intergenic
1163688506 19:18725659-18725681 GAGGCTCAGGAAGAGGGAGGAGG - Intronic
1163690906 19:18737760-18737782 GAGGAGGAGGAAAAGGGAGGAGG - Intronic
1163779764 19:19240101-19240123 AAGGATGGGGAGGAGGGAGGAGG - Intronic
1163849757 19:19656313-19656335 GAGGGTGAGGATCTGGGAGCTGG - Intronic
1164188310 19:22892758-22892780 GAGGAGGAGGAGGGGGGAGGGGG - Intergenic
1164400084 19:27896256-27896278 CTGGATGAGGATGTGGTAGGGGG + Intergenic
1164441374 19:28282864-28282886 GAAGAAGAGGATGGTGGAGGGGG - Intergenic
1164591895 19:29511979-29512001 GAGGATGAGGAGGAAGGAGGGGG + Intergenic
1164591901 19:29512022-29512044 GAGGATGAGGATGAAGGAGAGGG + Intergenic
1164591953 19:29512235-29512257 GAGGATGAGTAGGACGGAGGAGG + Intergenic
1164592029 19:29512505-29512527 AAGGATGAGGAGGAAGGAGGGGG + Intergenic
1164592053 19:29512586-29512608 GGGGATGAGGAGGAAGGAGGGGG + Intergenic
1164592090 19:29512734-29512756 GGGGATGAGGAGGAAGGAGGGGG + Intergenic
1164592306 19:29513528-29513550 GGGGATGAGGAGGAAGGAGGGGG + Intergenic
1164592352 19:29513691-29513713 GGGGATGAGGACGAAGGAGGGGG + Intergenic
1164592360 19:29513711-29513733 GGGGATGAGGAGGAAGGAGGGGG + Intergenic
1164592368 19:29513731-29513753 GGGGATGAGGAGGAAGGAGGGGG + Intergenic
1164592376 19:29513751-29513773 GGGGATGAGGAGGAAGGAGGGGG + Intergenic
1164592493 19:29514180-29514202 GGGGATGAGGAAGAAGGAGGAGG + Intergenic
1164592549 19:29514330-29514352 GGGGATGAGGAGGAAGGAGGGGG + Intergenic
1164592567 19:29514370-29514392 GGGGATGAGGAGGAAGGAGGGGG + Intergenic
1164592611 19:29514498-29514520 GGGGATGAGGAAGAAGGAGGGGG + Intergenic
1164592692 19:29514813-29514835 GAGGATGAGGAGGAAGGAGACGG + Intergenic
1164739456 19:30565685-30565707 GAAGGTGGGGATGTGGGAGGGGG - Intronic
1164757778 19:30703106-30703128 GAGGATGAGTTTGCAGGAGTTGG + Intronic
1164836612 19:31358945-31358967 GAGGATGGGGAGGAGGAAGGAGG - Intergenic
1164897936 19:31893593-31893615 GAGGAAGAAGAAGGGGGAGGAGG + Intergenic
1165063465 19:33216085-33216107 GAGGAGGAGGAGGCAGGAGGTGG + Intronic
1165416042 19:35694121-35694143 GAGGAAGAGGAAGAGGGAGGAGG - Intergenic
1165690889 19:37862388-37862410 GAGGAGGAGGAGGAAGGAGGAGG + Intergenic
1165690892 19:37862391-37862413 GAGGAGGAGGAAGGAGGAGGGGG + Intergenic
1166007329 19:39916522-39916544 GAGGGTGAGGACCCGGGAGGAGG - Intronic
1166213686 19:41322734-41322756 GGGGATGGGGATGGGGCAGGCGG - Exonic
1166361383 19:42254204-42254226 GAAGAGGTGGATCCGGGAGGGGG + Intronic
1166678887 19:44755672-44755694 GAGGCTGAGGCTGAGGCAGGAGG + Intronic
1166700219 19:44878041-44878063 GAGGAGGAGGAGGAGGGGGGTGG - Intronic
1167097134 19:47380513-47380535 TAGGAGGAGGAGGGGGGAGGTGG + Intronic
1167130488 19:47582168-47582190 GAAGAGGAGGAGGGGGGAGGAGG - Intergenic
1167130489 19:47582171-47582193 GAGGAAGAGGAGGAGGGGGGAGG - Intergenic
1167134496 19:47608843-47608865 GAGGAGGAGGAGGAGGAAGGGGG + Intronic
1167134500 19:47608849-47608871 GAGGAGGAGGAAGGGGGTGGGGG + Intronic
1167343991 19:48933834-48933856 GGGGAAGAGGAGGCGGGGGGCGG + Intronic
1167488291 19:49776203-49776225 GAGTCTGAGGATGCGGGCGGCGG - Intronic
1167566519 19:50260993-50261015 GATGATGAGGAAGCGGGGGTGGG - Intronic
1167607890 19:50491271-50491293 GAAGACGGGGACGCGGGAGGGGG + Intergenic
1167622037 19:50566075-50566097 GAGGAGGAGGAGGAGGAAGGTGG + Intronic
1167645498 19:50703174-50703196 CAGGAAGAGGATGGGGGGGGTGG - Intronic
1167646520 19:50708599-50708621 AAGGATGAGGATGGAGGATGTGG + Intronic
1167686511 19:50960048-50960070 GAGGGAGAGGAGGGGGGAGGAGG + Intronic
1167768325 19:51499038-51499060 AAGGCTGAGGCTGAGGGAGGGGG + Intronic
1167792043 19:51689182-51689204 GAGGAGGAGGGAGCGGGAGGGGG - Intergenic
1168063265 19:53906032-53906054 GAGGAGGAGGAGGGAGGAGGAGG - Intronic
1168063266 19:53906035-53906057 GAGGAGGAGGAGGAGGGAGGAGG - Intronic
1168069595 19:53942312-53942334 GAGGAGGAGGAGGAGGCAGGGGG - Exonic
1168072000 19:53958577-53958599 GGGGCTGGGGACGCGGGAGGGGG + Intergenic
1168251584 19:55145349-55145371 GTGGAGGAGGAGGAGGGAGGAGG + Intronic
1168251585 19:55145352-55145374 GAGGAGGAGGAGGGAGGAGGAGG + Intronic
1168258086 19:55178144-55178166 GAGGAGCAGGGTGCGGGAAGGGG + Intronic
1168288357 19:55345494-55345516 GAGGATGAGGATGCGGGAGGTGG + Intronic
1168357724 19:55712871-55712893 GAGGAGGAGGAGGGGGGAGGAGG + Intronic
1168510198 19:56967517-56967539 GAGGATGAGGAGGGAGGAGAAGG - Intergenic
924978861 2:202033-202055 GAGGAAGATGTTGCTGGAGGCGG - Intergenic
925009094 2:468449-468471 TTGCAGGAGGATGCGGGAGGCGG - Intergenic
925415905 2:3670000-3670022 GGGGATGAGGGCGCAGGAGGAGG + Intronic
925468818 2:4136482-4136504 GAGGCTGAGGATGCTGCAGCAGG + Intergenic
925595586 2:5552733-5552755 GAGGATGAAGGTGCAAGAGGTGG - Intergenic
925755361 2:7128035-7128057 GAGGAAGGGGAGGGGGGAGGGGG - Intergenic
925927614 2:8681732-8681754 GAGGGAGAGGAGGAGGGAGGAGG - Intronic
926266795 2:11330749-11330771 GAGGAGGAGGAGGGAGGAGGAGG + Intronic
926266821 2:11330824-11330846 GAGGGGGAGGAAGAGGGAGGAGG + Intronic
926266830 2:11330846-11330868 GAGGGGGAGGAAGAGGGAGGAGG + Intronic
926619465 2:15034027-15034049 GAGGAGGAGGAAGGAGGAGGAGG + Intergenic
927139121 2:20117955-20117977 GAGCAGGAGGATCCCGGAGGTGG + Intergenic
927187350 2:20491310-20491332 AAGGAGGAGGAGGAGGGAGGGGG - Intergenic
927384093 2:22513100-22513122 AAGTATGAGGATGAGGAAGGAGG + Intergenic
927810015 2:26175472-26175494 GAGGATGAGGGGGCGTGGGGAGG + Intronic
928085840 2:28345835-28345857 GAGGAGGGGGAGGCGGCAGGTGG - Intergenic
928826438 2:35427030-35427052 GAGAAGGAGGAGGCAGGAGGAGG + Intergenic
928988395 2:37204222-37204244 GAGGCTGAGGTTGGGGGTGGGGG - Exonic
929558465 2:42940302-42940324 GAGGATGAAGATGAGGATGGCGG + Intergenic
929670721 2:43875017-43875039 GATGATGAGGCTGTGGCAGGAGG - Intronic
929733862 2:44524570-44524592 GATGATGAAGATGAGGGAAGAGG - Intronic
929876574 2:45801505-45801527 GAGGGTGAGGGTGAGGGAGAGGG + Intronic
929876576 2:45801511-45801533 GAGGGTGAGGGAGAGGGAGGAGG + Intronic
930004291 2:46883546-46883568 GAGGAGGAGGATGCAGGAAGAGG + Intergenic
930374749 2:50551090-50551112 GAGGAGGAGGAGGAGGGAGGGGG + Intronic
930374753 2:50551096-50551118 GAGGAGGAGGGAGGGGGAGGGGG + Intronic
931177345 2:59867348-59867370 GAGGATGAGGCTGGGGGAAATGG + Intergenic
931179011 2:59881309-59881331 GAAGATGGGGGTGAGGGAGGAGG - Intergenic
931246061 2:60493845-60493867 GCTGATGAGGATGGGGGAGGGGG - Intronic
931348839 2:61470843-61470865 GAGCAAGAGAATGGGGGAGGGGG + Intergenic
931513151 2:63022294-63022316 GAGGAGGAGGAGGAGGAAGGAGG - Intronic
931671716 2:64653828-64653850 GCGGAGGAGGAAGCAGGAGGCGG + Exonic
931902760 2:66807553-66807575 GAGGAGGAGGAGGGGGAAGGAGG + Intergenic
931978656 2:67670594-67670616 AAGGATGGGGATAAGGGAGGGGG + Intergenic
932208163 2:69902292-69902314 GAGGAGGAGGAAGAAGGAGGAGG - Intronic
932396488 2:71452504-71452526 GAGGAAGAGGAAGAGGAAGGGGG - Intergenic
932434933 2:71697553-71697575 GGGGATGGGGATGCGGGTGGGGG + Intergenic
932498716 2:72161231-72161253 CAAGTTGAGGATGAGGGAGGCGG - Intergenic
932597317 2:73102056-73102078 CAGGATGAGGGTGCGGGATGTGG + Intronic
933253135 2:80050807-80050829 GAGGATGAAGCTGAGGCAGGAGG - Intronic
933481377 2:82861236-82861258 GATGATGAGGAAGAAGGAGGAGG - Intergenic
933770119 2:85738373-85738395 GAGGATGAGGACAAGCGAGGGGG - Intergenic
934653202 2:96104074-96104096 GAGGAGGAGGAGGAGGAAGGGGG - Intergenic
934653220 2:96104128-96104150 GAGGAGGAGGAGGGGGTAGGAGG - Intergenic
934653254 2:96104206-96104228 GAGGGAGGGGATGGGGGAGGAGG - Intergenic
934851198 2:97702322-97702344 TAGGAAGAGGATGCTGGAGGTGG - Intergenic
934854208 2:97718851-97718873 AAGCATGAGGATGCAGGATGAGG - Intronic
934934489 2:98454743-98454765 GAGGAGAAGGATGTGGGCGGGGG + Intronic
935103335 2:100017038-100017060 GATGATGACGATGCTGGTGGTGG + Intronic
935463057 2:103361897-103361919 GAGGAGGCGGAGGCGGGAGAGGG - Intergenic
935463063 2:103361913-103361935 GAGGAGGCGGAGGCGGGAGGAGG - Intergenic
935463069 2:103361929-103361951 GAGGAGGCGGAGGCGGGAGGAGG - Intergenic
935531667 2:104240368-104240390 GAGGATGAGGAGGAGGGAGGAGG + Intergenic
935531681 2:104240410-104240432 GAGGAGGACGAGGAGGGAGGAGG + Intergenic
935531682 2:104240413-104240435 GAGGACGAGGAGGGAGGAGGAGG + Intergenic
935592490 2:104855393-104855415 GGGGGGGAGGAGGCGGGAGGCGG + Intergenic
935592761 2:104856335-104856357 GCGGGTGAGGATGCGCGTGGTGG - Exonic
935622806 2:105144053-105144075 GAGGATGGGGGACCGGGAGGAGG - Intergenic
935663882 2:105493673-105493695 GAGGATGAGGCTGAGAGAGGAGG + Intergenic
936379407 2:111970745-111970767 GAGGAGGAGGAGAAGGGAGGAGG - Intronic
936379412 2:111970761-111970783 GAGGAGGAGGAGGGAGGAGGAGG - Intronic
936379413 2:111970764-111970786 GAGGAGGAGGAGGAGGGAGGAGG - Intronic
936379418 2:111970777-111970799 GAGGAGGAGGAGGGAGGAGGAGG - Intronic
936379419 2:111970780-111970802 GGGGAGGAGGAGGAGGGAGGAGG - Intronic
936379424 2:111970793-111970815 GAGGAGGAGGAGGGGGGAGGAGG - Intronic
936379425 2:111970796-111970818 GAGGAGGAGGAGGAGGGGGGAGG - Intronic
936379437 2:111970822-111970844 GAGGAGAAGGAGGAGGGAGGAGG - Intronic
936495573 2:113017781-113017803 GAGGAGGAGGAGGAGGGAGAAGG + Intergenic
936962268 2:118088483-118088505 GAGGAGGAAGAGGCGGTAGGGGG + Exonic
937217324 2:120321150-120321172 GAGGAGGAGGAGGAGGGAGAAGG - Intergenic
937217328 2:120321163-120321185 GAGGAGGAGGAGGGAGGAGGAGG - Intergenic
937217329 2:120321166-120321188 GAGGAGGAGGAGGAGGGAGGAGG - Intergenic
937217334 2:120321179-120321201 GAGGAGGAGGAGGGAGGAGGAGG - Intergenic
937217335 2:120321182-120321204 GAGGAGGAGGAGGAGGGAGGAGG - Intergenic
937217340 2:120321195-120321217 GAGGAGGAGGAGGGAGGAGGAGG - Intergenic
937217341 2:120321198-120321220 GAGGAGGAGGAGGAGGGAGGAGG - Intergenic
937217346 2:120321211-120321233 GAGGAGGAGGAGGGAGGAGGAGG - Intergenic
937217351 2:120321224-120321246 GAGGAGGAGGAGGGAGGAGGAGG - Intergenic
937217352 2:120321227-120321249 GAGGAGGAGGAGGAGGGAGGAGG - Intergenic
937217357 2:120321240-120321262 GAGGAGGAGGAGGGAGGAGGAGG - Intergenic
937217358 2:120321243-120321265 GAGGAGGAGGAGGAGGGAGGAGG - Intergenic
937217363 2:120321256-120321278 GAGGAGGAGGAGGGAGGAGGAGG - Intergenic
937217364 2:120321259-120321281 GAGGAGGAGGAGGAGGGAGGAGG - Intergenic
937217369 2:120321272-120321294 GAGGAGGAGGAGGGAGGAGGAGG - Intergenic
937217370 2:120321275-120321297 GAGGAGGAGGAGGAGGGAGGAGG - Intergenic
937217376 2:120321291-120321313 GAGAAGGAGGAGGAGGGAGGAGG - Intergenic
937217704 2:120323308-120323330 GAGGAGGAGGAGGAGGGGGGAGG - Intergenic
937623561 2:124017978-124018000 GAGGCAGAGGTTGCAGGAGGTGG - Intergenic
937818077 2:126275641-126275663 GAGGATGGTGATGCAGGACGTGG - Intergenic
937882071 2:126875882-126875904 GAGTGTGAAGATGAGGGAGGAGG + Intergenic
937883785 2:126886688-126886710 GCGGGTGAGGAAGCGGGTGGAGG - Intergenic
937969487 2:127538142-127538164 GAGGATGAGGGTGGGGAACGGGG + Intronic
938000047 2:127726385-127726407 GAGGAGGATGAGGAGGGAGGTGG - Intronic
938016917 2:127874871-127874893 GAGAATGAGGGGGCTGGAGGAGG - Intronic
938059015 2:128237915-128237937 GAGGCTGAGGCTGAGGCAGGTGG - Intronic
938092429 2:128442195-128442217 GAGGCTGAGGCTGGGGGTGGGGG + Intergenic
939075407 2:137596709-137596731 GAGGAAGAGGAGGGGGGAGGAGG - Intronic
939454594 2:142418009-142418031 GACGATGGGGAGGAGGGAGGGGG - Intergenic
939644365 2:144678622-144678644 CAGGATGAGGAGGTGTGAGGGGG - Intergenic
940252388 2:151693415-151693437 GAGGCTGGGGGTGGGGGAGGCGG - Intronic
940274747 2:151927507-151927529 GAGACTGAGGATGGGGGAAGAGG + Intronic
940353052 2:152709933-152709955 GAGGATGAGGTTGCAGTAAGTGG + Intronic
940453730 2:153871860-153871882 GAGGAGGAGGGACCGGGAGGCGG + Intergenic
940479746 2:154213184-154213206 GAGGCTGAGGTTGGGGGTGGAGG - Intronic
940696376 2:156984669-156984691 GAGGAGGAGGAGGAGGAAGGAGG + Intergenic
940696392 2:156984700-156984722 GAGGACGTGGAGGGGGGAGGGGG + Intergenic
940852206 2:158699159-158699181 GAGGAGGAGGAGGAGGAAGGAGG + Intergenic
940852209 2:158699162-158699184 GAGGAGGAGGAGGAAGGAGGGGG + Intergenic
941038209 2:160590555-160590577 GGGGAAGAGGAAGGGGGAGGGGG - Intergenic
941169642 2:162120862-162120884 GGGAATGAGGATGGGGGAGGAGG + Intergenic
941180479 2:162253661-162253683 GAGGATGAGTCTGGAGGAGGAGG - Intergenic
941515522 2:166471130-166471152 GAGGATGAGGATGAGGATGATGG + Intronic
941591132 2:167422067-167422089 GAGGAGGAGGATGAGGGAGAGGG + Intergenic
942199449 2:173556362-173556384 GAGGAGGAGGAAGGGGGAGGAGG - Intergenic
942241272 2:173965242-173965264 GCGGGAGAGGATGCGGGAAGCGG + Exonic
942418812 2:175786487-175786509 GAGGCAGAGGATGGAGGAGGAGG + Intergenic
942524807 2:176841802-176841824 GAGGAGGAGGAGGAAGGAGGAGG - Intergenic
942524808 2:176841805-176841827 GAGGAGGAGGAGGAGGAAGGAGG - Intergenic
942996267 2:182264022-182264044 GAGACTGAGGATGGGGGAAGAGG + Intronic
943570381 2:189566775-189566797 GAAAGTGAGGATGGGGGAGGAGG + Intronic
943890248 2:193277257-193277279 GAGGAAGGGGAGGGGGGAGGAGG - Intergenic
944093652 2:195942464-195942486 GAGGAAGAGGAGGAGGAAGGAGG + Intronic
944194500 2:197038214-197038236 GAGGATGATGATAATGGAGGAGG + Intronic
944204348 2:197141817-197141839 GAGGAAGAGGATGAGGAAGCTGG - Intronic
944205444 2:197153273-197153295 GAGGAAGAGGAAGAAGGAGGAGG + Intronic
944290280 2:197996976-197996998 GAGGGTGAGGTGGCGGGAGAGGG + Intronic
945137316 2:206642289-206642311 GAAGAGGAGGGTGCGGGAGACGG + Intergenic
945175741 2:207041528-207041550 ACTGATGAGGATGGGGGAGGGGG - Intergenic
945590912 2:211730441-211730463 GAGGAAGGAGATGGGGGAGGAGG - Intronic
945714368 2:213338869-213338891 GAGTATGTGGTTGGGGGAGGTGG + Intronic
945987528 2:216367309-216367331 AAGGAGGAGGAGGAGGGAGGGGG - Intronic
946040674 2:216780727-216780749 GATGGTGAGGATGTGGAAGGAGG + Intergenic
946069328 2:217017965-217017987 GAAGATGAGGTTGAGAGAGGGGG + Intergenic
946332217 2:219016872-219016894 GAGGCTGAGGAGGCGGGCAGGGG - Intronic
946334757 2:219029366-219029388 GGGCATGAGGCTGAGGGAGGAGG - Intronic
946336508 2:219040861-219040883 GAGGCTGAGGCTCCGGGAGATGG - Intronic
946395706 2:219442706-219442728 GAAGATGGGGATGCGGGGGGCGG - Intronic
946408958 2:219507131-219507153 GAGGCTGAGGCAGTGGGAGGGGG - Intergenic
946412408 2:219521937-219521959 GAGGATGGGAAGGCAGGAGGAGG + Intronic
946431691 2:219629813-219629835 GAGGAGCAGGGTGTGGGAGGGGG + Intronic
946692599 2:222320236-222320258 GGGGACGGGGAGGCGGGAGGGGG - Intergenic
947119371 2:226799655-226799677 GAGGAGGAGGAGGAGGGAGGAGG - Exonic
947382938 2:229563010-229563032 GAGGATGATGATGATGGTGGTGG - Intronic
947383073 2:229563841-229563863 GAGGATGATGATGACGGTGGTGG - Intronic
947533681 2:230928016-230928038 AGGGAGGAGGATGCTGGAGGAGG + Intronic
947606363 2:231488587-231488609 TAGGGTGAGTATGCGGGAGCAGG + Intergenic
947744077 2:232498636-232498658 GATGATGATGATGATGGAGGTGG - Intergenic
947760946 2:232603414-232603436 GAGGAGGAGGAGGTGGAAGGAGG + Intergenic
947817457 2:233047794-233047816 CTGGAGGAGGAGGCGGGAGGAGG + Intergenic
948091822 2:235301850-235301872 GAGGAGGAGGAAGAAGGAGGAGG - Intergenic
948091852 2:235301943-235301965 GAGGATGAGGAGGGAGCAGGAGG - Intergenic
948091857 2:235301962-235301984 GAGGAGGATGAGGAGGGAGGAGG - Intergenic
948091918 2:235302139-235302161 GAGGAAGAAGAGGAGGGAGGAGG - Intergenic
948122687 2:235543076-235543098 GAGGGGGAGGAGGCGGGAGCAGG - Intronic
948430163 2:237913635-237913657 GAGGGCGAGGAGACGGGAGGTGG + Intergenic
948447131 2:238041409-238041431 GAGCATGAGGACGGGAGAGGGGG - Exonic
948458828 2:238119477-238119499 GAGGAGGTGGATGGAGGAGGTGG + Intronic
948458832 2:238119490-238119512 GAGGAGGTGGATGGAGGAGGTGG + Intronic
948458846 2:238119530-238119552 GAGGAGGTGGATGGAGGAGGTGG + Intronic
948458857 2:238119571-238119593 GAGGAGGTGGATGGAGGAGGTGG + Intronic
948538966 2:238672214-238672236 GAGAAGGAGGAGGGGGGAGGAGG - Intergenic
948558550 2:238835222-238835244 GAGGAGGAGGAGGAGGGAGGGGG - Intergenic
948819190 2:240529965-240529987 GAGGAGGAGGAAGAGGAAGGAGG + Intronic
949032249 2:241802643-241802665 GAGGAGGAGGGGCCGGGAGGAGG + Intronic
1168792721 20:590716-590738 GAGGAGGAGGATGCAGGTGAAGG - Intergenic
1169026983 20:2379936-2379958 GAGGAAGGGGAAGTGGGAGGGGG - Intergenic
1169211673 20:3769159-3769181 GAGGCGGAGGAGGCAGGAGGGGG - Intergenic
1169214410 20:3785174-3785196 GAGGAGGAGGAGGAGGAAGGGGG - Exonic
1169765575 20:9144664-9144686 GAGGAGGAGGAGGGGGAAGGAGG + Intronic
1169988395 20:11472466-11472488 AAGGATGAGGATGGAGAAGGGGG - Intergenic
1170030177 20:11936075-11936097 GGGGATGAAGATGCAGGAAGTGG - Intergenic
1170562442 20:17569511-17569533 GAGGAGGGGGATGTGGGGGGAGG - Intergenic
1171074693 20:22110642-22110664 GAGGAAGAGGAGGAGGGAGAGGG - Intergenic
1171123645 20:22584631-22584653 GAGGAGGAGGAGGAAGGAGGAGG + Intronic
1171123646 20:22584634-22584656 GAGGAGGAGGAAGGAGGAGGAGG + Intronic
1171233753 20:23508301-23508323 GAGCTAGAGGATGCTGGAGGCGG - Intergenic
1172744859 20:37198928-37198950 GGGGATGAGCATGTGCGAGGCGG + Intronic
1172792714 20:37517249-37517271 GATGGTGGGGATGGGGGAGGGGG - Intronic
1173106972 20:40146094-40146116 GAGGAGGAGGAGGGAGGAGGAGG - Intergenic
1173106973 20:40146097-40146119 GAGGAGGAGGAGGAGGGAGGAGG - Intergenic
1173112259 20:40203002-40203024 GAGGATGAAGAAGGAGGAGGAGG + Intergenic
1173344282 20:42184496-42184518 GAGGAGGAGGAGGAGGAAGGGGG - Intronic
1173428255 20:42961633-42961655 AAGGAAGAGCATGTGGGAGGGGG + Intronic
1173572713 20:44087843-44087865 GAAGTTGAGGCTGCGTGAGGTGG - Intergenic
1173689976 20:44953107-44953129 AAGGATGAAGATGTGGGAGAGGG - Intronic
1173728548 20:45313272-45313294 GAGGGTTAGGGTGAGGGAGGGGG - Intronic
1174067337 20:47875046-47875068 GAGGATGGGGTTGGGGGTGGGGG + Intergenic
1174174689 20:48637369-48637391 GGGGAAGAGGAAGGGGGAGGAGG - Intronic
1174308412 20:49631637-49631659 GAGGATGAGTGAGCAGGAGGAGG - Intergenic
1174570953 20:51500828-51500850 GAGGGTGAGGGTGGGGGTGGGGG - Intronic
1174590558 20:51641429-51641451 GAGGATCACGATCTGGGAGGTGG + Intronic
1174724873 20:52851129-52851151 GAGGATGATCATGGGGGTGGAGG - Intergenic
1174898562 20:54475564-54475586 GAGGAGGAGGAAGGAGGAGGAGG - Intergenic
1174898563 20:54475567-54475589 GAGGAGGAGGAGGAAGGAGGAGG - Intergenic
1174898564 20:54475570-54475592 GAGGAGGAGGAGGAGGAAGGAGG - Intergenic
1174960494 20:55151663-55151685 AAGGAGGAGGAGGCGGAAGGAGG - Intergenic
1175293174 20:57891624-57891646 GAGGAGGAGGGCGTGGGAGGGGG + Intergenic
1175309947 20:58004935-58004957 GATAATGAGCAAGCGGGAGGTGG + Intergenic
1175831006 20:61965636-61965658 GAGGCTGGGGAGGCGGGACGCGG - Intronic
1175891473 20:62317888-62317910 GGGGGTGAGGAGGGGGGAGGAGG + Intronic
1175962765 20:62645487-62645509 GAGGGTGAGGGTGCGGGTGTGGG - Intronic
1175962767 20:62645493-62645515 GAGGATGAGGGTGAGGGTGCGGG - Intronic
1176166371 20:63676153-63676175 GAGGTGGAGGCTGCAGGAGGTGG - Intronic
1176409124 21:6438251-6438273 GAGGGTGAGGATGGGGGTGCAGG - Intergenic
1176933601 21:14842134-14842156 GCGGATGAGCATGCTGGCGGAGG - Intergenic
1176961700 21:15166133-15166155 GAGAATGAGGTTGCTGGCGGAGG - Intergenic
1177656952 21:24029637-24029659 GAGGAAGATGATGAGGCAGGAGG - Intergenic
1178434739 21:32548071-32548093 AAGGATGAGGGAGCGGGAGGGGG - Intergenic
1178505255 21:33157398-33157420 GAGGAGGAGAAAGAGGGAGGAGG - Intergenic
1178505260 21:33157417-33157439 GAGGAGGAGAAAGAGGGAGGAGG - Intergenic
1178505265 21:33157436-33157458 GAGGAGGAGAAAGAGGGAGGAGG - Intergenic
1178675105 21:34624025-34624047 GAGTGTGAGGATGAGGAAGGTGG + Intergenic
1178858458 21:36269764-36269786 GAGGCTGAGGCTGAGGCAGGGGG - Intronic
1179133681 21:38661028-38661050 GAGGAAGAGGAGGAGGGAGGCGG + Intronic
1179211564 21:39329142-39329164 GAGGATGAAGAAGTGGGAAGAGG + Intergenic
1179269918 21:39842831-39842853 AAGGATGAGGATGAGCGATGGGG - Intergenic
1179333808 21:40431288-40431310 GAGGAGGAGGAAGGGGGAGAAGG - Intronic
1179408155 21:41142318-41142340 GAGGATGAGTGTGTGGCAGGAGG - Intergenic
1179416034 21:41199413-41199435 GATGCTGAGGATGCTGCAGGGGG + Intronic
1179488589 21:41726509-41726531 GAGGAAGAGGAGGAGGAAGGAGG - Intergenic
1180071200 21:45436651-45436673 GGGGCTGAGGCTGGGGGAGGGGG + Intronic
1180666088 22:17513624-17513646 GAGGAAGAGGATACTGGAGAAGG - Intronic
1180765491 22:18343906-18343928 GAGGATGAAGATGCAGGCTGGGG - Intergenic
1180780825 22:18518486-18518508 GAGGATGAAGATGCAGGCTGGGG + Intergenic
1180813538 22:18775793-18775815 GAGGATGAAGATGCAGGCTGGGG + Intergenic
1180843998 22:18971713-18971735 GAGCATGTGGGTGCGGGAGTGGG - Intergenic
1180948726 22:19710824-19710846 GAGGCTGAGGATGAGGGAAGAGG - Intergenic
1180983109 22:19888630-19888652 GAGGACGAGGGTGTGGGAGTGGG + Intronic
1181199722 22:21210123-21210145 GAGGATGAAGATGCAGGCTGGGG + Intronic
1181313539 22:21958125-21958147 GAGGACGAGGATGAGGATGGAGG + Intronic
1181346648 22:22224197-22224219 GAGGACGAGGATGAGGATGGAGG + Intergenic
1181400039 22:22645735-22645757 GAGGATGAAGATGCAGGCTGGGG - Intronic
1181410412 22:22714317-22714339 GAGGATGTGGAGGGTGGAGGTGG - Intergenic
1181649325 22:24250055-24250077 GAGGATGAAGATGCAGGCTGGGG + Intergenic
1181702013 22:24626833-24626855 GAGGATGAAGATGCAGGCTGGGG - Intronic
1181768924 22:25111764-25111786 GGGGATGGGGATGGGGGTGGGGG - Intronic
1181786328 22:25229879-25229901 GAGGATTAGGTTGAGGCAGGAGG + Intronic
1181818499 22:25457702-25457724 GAGGATTAGGTTGAGGCAGGAGG + Intergenic
1181886072 22:26023470-26023492 GAGGAGGAGGAGGAGGGAGGAGG - Intronic
1181886085 22:26023508-26023530 GAGGAAGAGGAGGAGGGAGGAGG - Intronic
1181977238 22:26738544-26738566 GAAGAGGAGGAGGAGGGAGGGGG - Intergenic
1182009012 22:26984884-26984906 GAGGATCAGTAGGCTGGAGGGGG + Intergenic
1182198408 22:28543408-28543430 GAAGATGAAGAAGAGGGAGGAGG + Intronic
1182285590 22:29245165-29245187 GAGGATGGGTATGGGGTAGGAGG - Intronic
1182352449 22:29706521-29706543 GAGAAGGAGGAAGAGGGAGGCGG + Intergenic
1182755880 22:32678543-32678565 GAGGAGGAGGATGAAGGAGGAGG - Intronic
1182755883 22:32678556-32678578 GAGGAGGAGGAAGGAGGAGGAGG - Intronic
1182931469 22:34178289-34178311 GAGGGGGAGGAGGAGGGAGGAGG - Intergenic
1182931473 22:34178299-34178321 GAGGAGGAGGGAGGGGGAGGAGG - Intergenic
1182931475 22:34178305-34178327 AAGGAGGAGGAGGAGGGAGGGGG - Intergenic
1183132902 22:35856672-35856694 AAGGATGAGGATGGGACAGGGGG + Intronic
1183272797 22:36872523-36872545 GAGGATGAAGGTGAGGGTGGAGG + Intronic
1183273217 22:36874872-36874894 GAGGAAGAGGATGAGGGGTGAGG - Intronic
1183305109 22:37078691-37078713 GAGGAAGAGGAAGAGGAAGGAGG + Intronic
1183305111 22:37078697-37078719 GAGGAAGAGGAAGGAGGAGGCGG + Intronic
1183385434 22:37511463-37511485 GAGAAGGAGGAGGCGGGAGGAGG + Intronic
1183600176 22:38835487-38835509 GAGGATGAGGAAGAGGGAGCAGG + Intronic
1183816222 22:40303098-40303120 GAGGTGGAGGTTGTGGGAGGTGG - Intronic
1184123270 22:42467963-42467985 GAAGATGAGCATGCGGGTGGTGG + Intergenic
1184135942 22:42549958-42549980 GAAGATGAGGATGGGGGCGGGGG + Intergenic
1184178077 22:42801130-42801152 GAGCATGAGGAGGCGGCAGTGGG + Intronic
1184182916 22:42843102-42843124 GAGGCTGAGGATGCAGGAGCGGG - Intronic
1184449795 22:44576083-44576105 GAGGAAGAGGAGGAGGGAGGAGG + Intergenic
1184449801 22:44576102-44576124 GAGGTAGAGGAGGAGGGAGGAGG + Intergenic
1184455430 22:44607274-44607296 GAGGATGGGGATGGAGGAGGAGG + Intergenic
1184621450 22:45681835-45681857 GAGAGTGAGGATGAGGGAGATGG - Intronic
1184639822 22:45864643-45864665 GGGGATGAGGAAGCAGGAGGCGG - Intergenic
1185089348 22:48757140-48757162 AAGGAGGAGGAGGAGGGAGGAGG + Intronic
1185089349 22:48757143-48757165 GAGGAGGAGGAGGGAGGAGGAGG + Intronic
1185348521 22:50321234-50321256 GAGGGTGAAGATGAGAGAGGAGG - Intronic
1185398205 22:50603346-50603368 GAGGAGGAGGAGGAGGGAGATGG + Exonic
1203227113 22_KI270731v1_random:84796-84818 GAGGATGAAGATGCAGGCTGGGG - Intergenic
1203263638 22_KI270734v1_random:1475-1497 GAGGATGAAGATGCAGGCTGGGG + Intergenic
949250090 3:1973161-1973183 GAGGGAGAGGAGGAGGGAGGGGG + Intergenic
949549855 3:5104036-5104058 GAGGAGGGGGAGGAGGGAGGAGG - Intergenic
949713966 3:6906344-6906366 AGGGATGAGGTTGCAGGAGGGGG + Intronic
950009167 3:9710456-9710478 GAGAATGAGGATGGGGGAGGAGG + Intronic
950130053 3:10536463-10536485 GAGGAGGAGGAGGAGGAAGGAGG - Intronic
950222496 3:11206907-11206929 GAGGAGGGGGAAGCTGGAGGAGG + Intronic
950386420 3:12663883-12663905 GCGGGTGAGGGAGCGGGAGGCGG + Exonic
950715698 3:14846267-14846289 GAGGATGGGGCTGAGGGAGGAGG + Intronic
950825057 3:15809962-15809984 GTGGATGAGGAGGTGGGAGGGGG - Intronic
950829358 3:15859420-15859442 GAGGAGGAGGAGGCTGGAGTGGG - Exonic
951217823 3:20040844-20040866 GCGGAGGTGGAAGCGGGAGGGGG - Intronic
951426460 3:22551984-22552006 GAGGATGAGGATGGAGGATGAGG + Intergenic
951524452 3:23640243-23640265 GAGGGTAAGGAAGCAGGAGGTGG + Intergenic
951556543 3:23926406-23926428 GAGGAGGAGGAAGGAGGAGGAGG - Intronic
951556544 3:23926409-23926431 GAGGAGGAGGAGGAAGGAGGAGG - Intronic
951771161 3:26259104-26259126 GAGAATGTGGAAGCGGGTGGTGG - Intergenic
951955616 3:28249954-28249976 GAAGAGGAGGTTGAGGGAGGAGG + Intronic
952215319 3:31272325-31272347 AAGGAGGAGGATGGAGGAGGAGG + Intergenic
952430457 3:33218667-33218689 GATGGTGAGTGTGCGGGAGGCGG - Exonic
952646658 3:35667895-35667917 GAGGAAGAGGAAGAGGAAGGAGG + Intronic
952646660 3:35667901-35667923 GAGGAAGAGGAAGGAGGAGGAGG + Intronic
952700091 3:36318533-36318555 GAGGAGGAGGAGGAGGAAGGGGG - Intergenic
953019087 3:39102779-39102801 GACCATGAGGGTGCGCGAGGTGG - Exonic
953140014 3:40220799-40220821 GAGGAAGAGAGTGAGGGAGGAGG + Intronic
953230241 3:41058303-41058325 AAGGAGGAGGAGGAGGGAGGAGG + Intergenic
953230242 3:41058306-41058328 GAGGAGGAGGAGGGAGGAGGAGG + Intergenic
953230252 3:41058334-41058356 GAGGAGGAGGAGGAGGGAGGAGG + Intergenic
953230253 3:41058337-41058359 GAGGAGGAGGAGGGAGGAGGAGG + Intergenic
953230261 3:41058365-41058387 GAGGAGGAGGAAGAGGAAGGAGG + Intergenic
953431776 3:42845988-42846010 GAGGCTGAGGGTGGGGGTGGAGG + Intronic
953490256 3:43344197-43344219 GAGGAGGAGGAGGAGAGAGGGGG - Intronic
953499987 3:43424028-43424050 GAGGATGATGAGGGAGGAGGAGG - Intronic
953871293 3:46629701-46629723 GAGGAGGAGAATGGAGGAGGAGG + Intergenic
953923935 3:46971160-46971182 GAGGATGGGGAAGTGGGAGAAGG - Intronic
954091499 3:48287915-48287937 GAGAGTGAGGAAGGGGGAGGAGG + Intronic
954121846 3:48504235-48504257 CAGGAGGAGGAGGAGGGAGGAGG + Exonic
954121847 3:48504238-48504260 GAGGAGGAGGAGGGAGGAGGAGG + Exonic
954707224 3:52487476-52487498 GTGGAGGAGGAGGAGGGAGGAGG + Exonic
954813463 3:53262391-53262413 GAGGAGGAGGAAGAGGGAAGAGG - Intergenic
955283462 3:57616357-57616379 GAGGAGGAGGAGGAGGCAGGGGG + Intergenic
955758989 3:62257853-62257875 GAGGCTGAGGCTGAGGCAGGAGG + Intronic
955940984 3:64146955-64146977 GAGGAAGAGGAAGAGGAAGGGGG - Exonic
956198795 3:66683918-66683940 GAGGAGGAGGAAGAAGGAGGGGG - Intergenic
956198800 3:66683931-66683953 GAGGAGGAGGAGGGAGGAGGAGG - Intergenic
956198801 3:66683934-66683956 AAGGAGGAGGAGGAGGGAGGAGG - Intergenic
956234839 3:67058322-67058344 GAAGATTAGCATGAGGGAGGGGG - Intergenic
956753397 3:72362925-72362947 GAGGAAGAGAATGAAGGAGGAGG - Intergenic
956836895 3:73102949-73102971 GTGGATGAGGATGGGTGAGATGG + Intergenic
956846532 3:73188819-73188841 GAGGAGGAGGAAGAAGGAGGGGG - Intergenic
957501708 3:81066515-81066537 GAGGAGGAAGAGGAGGGAGGAGG - Intergenic
957762638 3:84578162-84578184 GAGGAAGAGGAAGGAGGAGGAGG + Intergenic
958805867 3:98809377-98809399 GAGGCTGAAGATACAGGAGGGGG + Intronic
959408218 3:105987701-105987723 AAGGGTGAGGATGCGGGGTGGGG - Intergenic
959531790 3:107441575-107441597 GAGAGTGAGGATGGTGGAGGAGG + Intergenic
960176494 3:114523783-114523805 GAGCGTAAGGATGGGGGAGGAGG + Intronic
960350377 3:116585724-116585746 GAGGAGGAGGCTGGGAGAGGAGG + Intronic
960443739 3:117721605-117721627 GAGACTGAGGATGAGGGAGATGG + Intergenic
960836437 3:121911453-121911475 GAGGAGGAGGAGGAGGGAGGAGG - Intronic
961055649 3:123786516-123786538 GAGGGTGGGGGTGGGGGAGGAGG + Intronic
961236264 3:125370950-125370972 GAGGATGAGGATGAGGAACAGGG - Intronic
961447933 3:126989808-126989830 GGGGATGGGGCCGCGGGAGGAGG - Intronic
961485482 3:127212913-127212935 GAGGATGAGGATGCTGTAGGGGG - Intergenic
961870936 3:129987714-129987736 GTGGTTGAGGAGGTGGGAGGTGG - Intergenic
962742759 3:138374202-138374224 GAGGCTGAGGCTGAGGCAGGCGG - Intronic
962769700 3:138600929-138600951 GAGGAGGAGAAGGAGGGAGGAGG + Intergenic
963600954 3:147378440-147378462 GAGGAGGAGGATGGGGGAGAGGG + Intergenic
963605607 3:147409983-147410005 GAAGAAGAGGAGGAGGGAGGGGG - Exonic
963796474 3:149635596-149635618 GAGGAAGCGGAAGAGGGAGGAGG + Intronic
964170924 3:153768590-153768612 TAGGATGGGGATGTGGGAGCCGG + Intergenic
964374399 3:156035402-156035424 AAGGAGGAGGAGGAGGGAGGAGG - Intergenic
964374434 3:156035595-156035617 GAGGAGGAGGAAGCAGGAGGGGG - Intergenic
964671363 3:159229754-159229776 GGGGAGGAGGAGGGGGGAGGAGG - Intronic
964671377 3:159229782-159229804 GGGGAGGAGGATGGGAGAGGAGG - Intronic
964708599 3:159647319-159647341 GAGCATGGGGAGGTGGGAGGAGG + Intronic
965736790 3:171829152-171829174 TAGGATGGGGAGGCAGGAGGAGG + Intergenic
965831009 3:172789304-172789326 GAGGATGAGGTGGGAGGAGGTGG - Intronic
966022458 3:175232147-175232169 GAGGAAGAAGAAGGGGGAGGAGG + Intronic
966686262 3:182698921-182698943 GAGGCTGAGGACCCAGGAGGTGG + Intergenic
966754227 3:183353593-183353615 GAGGAAGAGAGTGAGGGAGGAGG + Intronic
966908579 3:184544771-184544793 GAGGAGGAGGAGGGGGGAGGAGG - Intronic
967332836 3:188309089-188309111 GAGGCAGAGGATGCAGGAGCAGG - Intronic
968088818 3:195886942-195886964 GTGGGTGAGGAGGTGGGAGGGGG - Intronic
968174578 3:196538243-196538265 GAGGAGGAGGAAGAAGGAGGAGG - Intergenic
968293295 3:197555253-197555275 GAGGAGGAGGAGGAGGGACGCGG + Intronic
968434095 4:576157-576179 GAGGATGAGGAGGAGGCCGGCGG - Intergenic
968543133 4:1178398-1178420 GAAGATGAGGGAGGGGGAGGGGG - Intronic
968543137 4:1178404-1178426 GAGTCTGAAGATGAGGGAGGGGG - Intronic
968577644 4:1375413-1375435 GAGGACGAGGATGGACGAGGAGG + Exonic
968889285 4:3359169-3359191 GAGGAGGGGGAGGAGGGAGGAGG - Intronic
968952044 4:3700306-3700328 GAGGGGGAGGAAGTGGGAGGAGG + Intergenic
969104365 4:4793863-4793885 GATGATGATGATGATGGAGGTGG + Intergenic
969428967 4:7142110-7142132 GAGGATGAAGATGAGGCAGGTGG - Intergenic
969454843 4:7295027-7295049 GAGGGAGAGGAGGGGGGAGGAGG - Intronic
969467546 4:7366544-7366566 GCTGATGAGGATGGAGGAGGGGG - Intronic
969511383 4:7620008-7620030 GAGGAGGAGGAAGGAGGAGGAGG - Intronic
969511384 4:7620011-7620033 GAGGAGGAGGAGGAAGGAGGAGG - Intronic
969511388 4:7620024-7620046 GAGGAGGAGGAAGGAGGAGGAGG - Intronic
969511389 4:7620027-7620049 GAGGAGGAGGAGGAAGGAGGAGG - Intronic
969511393 4:7620040-7620062 GAGGAAGAGGAAGGAGGAGGAGG - Intronic
969533384 4:7741500-7741522 GAGGAGGGGGAGGAGGGAGGAGG - Exonic
969618720 4:8268396-8268418 GAGGATGAGGTGGGAGGAGGCGG - Intergenic
969671494 4:8592649-8592671 GAGGATGCCGCTGGGGGAGGAGG - Exonic
969717907 4:8877339-8877361 GAGGAGGAGGAGATGGGAGGAGG + Intergenic
969889029 4:10242625-10242647 GAGGATGAGGATGCGGCCCAGGG + Intergenic
970868468 4:20785148-20785170 GAAGATTAGGATGGGGGAAGAGG + Intronic
971422708 4:26488802-26488824 GAGGGTGAGGATGATGGAGGAGG - Intronic
971514353 4:27467945-27467967 GAGGATGAGGAAGGAGAAGGAGG - Intergenic
971525021 4:27605818-27605840 GAGGAAGAGGATGAAGGGGGAGG - Intergenic
971574522 4:28256545-28256567 GAGGAGGAGGAGGGAGGAGGAGG - Intergenic
971574527 4:28256558-28256580 GAGGAGGAGGAGGGAGGAGGAGG - Intergenic
971574532 4:28256571-28256593 GAGGAGGAGGAGGGAGGAGGAGG - Intergenic
971574537 4:28256584-28256606 GAGGAGGAGGAGGGAGGAGGAGG - Intergenic
971574538 4:28256587-28256609 GAGGAGGAGGAGGAGGGAGGAGG - Intergenic
971574544 4:28256603-28256625 GAGGAGGAGGAGGGAGGAGGAGG - Intergenic
971574549 4:28256616-28256638 GAGGAGGAGGAGGGAGGAGGAGG - Intergenic
971574554 4:28256629-28256651 GAGGAGGAGGAGGGAGGAGGAGG - Intergenic
971574555 4:28256632-28256654 GAAGAGGAGGAGGAGGGAGGAGG - Intergenic
971852841 4:32005865-32005887 GAGGAAGAGGAAGAAGGAGGAGG - Intergenic
972840200 4:42921870-42921892 GAGGATGAGGAAAAGGAAGGTGG - Intronic
973014368 4:45119045-45119067 GAGGAACAGCATGAGGGAGGAGG + Intergenic
973323595 4:48834666-48834688 GAGGCTGAGGCTGAGGTAGGAGG + Intronic
975360224 4:73460953-73460975 GGGGAGGGGGATGGGGGAGGGGG - Intergenic
975504450 4:75122852-75122874 GAGGAAGAGGAGGAGGAAGGAGG + Intergenic
976220757 4:82755117-82755139 GGGGGTGAGGATGGGGGTGGAGG + Intronic
976398440 4:84582724-84582746 GAGGCTGAGGAGCTGGGAGGCGG - Intergenic
976620863 4:87126145-87126167 GAGGACGAGGACACGGGTGGCGG - Exonic
976885050 4:89971588-89971610 GAGGAAGAGGAGGAGGGAAGAGG - Intergenic
977788270 4:101066752-101066774 GGGGCGGAGGATGTGGGAGGTGG - Intronic
977790263 4:101091874-101091896 GAGGAGGAGGAGGAGGAAGGAGG + Intronic
978358655 4:107904955-107904977 GAAGATGGGGATGAGGGTGGAGG + Intronic
978390006 4:108215546-108215568 GAGGATGATGATGGTGGTGGTGG + Intergenic
978404479 4:108364728-108364750 GAAGATGGGGAAGCAGGAGGAGG - Intergenic
978508036 4:109481760-109481782 GAGGAGGAGGATGAGGAAGCAGG + Exonic
979482687 4:121237904-121237926 GAGGGAGAGGAAGCGGGAGAGGG - Intergenic
979874614 4:125872270-125872292 GAGATTGAGAATGAGGGAGGAGG - Intergenic
980875270 4:138656045-138656067 TAGGATGAGGAAGCATGAGGTGG - Intergenic
980910791 4:138992516-138992538 GAGGAGGAGGAAGAAGGAGGAGG + Intergenic
980981428 4:139657582-139657604 GAGGAGGAGGAGAAGGGAGGGGG + Intergenic
981213559 4:142136611-142136633 GAGGATGAGGCAGGGTGAGGTGG + Intronic
982104205 4:151997598-151997620 GATGATGATGATGAGGGTGGGGG - Intergenic
982196940 4:152925882-152925904 GAGGAGGAGGAGGAGGGAGAAGG + Intergenic
983617667 4:169725699-169725721 GAGGATGAGGGTGGGGGTTGGGG + Intergenic
983647383 4:170005582-170005604 GAGGATGAGAAGGAGAGAGGAGG - Exonic
983891418 4:173034083-173034105 GAGGTTGAGGTAGAGGGAGGAGG - Intronic
984547808 4:181128340-181128362 GAGGTTGAAGATGCAGGATGGGG + Intergenic
984786656 4:183573488-183573510 GAGGAAGAGGGAGAGGGAGGAGG + Intergenic
984819339 4:183866512-183866534 GAAGAAGAGGATGGTGGAGGGGG + Intronic
984871543 4:184329857-184329879 GAGGATGGGGATGCGGAAGGGGG - Intergenic
985011635 4:185588597-185588619 GAGGAGGAGGAGGGAGGAGGAGG - Intronic
985011636 4:185588600-185588622 GAGGAGGAGGAGGAGGGAGGAGG - Intronic
985038529 4:185865358-185865380 GTTGATGAGGATGGGGGAGTGGG - Intronic
985091202 4:186364241-186364263 GGTGGTGAGGATGGGGGAGGGGG - Intergenic
985422238 4:189795779-189795801 GATGCTGAGGATGCTGGATGTGG - Intergenic
985660994 5:1156368-1156390 GAGTCTGGGGATGGGGGAGGTGG - Intergenic
985671612 5:1209672-1209694 GAGGAGGAGGATGAGAGAGAGGG - Intronic
985763364 5:1763321-1763343 AAGGACGAGGAAACGGGAGGAGG - Intergenic
985988772 5:3538476-3538498 GGGGATGAGGATGCAGGGGTGGG - Intergenic
986009653 5:3700723-3700745 GAGGAAGAGGAAGAGGGAGGAGG - Intergenic
986063681 5:4215365-4215387 GAAGAAGAGGAAGCAGGAGGAGG - Intergenic
986085252 5:4438334-4438356 GAGGAAGAGGAAGAGGAAGGAGG + Intergenic
986085254 5:4438340-4438362 GAGGAAGAGGAAGGAGGAGGAGG + Intergenic
986183621 5:5416959-5416981 GAGGGTGAGGAGGAGGGAGAGGG + Intergenic
986775087 5:11006880-11006902 GAGGATGAAGAAACAGGAGGAGG + Intronic
986879092 5:12147851-12147873 GAGGAGGAGGGAGGGGGAGGGGG - Intergenic
987822829 5:22988018-22988040 GAGGAAGAGGAGGAAGGAGGTGG - Intergenic
988255775 5:28818409-28818431 GAGGAAGAGGAAGAAGGAGGAGG + Intergenic
988819146 5:34863362-34863384 GAGGATGAGGGTGGTGGTGGTGG + Intronic
988888648 5:35589146-35589168 GAGGAAGAGGAAGGGTGAGGAGG - Intergenic
989098989 5:37807317-37807339 GAGAGTGAGGCTGAGGGAGGAGG + Intergenic
989466792 5:41765865-41765887 GGGGATGAAGATGAGGGATGGGG - Intronic
990287211 5:54311660-54311682 GAGGGTGGGGATGGGGGGGGGGG - Intergenic
990499904 5:56385743-56385765 GAGGAAGAGGAGGGGGCAGGAGG - Intergenic
990825468 5:59893457-59893479 GGTGATGGGGATGCAGGAGGCGG + Exonic
991054636 5:62306953-62306975 GGGGATGGGGATGGGGGTGGGGG + Intronic
991058728 5:62348126-62348148 TTGGCTGAGGATGCTGGAGGTGG - Exonic
991105333 5:62836537-62836559 GAGGAGGAGGAAGGGGGAAGAGG + Intergenic
991418748 5:66418876-66418898 GAGGAGGAGGAGGAGAGAGGAGG - Intergenic
991418752 5:66418892-66418914 GAGGAGGAGGAAGAAGGAGGAGG - Intergenic
991726983 5:69545526-69545548 GAGGCTGAGGCTGAGGCAGGAGG + Intronic
991867974 5:71082348-71082370 GAGGCTGAGGCTGAGGCAGGAGG - Intergenic
992758958 5:79934663-79934685 GAGGATGAGGGAGAGGGTGGCGG + Intergenic
993519479 5:88883309-88883331 GAGGAGGAGGAAGAAGGAGGAGG + Intronic
994043593 5:95284591-95284613 GAGGAGGAGGAGGGGAGAGGAGG - Intergenic
995055022 5:107749476-107749498 GAGGAAGAAGAAGAGGGAGGAGG + Intergenic
995116232 5:108482619-108482641 GAGGATAAGGTTGGGAGAGGGGG - Intergenic
995402342 5:111757277-111757299 GAGGAAGAGGAGGGAGGAGGGGG + Intronic
995404313 5:111776991-111777013 GAGGAGGAGGAGGAGGAAGGAGG + Intronic
995404314 5:111776994-111777016 GAGGAGGAGGAGGAAGGAGGTGG + Intronic
995404321 5:111777016-111777038 GAGGAGGAGGAGGAAGGAGGTGG + Intronic
995523344 5:113031372-113031394 GAGGATGGTGTTGCAGGAGGGGG + Intronic
995807537 5:116070261-116070283 GGCGATGAGGATGCTGGTGGTGG - Intergenic
995967167 5:117921600-117921622 AAGGATGAGTAGGTGGGAGGGGG + Intergenic
996087347 5:119318663-119318685 GGGCAGGAGGATGCGGGGGGAGG - Intronic
996398063 5:123032942-123032964 GAGGTAGAGGAAGAGGGAGGAGG + Intronic
996457789 5:123704498-123704520 GAGGATGAGGCTGAGGCGGGAGG - Intergenic
996904015 5:128576970-128576992 AAGGATGTGTATGGGGGAGGTGG - Intronic
997246128 5:132351152-132351174 GAGGGTGATCATGGGGGAGGAGG - Intergenic
997417856 5:133742724-133742746 GAGGCTGAGGAGGTGTGAGGGGG + Intergenic
997718904 5:136062532-136062554 GAGGAAGAGGAAGGGGAAGGTGG - Intronic
997766004 5:136503993-136504015 GGGGATGGGGATGAGGCAGGAGG - Intergenic
998363561 5:141612632-141612654 GAGGACGAGGATGGGTGAGAGGG + Intronic
998376339 5:141693335-141693357 CAGGAGGAGGCTGTGGGAGGTGG + Intergenic
998484793 5:142492396-142492418 GAGTAAGAGGAGGAGGGAGGAGG - Intergenic
998497502 5:142603399-142603421 GAGGAAGAGGATGTGGGGGAGGG - Intronic
998590976 5:143477920-143477942 GAGGATGAGTAGGGAGGAGGAGG - Intergenic
998611512 5:143694307-143694329 AAGGAGGAGGAGGAGGGAGGGGG - Intergenic
998673635 5:144382246-144382268 AAGGATGAGCATGTGGGAAGAGG + Intronic
998843615 5:146282291-146282313 GAGGATGAGGCTGGGTGCGGTGG - Intronic
998940830 5:147280418-147280440 GGGGTTGGGGATGGGGGAGGGGG + Intronic
999147609 5:149406519-149406541 GAGGAGGAGGAGGAGGAAGGGGG - Intergenic
999200208 5:149810800-149810822 GAGGCTGAGAAAGCGGGAAGAGG - Intronic
999517202 5:152313497-152313519 GAGGAGGAGGAAGAAGGAGGAGG - Intergenic
999788340 5:154912791-154912813 GATGATGATAATGGGGGAGGGGG + Intronic
999827994 5:155292468-155292490 GAGGATGAAGAAGCAGGAGAAGG - Intergenic
999871946 5:155761602-155761624 GATGATGAGGATGATGGAGAGGG - Intergenic
999969374 5:156843920-156843942 GAGAGTGAGGATGGGGAAGGAGG + Intergenic
1000065232 5:157688440-157688462 GAGGTTGAGGCTGCGGTGGGCGG + Intergenic
1000116604 5:158159826-158159848 TAGGAGGAGGATGCTGGGGGCGG - Intergenic
1000485415 5:161836173-161836195 GAGGAGGAGGAAGGAGGAGGAGG + Intergenic
1001132919 5:169079584-169079606 GGGGAGGAGGAGGAGGGAGGAGG + Intronic
1001132920 5:169079587-169079609 GAGGAGGAGGAGGGAGGAGGAGG + Intronic
1001132959 5:169079719-169079741 GAGGAGGAGGAGGAGGGAAGAGG + Intronic
1001132986 5:169079809-169079831 GGGGAAGAGGAGGAGGGAGGAGG + Intronic
1001769884 5:174286312-174286334 GAGGAGAAAGATGGGGGAGGAGG + Intergenic
1001777041 5:174336883-174336905 TAGGATGGGGATGCTGGAAGTGG - Intergenic
1002340914 5:178516110-178516132 GAGGACGAGGACGGGGCAGGTGG - Intronic
1002451425 5:179321170-179321192 GAGGATGAGGATCCGGGAGATGG - Intronic
1002594312 5:180312175-180312197 GAGGCTGAGGACCAGGGAGGCGG + Intronic
1002795096 6:465635-465657 GAGAAAGAGGATGGGGCAGGTGG - Intergenic
1002844883 6:937355-937377 GAGGAGGAGGATGGAGGGGGAGG - Intergenic
1002844884 6:937358-937380 GAGGAGGAGGAGGATGGAGGGGG - Intergenic
1002910277 6:1485893-1485915 GACGATGAGGATGCAGGGCGTGG + Intergenic
1003020428 6:2504823-2504845 AAGGATGAGGAGGGGTGAGGAGG - Intergenic
1003020493 6:2505066-2505088 GAGGATGAGGAGCAGTGAGGAGG - Intergenic
1003125953 6:3356077-3356099 GAGGGGGAGGAGGCGGGAGGAGG + Intronic
1003406755 6:5832554-5832576 GAGGAAGAGGAGGGGGGAGGGGG + Intergenic
1003409169 6:5848177-5848199 GAGTATGAGGATGAGGGAGAGGG - Intergenic
1003449704 6:6219316-6219338 GAGGGTGAGGGTGAGGGTGGAGG - Intronic
1003491063 6:6621951-6621973 GAGGGTGGGGTTGGGGGAGGAGG + Intronic
1003668839 6:8136659-8136681 GAGAAGGATGATGGGGGAGGTGG - Intergenic
1003727448 6:8781194-8781216 GAGGATGAGTATGTAGGAGGAGG + Intergenic
1003817623 6:9859932-9859954 GAGGAGGAGGATGAAGAAGGAGG + Intronic
1004060995 6:12197931-12197953 GGGGGTGAGGAAGAGGGAGGAGG + Intergenic
1004159855 6:13203894-13203916 GAAGGTGAGGATCCTGGAGGAGG + Intronic
1004649343 6:17593560-17593582 GAGAAGGAGGAAGGGGGAGGGGG - Intergenic
1004924424 6:20403565-20403587 GAGGAGGCGGCGGCGGGAGGGGG + Intronic
1005064856 6:21808061-21808083 GAGGGTGAGGATGGGTGGGGAGG + Intergenic
1005871018 6:29974633-29974655 GAGGCTGAGGATGAAGGAGTGGG + Intergenic
1006014782 6:31071509-31071531 GAGGCCGAGGAGGCGGGCGGAGG + Intergenic
1006058904 6:31404822-31404844 GAGGCTGAGGATGAAGGAGTGGG - Intronic
1006071388 6:31499707-31499729 GAGGCTGAGGATGAAGGAGTGGG - Intronic
1006088908 6:31616267-31616289 GAGAATGGGGATGCGGAAGTGGG + Intronic
1006146199 6:31961270-31961292 GAGGATGAGAATGAGGCAGTGGG + Exonic
1006304693 6:33211886-33211908 GAGGGTGGGGGTGCCGGAGGAGG + Exonic
1006335813 6:33420154-33420176 GAGGAGGAGGAGGAGAGAGGAGG - Exonic
1006439917 6:34047558-34047580 GAGGATGAAAATTCGAGAGGAGG - Intronic
1006453284 6:34117683-34117705 GAGGAGGTGGATGTGGCAGGTGG - Intronic
1006671488 6:35732124-35732146 GAGGAGGAGGTTGCGGCGGGGGG - Intergenic
1006929508 6:37679330-37679352 GGGGCTGTGGATGCGGGAGGAGG + Intronic
1007176515 6:39901424-39901446 GAGGAGGAGGAAGGAGGAGGAGG + Exonic
1007266270 6:40598695-40598717 GAGGATGTGGGTGGGGGTGGGGG - Intergenic
1007341533 6:41194095-41194117 GGGGAGGAGGATCAGGGAGGAGG - Intronic
1007371478 6:41429105-41429127 GAAGAGGAGGATGCTGGAGCAGG + Intergenic
1007420158 6:41714459-41714481 GAGGATGGGGAAGAGGGAGCAGG + Intronic
1007664741 6:43507539-43507561 GAGGAGGAGGAAGTGGCAGGAGG - Exonic
1007813977 6:44507071-44507093 GAGGATGATGATGGAGGAAGAGG + Intergenic
1007837251 6:44683174-44683196 GAGGGTGAGGATGAGAGAGAGGG - Intergenic
1007970612 6:46048603-46048625 GTTGATGAGGAGGTGGGAGGTGG - Intronic
1008016422 6:46525602-46525624 GAGGATGAGGAAGAAGGAGGAGG + Intergenic
1008383431 6:50859583-50859605 GAGGAGGAGGATGAGGTGGGGGG - Intergenic
1008584553 6:52936990-52937012 GAGGAAGAGGAGGAGAGAGGAGG - Intergenic
1008908179 6:56703643-56703665 GAGGATGAGGATAAGGGGGTAGG - Intronic
1009370165 6:62889438-62889460 GAGGATGGGGAAGCTGGAGGTGG + Intergenic
1009567308 6:65325209-65325231 GAGGATGAAGAAGGGAGAGGAGG - Intronic
1010232217 6:73545110-73545132 GAGGAGGAGGAGGAGGAAGGAGG - Intergenic
1010887423 6:81261882-81261904 GGGGAAGAGGAAGGGGGAGGGGG + Intergenic
1011484781 6:87830098-87830120 GAGGAGGAGGAAGAAGGAGGAGG - Intergenic
1011484786 6:87830117-87830139 GAGGAGGAGGAAGAAGGAGGAGG - Intergenic
1011484789 6:87830130-87830152 GAGGAGGAGGAGGGAGGAGGAGG - Intergenic
1011484790 6:87830133-87830155 GAGGAGGAGGAGGAGGGAGGAGG - Intergenic
1011484796 6:87830149-87830171 GAGGAGGAGGAAGAAGGAGGAGG - Intergenic
1011484799 6:87830162-87830184 GAGGAGGAGGAGGGAGGAGGAGG - Intergenic
1011484800 6:87830165-87830187 GAGGAGGAGGAGGAGGGAGGAGG - Intergenic
1011484807 6:87830184-87830206 GAGGAGGAGGAAGAAGGAGGAGG - Intergenic
1012201419 6:96411095-96411117 GCGGAAGGTGATGCGGGAGGAGG + Intergenic
1012477739 6:99633435-99633457 GCTGATGAGGGTGCGGCAGGAGG + Intergenic
1012809210 6:103936568-103936590 GAGGAGGAGGAGGAGGAAGGAGG + Intergenic
1012954445 6:105553698-105553720 GAGGATGATGATGACGGTGGTGG - Intergenic
1013056572 6:106589139-106589161 GAGGAAGAGGAAGAGGAAGGAGG + Intronic
1013056574 6:106589145-106589167 GAGGAAGAGGAAGGAGGAGGAGG + Intronic
1013056584 6:106589173-106589195 GAGGAGGAGGAGGAGGGAGGAGG + Intronic
1013056585 6:106589176-106589198 GAGGAGGAGGAGGGAGGAGGAGG + Intronic
1013056593 6:106589192-106589214 GAGGAGGAGGGAGGGGGAGGAGG + Intronic
1013449516 6:110265868-110265890 GAGGAAGAGGAAGAAGGAGGAGG - Intronic
1013597245 6:111671420-111671442 GAAGATGGAGGTGCGGGAGGAGG - Intronic
1014242411 6:119032514-119032536 GAGGAAGAGGAAGAGGGAGAGGG + Intronic
1014272553 6:119349879-119349901 GAGGAGGGGGATGCGCGGGGCGG + Intergenic
1014281343 6:119445463-119445485 GAGGTGGAGGTTGCTGGAGGAGG + Intergenic
1014561915 6:122901184-122901206 GAGGAAGAGGAAGAAGGAGGAGG - Intergenic
1014684359 6:124477684-124477706 GAGGGAGAGGATGAGGGAGAGGG - Intronic
1014804865 6:125818086-125818108 GAGGAGGAGGAAGGAGGAGGTGG - Intronic
1015405652 6:132834306-132834328 CAGAAAGAGGATGAGGGAGGAGG + Intergenic
1015405654 6:132834312-132834334 GAGGATGAGGGAGGAGGAGGTGG + Intergenic
1015643867 6:135364911-135364933 GAGGAAGAGGAAGAGGGAGAGGG + Intronic
1015868689 6:137753919-137753941 TAGGATAAGGAAGCTGGAGGAGG + Intergenic
1015960428 6:138643317-138643339 GAGGATGTGGATAAAGGAGGAGG - Intronic
1016122159 6:140357603-140357625 CTGGAGGAGGATGTGGGAGGGGG - Intergenic
1016400543 6:143675531-143675553 GGGGGTGAGGAGGCAGGAGGGGG - Intronic
1016400741 6:143677865-143677887 GAGGAGGGGGAAGCGGGGGGAGG - Intronic
1016741495 6:147533651-147533673 GAGGAGGAGGAAGGGGGAGAGGG - Intronic
1016801488 6:148173547-148173569 GAGGAAGAGGAGGGGGGAAGAGG + Intergenic
1016904309 6:149133750-149133772 GAGGATGAGGATGAGGATGGTGG - Intergenic
1017103470 6:150866979-150867001 GAGGATGTGAATGGAGGAGGTGG - Intronic
1017409855 6:154156529-154156551 GAGCATGGGGCAGCGGGAGGGGG + Intronic
1017616573 6:156252571-156252593 AAGGATGAGGGAGCAGGAGGGGG - Intergenic
1017853554 6:158328172-158328194 GAGGAGCAGGAGGAGGGAGGAGG + Intronic
1017961179 6:159222034-159222056 AAGGAAGAGCAGGCGGGAGGTGG + Intronic
1018038036 6:159898513-159898535 GAGGAGGAGGAAGAAGGAGGAGG - Intergenic
1018038047 6:159898546-159898568 GAGGAGGAAGAGGCAGGAGGAGG - Intergenic
1018038066 6:159898620-159898642 GAGGAGGAAGAAGAGGGAGGAGG - Intergenic
1018038070 6:159898636-159898658 GAGGAGGAGGAAGAGGGAGGAGG - Intergenic
1018038079 6:159898662-159898684 GAGGAGGAGGAAGAGGAAGGAGG - Intergenic
1018038083 6:159898678-159898700 AAGGAGGAGGAAGAGGGAGGAGG - Intergenic
1018038090 6:159898704-159898726 GAGGAGGAGGAAGAGGGAGGAGG - Intergenic
1018038095 6:159898720-159898742 GAGGAGGAGGAAGAGGGAGGAGG - Intergenic
1018247694 6:161838604-161838626 AAGGATGAGGAAGAGGAAGGTGG - Intronic
1018442463 6:163825626-163825648 GAAGATGGGGATGCGGTAGGAGG + Intergenic
1018453296 6:163929106-163929128 GACCATGAGGATGCTGTAGGGGG - Intergenic
1018617356 6:165700286-165700308 GAGGAAGGGGATGGGGTAGGGGG + Intronic
1018958916 6:168432291-168432313 GAGGATGAGCAGGAGGGAGGAGG + Intergenic
1019251586 7:16653-16675 GAGGATGAGGATGAGGGTTAGGG - Intergenic
1019320692 7:414171-414193 GAGGAGGGGGAGGAGGGAGGAGG - Intergenic
1019320710 7:414217-414239 GAGGAGGGGGAGGAGGGAGGAGG - Intergenic
1019320718 7:414233-414255 GAGGAGGGGGAGGAGGGAGGAGG - Intergenic
1019320726 7:414249-414271 GAGGAGGGGGAGGAGGGAGGAGG - Intergenic
1019320750 7:414311-414333 GAGGAGGGGGAGGAGGGAGGAGG - Intergenic
1019320758 7:414327-414349 GAGGATGGAGAGGAGGGAGGAGG - Intergenic
1019320771 7:414359-414381 GAGGAGGGGGAGGAGGGAGGAGG - Intergenic
1019332300 7:466469-466491 AAGGATGAGGGTGAGGTAGGAGG - Intergenic
1019332382 7:466793-466815 AGGGATGAGGGTGAGGGAGGAGG - Intergenic
1019332387 7:466806-466828 GAGGATGAGGGTAAGGGATGAGG - Intergenic
1019419052 7:942281-942303 GAGGAGGAGGAAGAGAGAGGAGG + Intronic
1019419068 7:942350-942372 GAGGAAGAGGAAGAGAGAGGAGG + Intronic
1019419224 7:942933-942955 GAGGAGGAGGAAGAGAGAGGAGG + Intronic
1019419291 7:943208-943230 GAGGAGGAGGAAGAGAGAGGAGG + Intronic
1019419301 7:943242-943264 GAGGAGGAGGAAGGGAGAGGAGG + Intronic
1019494915 7:1333348-1333370 GAGGGGGAGGAGGGGGGAGGAGG - Intergenic
1019494966 7:1333457-1333479 GAGGGGGAGGAGGAGGGAGGAGG - Intergenic
1019517426 7:1446191-1446213 GAGGGAGAGGAGGGGGGAGGAGG + Intronic
1019517435 7:1446210-1446232 GAGGGAGAGGAGGGGGGAGGAGG + Intronic
1019517444 7:1446229-1446251 GAGGGAGAGGAGGGGGGAGGAGG + Intronic
1019517453 7:1446248-1446270 GAGGGAGAGGAGGGGGGAGGAGG + Intronic
1019517483 7:1446335-1446357 GAGGGAGAGGAGGGGGGAGGAGG + Intronic
1019517492 7:1446354-1446376 GAGGGAGAGGAGGGGGGAGGAGG + Intronic
1019517499 7:1446373-1446395 GAGGAAGAGAAGGGGGGAGGAGG + Intronic
1019517522 7:1446441-1446463 GAGGGAGAGGAGGGGGGAGGAGG + Intronic
1019535374 7:1526484-1526506 GAGGAAGAGGAAGAAGGAGGGGG + Intergenic
1019535387 7:1526540-1526562 GAAGAAGAGGAAGAGGGAGGAGG + Intergenic
1019562627 7:1666048-1666070 GAGGAAGAGGAGGAGGAAGGAGG + Intergenic
1019827616 7:3297713-3297735 GAGGAAGAGGAAGAAGGAGGAGG + Intergenic
1019954978 7:4406077-4406099 GAGGAGGAGGAGGAGGAAGGAGG + Intergenic
1019989743 7:4682948-4682970 GAGGCCGAGGAAGCTGGAGGGGG - Intronic
1020047146 7:5048845-5048867 GAGCAGGAGGAAGAGGGAGGGGG + Intronic
1020080179 7:5282677-5282699 GAGGAGGAGGAATGGGGAGGAGG + Intronic
1020263194 7:6543016-6543038 GTGGATGAGGGTGAGAGAGGCGG - Intronic
1020661049 7:10982971-10982993 GATGATGAAGATGAGGGAAGCGG + Exonic
1020794926 7:12667618-12667640 GAGGAAGAGGACGAGGGAGGAGG + Intergenic
1020808829 7:12826311-12826333 GAGGAAGAGGATGAGGGGGAAGG - Intergenic
1020904554 7:14048951-14048973 GAGAGTGAGGATGGGGAAGGAGG - Intergenic
1021625626 7:22590299-22590321 GAGAATGAGGAGGCAGGAGGAGG - Intronic
1021968142 7:25942391-25942413 GGGGATCAGGATGGGGGCGGTGG - Intergenic
1022097237 7:27148525-27148547 CAGGATGTGTATGTGGGAGGAGG - Intronic
1023003733 7:35840167-35840189 GAGGAGGAGGGGGAGGGAGGAGG - Intronic
1023078585 7:36506823-36506845 GAGGCTGAGGCTGAGGCAGGAGG - Intergenic
1023224626 7:37956230-37956252 GAGGAAGAGGAAGAGGGAGAAGG + Intronic
1023295875 7:38714741-38714763 GAGGAGGAGGAAGAGGGAGCAGG - Intergenic
1023910659 7:44553338-44553360 GAGGAGGAGGAAGGGCGAGGAGG + Intergenic
1024030296 7:45455038-45455060 GAGTAGGGGGATGGGGGAGGGGG - Intergenic
1024569681 7:50713558-50713580 GAGGATGGAGATGGTGGAGGAGG - Intronic
1024667565 7:51561993-51562015 GAGGGTGAGGCTCTGGGAGGAGG + Intergenic
1024720955 7:52137079-52137101 GAGGAGAAGGAGGAGGGAGGAGG + Intergenic
1024721005 7:52137369-52137391 AAGGAGGAGGAGGGGGGAGGAGG + Intergenic
1025069709 7:55887696-55887718 GAGGAGGCGGAGGCGGGAGGCGG + Intronic
1025106205 7:56174271-56174293 GACGATGAGGACGGGGGTGGGGG + Intergenic
1025230956 7:57203172-57203194 GAGGCGGAGGAGGCGGGAGGAGG - Intergenic
1025283655 7:57646382-57646404 GAGGAAGAAGCTGCGGGCGGAGG - Intergenic
1026136090 7:67662328-67662350 AAGTCTGAGGATGAGGGAGGTGG - Intergenic
1026148620 7:67769804-67769826 GAGGAGGAGGAGGGAGGAGGAGG - Intergenic
1026148621 7:67769807-67769829 GTGGAGGAGGAGGAGGGAGGAGG - Intergenic
1026191907 7:68136496-68136518 GAGAAGGAGGAGGAGGGAGGAGG + Intergenic
1026191932 7:68136559-68136581 AAGGAGGAGGATGAGGGAGGAGG + Intergenic
1026217647 7:68363967-68363989 GAGGAGGAGGAAGAAGGAGGAGG - Intergenic
1026217650 7:68363980-68364002 GAGGAGGAGGAGGGAGGAGGAGG - Intergenic
1026638635 7:72105772-72105794 GAGGAGGAGGAGGAGGGGGGAGG + Intronic
1026638664 7:72105833-72105855 AGGGATGGGGATGAGGGAGGGGG + Intronic
1026928525 7:74210191-74210213 GAGAGTGGGGCTGCGGGAGGGGG - Intronic
1027192599 7:76005818-76005840 GAGGAGGAGGAAGAGAGAGGAGG + Intronic
1027192602 7:76005834-76005856 GAGGAGGAGGAAGAGAGAGGAGG + Intronic
1027192613 7:76005886-76005908 GAGGAGGAGGAGGAGAGAGGAGG + Intronic
1027192621 7:76005908-76005930 GAGGAGGAGGAGGAGGGAGGAGG + Intronic
1027192622 7:76005911-76005933 GAGGAGGAGGAGGGAGGAGGTGG + Intronic
1027589921 7:80105693-80105715 GAGGAAGAGGAAGAGGAAGGTGG + Intergenic
1027782632 7:82538446-82538468 GAGGGTGAGGGTGAGGGAGAGGG + Intergenic
1028086096 7:86639639-86639661 GAGGATGAGGATGAGGAAGCCGG - Intergenic
1028398963 7:90404022-90404044 GAGGAGGCGGAGGGGGGAGGAGG + Intronic
1028476936 7:91264245-91264267 GGGTAGGAGGAGGCGGGAGGAGG - Intergenic
1029440600 7:100584900-100584922 GGGGATCAGGATCAGGGAGGAGG - Intronic
1029623566 7:101705647-101705669 GAGGAAGAGGAGGTGGGAGAGGG + Intergenic
1030172391 7:106616482-106616504 GAGGAAGAGGAGGGAGGAGGAGG + Intergenic
1030380005 7:108800843-108800865 GAGGAGGAGGAAAGGGGAGGGGG - Intergenic
1031695002 7:124840092-124840114 GAGGATGTTGATACTGGAGGAGG - Intronic
1031854626 7:126907286-126907308 GGGGAGGAGGAAGAGGGAGGAGG + Intronic
1031854630 7:126907302-126907324 GAGGAGGAGGAAGAGGAAGGAGG + Intronic
1031923663 7:127619362-127619384 CAGTCTGAGGATGCTGGAGGAGG - Intergenic
1032326565 7:130934627-130934649 GAGGAAGAGGAAGAGGGAGAGGG + Intergenic
1032450438 7:132025843-132025865 AAAGATGAGGATGGAGGAGGTGG + Intergenic
1032464888 7:132137903-132137925 GAGGATGAGTATGAGGATGGTGG + Intronic
1032466831 7:132151393-132151415 GAGGAGGAGGAGGAGGAAGGAGG + Intronic
1032466832 7:132151396-132151418 GAGGAGGAGGAGGAAGGAGGAGG + Intronic
1032466833 7:132151399-132151421 GAGGAGGAGGAAGGAGGAGGAGG + Intronic
1032466838 7:132151415-132151437 GAGGAGGAGGAGGAGGAAGGAGG + Intronic
1032466839 7:132151418-132151440 GAGGAGGAGGAGGAAGGAGGAGG + Intronic
1032466840 7:132151421-132151443 GAGGAGGAGGAAGGAGGAGGAGG + Intronic
1032492396 7:132333388-132333410 CAGGAAGAGGAAGAGGGAGGTGG + Intronic
1032947595 7:136870490-136870512 AGGGATGCGGATGCTGGAGGCGG - Intronic
1033367444 7:140682462-140682484 GAGGCTGAGGAGGTGAGAGGAGG + Intronic
1033654258 7:143362499-143362521 GAGGAGAGGGATGGGGGAGGGGG + Intronic
1033890430 7:146006398-146006420 CAGGGGGAGGATGGGGGAGGAGG - Intergenic
1034438738 7:151076104-151076126 GAGGATGAGGATGAAGGGGAAGG - Exonic
1034875477 7:154721083-154721105 GAGGAAGAGAATGTGAGAGGTGG + Intronic
1035034438 7:155885864-155885886 AAGGAAAAGGATGGGGGAGGAGG - Intergenic
1035035954 7:155893876-155893898 GAGGAGGAGGCAGCGGGAGCTGG - Intergenic
1035070869 7:156144043-156144065 AATAATGAGGATGTGGGAGGCGG - Intergenic
1035179287 7:157077708-157077730 GAGGCTGAGGCTGAGGCAGGAGG - Intergenic
1035265295 7:157686767-157686789 GAGGAGGAGGAGGAGGGAGAAGG + Intronic
1035659626 8:1337213-1337235 GATGATGAGGATGATGGTGGTGG + Intergenic
1035659633 8:1337261-1337283 GATGATGAGGATGATGGTGGTGG + Intergenic
1035679908 8:1480318-1480340 GAGGAAGAGGATGGGTGATGGGG + Intergenic
1036165023 8:6424507-6424529 AAGGCTGAGGAGGCGGGAAGTGG - Intronic
1036598889 8:10240828-10240850 GGGGATGGGGGTGCGGGGGGTGG - Intronic
1037193127 8:16152084-16152106 GAGGAGGAGGATGAGGAAGAGGG - Intronic
1037497047 8:19450213-19450235 GAGGAAGAGGGAGGGGGAGGGGG + Intronic
1037568865 8:20141624-20141646 GAGGAGGAGGAGGGGGGAGGGGG + Intergenic
1038136062 8:24787026-24787048 GAGGATGAGGCTGAGGCAGGCGG - Intergenic
1038393010 8:27222849-27222871 CAGGATGAGAATATGGGAGGAGG - Intergenic
1038864522 8:31424994-31425016 GAGGCTGAGGATGAGGCAGAAGG + Intergenic
1038895353 8:31776473-31776495 GAGCATGGGCATGAGGGAGGAGG - Intronic
1039052697 8:33509213-33509235 GAGGCTGAGGCTGAGGCAGGTGG + Intronic
1039454684 8:37698707-37698729 GAGGAGGAGGGAGAGGGAGGAGG - Exonic
1039458070 8:37721065-37721087 CAGTATGAGGATTTGGGAGGTGG - Intergenic
1039493084 8:37962396-37962418 GAGAATGATGATGTTGGAGGTGG - Intergenic
1040079781 8:43274942-43274964 GAGGATGAGGGAGGAGGAGGAGG - Intergenic
1040079783 8:43274948-43274970 AGGGAGGAGGATGAGGGAGGAGG - Intergenic
1040079787 8:43274961-43274983 GGGGAGGAGGAAGAGGGAGGAGG - Intergenic
1040517042 8:48143867-48143889 GAGGTTGAGGCTGCAGCAGGCGG + Intergenic
1040578840 8:48678507-48678529 TAGGATTAGGCTGCTGGAGGGGG + Intergenic
1041005386 8:53492784-53492806 GAGGGTGGTGATGAGGGAGGCGG + Intergenic
1041029732 8:53724575-53724597 GAGGAGGGGGAGGGGGGAGGAGG - Intronic
1041104477 8:54427826-54427848 GAGGATGACCATGAGGGTGGAGG - Intergenic
1041167335 8:55102621-55102643 GAGGACGAGGAGGCGGCCGGGGG + Exonic
1041170884 8:55141253-55141275 GAGGCAGAGGAGGAGGGAGGCGG - Intronic
1041291157 8:56310091-56310113 GAGGAAGAGGAGGAAGGAGGAGG + Intronic
1041291166 8:56310120-56310142 AAGGAGGAGGAGGAGGGAGGAGG + Intronic
1041291167 8:56310123-56310145 GAGGAGGAGGAGGGAGGAGGAGG + Intronic
1041291171 8:56310136-56310158 GAGGAGGAGGAGGAGGAAGGAGG + Intronic
1041291172 8:56310139-56310161 GAGGAGGAGGAGGAAGGAGGAGG + Intronic
1041291173 8:56310142-56310164 GAGGAGGAGGAAGGAGGAGGAGG + Intronic
1041291177 8:56310152-56310174 AAGGAGGAGGAGGAGGGAGGAGG + Intronic
1041291178 8:56310155-56310177 GAGGAGGAGGAGGGAGGAGGAGG + Intronic
1041291182 8:56310168-56310190 GAGGAGGAGGAGGAGGAAGGAGG + Intronic
1041291183 8:56310171-56310193 GAGGAGGAGGAGGAAGGAGGAGG + Intronic
1041291184 8:56310174-56310196 GAGGAGGAGGAAGGAGGAGGAGG + Intronic
1041291188 8:56310187-56310209 GAGGAGGAGGAAGGAGGAGGAGG + Intronic
1041291192 8:56310200-56310222 GAGGAGGAGGAGGAAGGAGGAGG + Intronic
1041291193 8:56310203-56310225 GAGGAGGAGGAAGGAGGAGGAGG + Intronic
1041291197 8:56310216-56310238 GAGGAGGAGGAGGAAGGAGGAGG + Intronic
1041291198 8:56310219-56310241 GAGGAGGAGGAAGGAGGAGGAGG + Intronic
1041291202 8:56310232-56310254 GAGGAGGAGGAGGAAGGAGGAGG + Intronic
1041291203 8:56310235-56310257 GAGGAGGAGGAAGGAGGAGGAGG + Intronic
1041291207 8:56310248-56310270 GAGGAGGAGGAGGAAGGAGGAGG + Intronic
1041291208 8:56310251-56310273 GAGGAGGAGGAAGGAGGAGGAGG + Intronic
1041291212 8:56310264-56310286 GAGGAGGAGGAGGAAGGAGGAGG + Intronic
1041291213 8:56310267-56310289 GAGGAGGAGGAAGGAGGAGGAGG + Intronic
1041291217 8:56310280-56310302 GAGGAGGAGGAGGAAGGAGGAGG + Intronic
1041291218 8:56310283-56310305 GAGGAGGAGGAAGGAGGAGGAGG + Intronic
1041291222 8:56310296-56310318 GAGGAGGAGGAGGAAGGAGGAGG + Intronic
1041291223 8:56310299-56310321 GAGGAGGAGGAAGGAGGAGGAGG + Intronic
1041291227 8:56310312-56310334 GAGGAGGAGGAAGGAGGAGGAGG + Intronic
1042176525 8:66042701-66042723 GAGGAGGGGGAGGGGGGAGGGGG - Intronic
1042312074 8:67388792-67388814 GAGCAGGAGGAGGAGGGAGGAGG - Intergenic
1042591815 8:70403841-70403863 GAGGAGGAGGAGGAGGGAGTTGG - Intergenic
1042962860 8:74321476-74321498 GAGGAGGAGGAGGAGGAAGGCGG - Intronic
1042987961 8:74604457-74604479 GAGGAGGAGGAGGAGGAAGGGGG + Intronic
1043548040 8:81337245-81337267 GAGGAAGAGGAGGCGGAAGAAGG + Intergenic
1044090325 8:87992527-87992549 GAGGAGGAGGAGGGGGGAGAGGG - Intergenic
1044193116 8:89342917-89342939 GAGGATGAGGAAGAGTGGGGAGG - Intergenic
1044619100 8:94171976-94171998 GAGGAGGGGGAGGGGGGAGGGGG - Intronic
1044626930 8:94243068-94243090 AAGGATGGGGAAGTGGGAGGGGG + Intergenic
1044703833 8:94989391-94989413 GTGGATGAAGATCAGGGAGGAGG + Intronic
1044893699 8:96864802-96864824 GAGGAATAGGATGGGGGATGGGG + Intronic
1045008832 8:97939539-97939561 GAGGCTGAGGCTGAGGCAGGAGG + Intronic
1045345731 8:101291988-101292010 GGGAATGGGGATGCGGGGGGAGG - Intergenic
1045474616 8:102542518-102542540 GAGGAGGTGGGTGTGGGAGGAGG - Intergenic
1046573550 8:115996885-115996907 GGGGAAGAGAATGCTGGAGGAGG + Intergenic
1047073645 8:121375980-121376002 AAGGAGGAGTATGAGGGAGGAGG - Intergenic
1047102534 8:121694123-121694145 AAGGGTGAGGGTGCGGAAGGAGG + Intergenic
1047192988 8:122695470-122695492 GAGCAGGAGGATGAGGGGGGAGG + Intergenic
1048574541 8:135680392-135680414 GATGATGAAGACGCCGGAGGCGG - Intergenic
1048811913 8:138296174-138296196 GTTGATGAGGATGCCTGAGGAGG - Intronic
1048889432 8:138934481-138934503 GAGGAAGAGGAGGAGGGAGAAGG + Intergenic
1048996376 8:139796103-139796125 GAGGAAGAGGAGGAGGGAGGAGG + Intronic
1049122035 8:140747682-140747704 GGGGAGGAGGAGGAGGGAGGAGG + Intronic
1049122036 8:140747685-140747707 GAGGAGGAGGAGGGAGGAGGAGG + Intronic
1049241848 8:141541824-141541846 GAGGAAGAGGCTGCAGGAGTGGG - Intergenic
1049310481 8:141931367-141931389 GAGGAGGAGGAGGCCTGAGGAGG + Intergenic
1049360569 8:142210787-142210809 CATGATGAGGCTGAGGGAGGAGG - Intergenic
1049361119 8:142212997-142213019 GAGGAGGAGGGAGGGGGAGGAGG - Intronic
1049370356 8:142261349-142261371 GAGTGGGAGGATGAGGGAGGAGG + Intronic
1049386079 8:142343802-142343824 GAGGAGGAGGAGGGGAGAGGAGG + Intronic
1049404181 8:142444301-142444323 GAGGAAGGGGATGGGGGATGGGG + Intergenic
1049501804 8:142971219-142971241 GAGCCTGTGGATGGGGGAGGCGG + Intergenic
1049511382 8:143028430-143028452 GAGGCTGTGGATGGGGGAGGTGG - Intergenic
1049519330 8:143080239-143080261 GAGGAGGAGGGAGAGGGAGGAGG - Intergenic
1049609048 8:143544382-143544404 GAGGAGGAGGATGAGGAGGGAGG - Intergenic
1049728550 8:144163438-144163460 GTGGAGGAGGATGCTGTAGGTGG + Intronic
1049762976 8:144339156-144339178 GGGGATCAGGATGCTGGTGGGGG - Intergenic
1049780220 8:144425450-144425472 GGGGATGAGGGTGGGGGAGTGGG + Intronic
1049846333 8:144803625-144803647 GAGTATGTGGTTGCAGGAGGCGG + Exonic
1049882936 9:10437-10459 GAGGGTGAGGGTGGGGGTGGGGG - Intergenic
1049882940 9:10443-10465 GAGGGTGAGGGTGAGGGTGGGGG - Intergenic
1050153687 9:2643316-2643338 GCTGATGGGGATGCAGGAGGAGG - Exonic
1050475904 9:6040903-6040925 GAGGAGGAGGAGGAAGGAGGAGG - Intergenic
1051166767 9:14271015-14271037 GAGAATGGGGATGGGGGTGGAGG - Intronic
1051206345 9:14693174-14693196 GCGGATGGGGATGGGGGTGGGGG + Intronic
1051919004 9:22241831-22241853 GAAGATGAGGATGAGGAAGTGGG - Intergenic
1053071782 9:35106192-35106214 GAGGATGAGGATTTGGGGGCGGG - Intronic
1053404173 9:37856706-37856728 GAGGCTGAGGCTGAGGCAGGAGG + Intronic
1053441616 9:38120942-38120964 GAGGAGGAGAAGGTGGGAGGGGG + Intergenic
1053441623 9:38120964-38120986 GAGGAGAAGGAGGAGGGAGGAGG + Intergenic
1053482079 9:38423525-38423547 GAAGTTGAGGATGCAGGAGGAGG - Intronic
1054293511 9:63317739-63317761 GAAGGTGAAGATGCGGGGGGGGG + Intergenic
1055080276 9:72261828-72261850 GAGGAGGAGGAAGAAGGAGGAGG - Intergenic
1055467077 9:76576510-76576532 GGCGATGAGGTTGAGGGAGGTGG + Intergenic
1056040518 9:82660701-82660723 GAGGAGGAGGAGGAGGAAGGAGG + Intergenic
1056040521 9:82660704-82660726 GAGGAGGAGGAGGAAGGAGGGGG + Intergenic
1056240098 9:84636734-84636756 GAGGAGGAGGAGGAGGGAGGGGG - Intergenic
1056433652 9:86554105-86554127 GAGGAGGAGGAGGAGGGAGAGGG - Intergenic
1056436668 9:86581139-86581161 AAGGGAGAGGATGCTGGAGGAGG - Intergenic
1056530341 9:87481047-87481069 GAGGATGAGGCTGGGTGTGGTGG - Intergenic
1057195844 9:93115407-93115429 GAGGAAGGAGATGAGGGAGGGGG + Intergenic
1057390836 9:94640214-94640236 GGGGGTCAGGATGCGGGCGGTGG - Exonic
1057396043 9:94681440-94681462 GAGGAGGAGGATGGTGGCGGTGG - Intergenic
1057729869 9:97599001-97599023 GATGATGAGGATGCAGGGAGGGG - Intronic
1057885591 9:98827301-98827323 GAGGCTGAGGAGGAGTGAGGAGG - Intronic
1058457275 9:105149113-105149135 GAAGATGATGATCCGTGAGGTGG - Intergenic
1058561431 9:106233129-106233151 GAGGAGGAGGAAGGAGGAGGAGG - Intergenic
1059072424 9:111152818-111152840 GAGGCGGAGGAGGAGGGAGGAGG + Intergenic
1059072428 9:111152834-111152856 GAGGAGGAGGAAGAGGAAGGAGG + Intergenic
1059072430 9:111152840-111152862 GAGGAAGAGGAAGGAGGAGGAGG + Intergenic
1059072443 9:111152891-111152913 GAGGTGGAGGAGGAGGGAGGAGG + Intergenic
1059072448 9:111152907-111152929 GAGGAGGAGGAGGAAGGAGGAGG + Intergenic
1059072449 9:111152910-111152932 GAGGAGGAGGAAGGAGGAGGAGG + Intergenic
1059072453 9:111152923-111152945 GAGGAGGAGGAGGAAGGAGGAGG + Intergenic
1059072456 9:111152936-111152958 AAGGAGGAGGAAGCAGGAGGAGG + Intergenic
1059072461 9:111152952-111152974 GAGGAGGAGGAAGGAGGAGGAGG + Intergenic
1059072465 9:111152965-111152987 GAGGAGGAGGAGGAAGGAGGAGG + Intergenic
1059072466 9:111152968-111152990 GAGGAGGAGGAAGGAGGAGGAGG + Intergenic
1059072470 9:111152981-111153003 GAGGAGGAGGAAGGAGGAGGAGG + Intergenic
1059072474 9:111152994-111153016 GAGGAGGAGGAAGGAGGAGGAGG + Intergenic
1059072478 9:111153007-111153029 GAGGAGGAGGAGGAAGGAGGAGG + Intergenic
1059235181 9:112754874-112754896 GAGATTGAGGATGTGGGAGGAGG - Intronic
1059449195 9:114359708-114359730 GAGGAGGAGGAAGAGGGGGGAGG - Exonic
1059642491 9:116231329-116231351 GAAGATAAGGAAGGGGGAGGAGG - Intronic
1059823219 9:117997229-117997251 GAGGAGGAGGAGGAAGGAGGAGG - Intergenic
1059823223 9:117997242-117997264 GAGGAGGAGGAAGGAGGAGGAGG - Intergenic
1059823224 9:117997245-117997267 GAGGAGGAGGAGGAAGGAGGAGG - Intergenic
1059823225 9:117997248-117997270 GAGGAGGAGGAGGAGGAAGGAGG - Intergenic
1060141509 9:121214279-121214301 GAGGAAGAGGAAGAAGGAGGAGG - Intronic
1060237254 9:121873605-121873627 GAGGAGGAGGAGGCGGGACTGGG - Intronic
1060269061 9:122128408-122128430 GAGGAGGAGGATGCCGGGGTGGG - Intergenic
1060277295 9:122191855-122191877 GAGGGGGAGCCTGCGGGAGGAGG - Intronic
1060319801 9:122547524-122547546 GAGGATGGGAAGGTGGGAGGGGG - Intergenic
1060623574 9:125090334-125090356 GAGGATGTGGAGGAGAGAGGAGG + Intronic
1060623586 9:125090401-125090423 GAGGATGATGAGGAAGGAGGAGG + Intronic
1060698616 9:125731390-125731412 GAGGAAAAGGAAGCAGGAGGGGG - Intergenic
1060952545 9:127612935-127612957 GAGGATGGGGGTGCGGGGGAGGG - Intronic
1060960965 9:127680407-127680429 GAGGAACGGGATGCTGGAGGGGG - Intronic
1061084750 9:128392461-128392483 AAGGACGAGGATGCGGATGGCGG + Intergenic
1061127040 9:128683716-128683738 TGGGATGAGGCTGGGGGAGGGGG + Exonic
1061621355 9:131813226-131813248 AAGGATGAGGTGGCAGGAGGAGG + Intergenic
1061655924 9:132090054-132090076 GAGGATGAGGTTAAGGGTGGTGG - Intergenic
1061899677 9:133666497-133666519 GAGGAGGAGGGAGAGGGAGGAGG - Intronic
1061900052 9:133668355-133668377 GAGAATGAGGGTGAGGGAGAGGG - Intronic
1061967637 9:134025257-134025279 GAGGAGGAGGAGGGAGGAGGAGG - Intergenic
1062061664 9:134500056-134500078 GAGGAGGAGGAGGAGGAAGGGGG - Intergenic
1062074716 9:134579696-134579718 GAGGAGGAGGAGGAGGGAGGAGG + Intergenic
1062074717 9:134579699-134579721 GAGGAGGAGGAGGGAGGAGGAGG + Intergenic
1062123627 9:134847877-134847899 GAGGAAGGGGAAGTGGGAGGGGG + Intergenic
1062139302 9:134947202-134947224 GTGGGTGAGGAAGCGGGGGGGGG - Intergenic
1062165346 9:135104805-135104827 GAGGAGCAGGAGGCAGGAGGTGG - Intronic
1062315737 9:135966307-135966329 GAGGCTGAGGCTGAGGGATGGGG - Intergenic
1062335709 9:136065733-136065755 GAGGTTGAGGCTGCAGGAAGGGG + Intronic
1062445994 9:136595111-136595133 GAGGAAGAGGAAGAAGGAGGAGG + Intergenic
1062469703 9:136697004-136697026 GAGGAGGAGGAGGGGGAAGGAGG - Intergenic
1062469717 9:136697036-136697058 GAGGAGGGGGAGGGGGGAGGAGG - Intergenic
1062469728 9:136697055-136697077 GAGGAGGGGGAGGGGGGAGGAGG - Intergenic
1062523673 9:136969851-136969873 GAGGATGGGGGTGGGGAAGGGGG - Intronic
1062640421 9:137515744-137515766 GAGGAGGGGGATGTGGGAGGCGG - Intronic
1062658164 9:137614715-137614737 GAGGCTGAGGCTGCGGCTGGCGG + Exonic
1185449523 X:275098-275120 GAGGAGGAGGAGGGAGGAGGGGG + Intergenic
1185499044 X:583937-583959 GAGGAGGAGGAGGCTGGAGGAGG + Intergenic
1185499091 X:584126-584148 GAAGAGGAGGAGGCTGGAGGAGG + Intergenic
1185499116 X:584226-584248 GAAGAGGAGGAGGCTGGAGGAGG + Intergenic
1185499117 X:584229-584251 GAGGAGGAGGCTGGAGGAGGAGG + Intergenic
1185499144 X:584326-584348 GAAGAGGAGGAGGCTGGAGGAGG + Intergenic
1185499145 X:584329-584351 GAGGAGGAGGCTGGAGGAGGAGG + Intergenic
1185575567 X:1169288-1169310 GAGGAGGAGGAGGGAGGAGGAGG + Intergenic
1185603554 X:1354843-1354865 GAGGAGGAGGAGGCGGGGGAGGG + Intronic
1185608495 X:1380566-1380588 GAGGGGGAGGGTGGGGGAGGGGG + Intronic
1185610905 X:1393011-1393033 AAGGGAGAGGAGGCGGGAGGAGG - Intergenic
1185662080 X:1735757-1735779 GAGAAAGAGGAGGAGGGAGGAGG - Intergenic
1185755766 X:2651914-2651936 GAGAAAGAAGATGAGGGAGGGGG - Intergenic
1185830103 X:3293296-3293318 GAGGAGGAGGATGAGGCAGGAGG + Intergenic
1185830104 X:3293299-3293321 GAGGAGGATGAGGCAGGAGGAGG + Intergenic
1185838685 X:3368712-3368734 GAGAATGAGAATGAGGGATGAGG - Intergenic
1186124720 X:6400931-6400953 GAGGAAGAGGAAGAAGGAGGAGG - Intergenic
1186239806 X:7554139-7554161 GAGGAAGAGGAGGAGGAAGGAGG + Intergenic
1186249799 X:7653325-7653347 GAGGAGGAGGAGGAGGAAGGAGG - Intergenic
1186270892 X:7886910-7886932 GAGGTTGATGATGCCGGAGAGGG + Intergenic
1186451429 X:9677084-9677106 AAGGATGAGGAAGTGGGAGCCGG - Intronic
1186512306 X:10139115-10139137 GAGGCTGCGGGTGCTGGAGGAGG + Intronic
1186653894 X:11592152-11592174 GAGGAGGAAGATGGGGGAAGGGG + Intronic
1187026594 X:15441669-15441691 GAGGATGAGGGGGAGGCAGGAGG + Intronic
1187515021 X:19961045-19961067 AAGGAAGAGGAGGAGGGAGGAGG - Intronic
1187551327 X:20308868-20308890 AAGGATGAAGATGGGGGAGACGG - Intergenic
1187736914 X:22314148-22314170 GAGGAGGAGGAGGAGGGAGGAGG + Intergenic
1187947026 X:24436020-24436042 TAGGATAAGGATGAGGTAGGAGG - Intergenic
1188303624 X:28535314-28535336 GAGGAGGAGGAAGTGGAAGGAGG - Intergenic
1188344373 X:29045908-29045930 GAGGAGGAGGAAGAAGGAGGAGG - Intronic
1188344379 X:29045930-29045952 GAGGAGGAGGAAGAAGGAGGAGG - Intronic
1188400055 X:29733047-29733069 GAGGAAGAGGATGAGAGGGGAGG + Intronic
1188530284 X:31132845-31132867 CAGAATGGGGATGCGGGTGGCGG + Intronic
1188677846 X:32965077-32965099 GAGAACGAGGATGAGGGAGGAGG + Intronic
1188857288 X:35211876-35211898 GATGGAGAGGATGGGGGAGGGGG - Intergenic
1189364738 X:40379943-40379965 CAGGAGGAGGAAGAGGGAGGAGG - Intergenic
1189806202 X:44737728-44737750 GAGGGTGGGGTTGTGGGAGGAGG + Intergenic
1190212511 X:48459605-48459627 GAGGATGAAGATGAGGCTGGGGG + Exonic
1191951895 X:66601830-66601852 GAGGACAAAGATGGGGGAGGTGG - Intronic
1192026010 X:67452516-67452538 GAGGAGGAGGAGGAGGAAGGAGG + Intergenic
1192213975 X:69145081-69145103 GGGGGTGAGGAGGAGGGAGGGGG + Intergenic
1192533644 X:71910797-71910819 GAGGAGGAGGAGGGGGGAGGAGG + Intergenic
1192547208 X:72023946-72023968 GATGGTGAGGATGAAGGAGGAGG + Intergenic
1192630469 X:72774046-72774068 GAGGAAGAAGATGAAGGAGGAGG + Intergenic
1192651241 X:72946758-72946780 GAGGAAGAAGATGAAGGAGGAGG - Intergenic
1192847994 X:74925484-74925506 GAGGAGGAGGAAGGGGGAGGAGG - Intronic
1193221767 X:78934973-78934995 GAGGAAGGGGCTGCGGGAGGGGG + Intergenic
1194973833 X:100373286-100373308 GAGAAGGAGGCTGGGGGAGGTGG - Intronic
1194992924 X:100564087-100564109 GGGGAGGTGGATGGGGGAGGGGG + Intergenic
1195294588 X:103463491-103463513 GAGGAAGAGGAAGAAGGAGGAGG + Intergenic
1195696228 X:107669606-107669628 GAGGAGGAGGAGGGGGAAGGGGG - Intergenic
1195751006 X:108161981-108162003 GAGGATGAGAAGAAGGGAGGAGG - Intronic
1196657335 X:118232208-118232230 GAGGAAGAGGAAGGAGGAGGGGG + Intergenic
1196657346 X:118232232-118232254 GAGGAAGGGGAGGGGGGAGGAGG + Intergenic
1197605835 X:128584129-128584151 GAGGAGGAGGAGGAGGAAGGAGG + Intergenic
1198155138 X:133952393-133952415 GATGATGATGATGATGGAGGTGG - Intronic
1198517828 X:137427062-137427084 GAGGAAGGGGATGGGGGAGGGGG + Intergenic
1198685867 X:139227412-139227434 GAGGAGGAGGAGGCTGAAGGAGG + Intergenic
1200229708 X:154437771-154437793 GACGATGAGGAGGCGGGCTGAGG - Intronic
1201739702 Y:17310936-17310958 GAGGAGGAGAAGGGGGGAGGAGG - Intergenic
1202274377 Y:23100263-23100285 GAGGAGGAGGGAGGGGGAGGAGG - Intergenic
1202274379 Y:23100269-23100291 GAGGAGGAGGAGGAGGGAGGGGG - Intergenic
1202291648 Y:23320402-23320424 GAGGAGGAGGAGGAGGGAGGGGG + Intergenic
1202291650 Y:23320408-23320430 GAGGAGGAGGGAGGGGGAGGAGG + Intergenic
1202427370 Y:24734014-24734036 GAGGAGGAGGGAGGGGGAGGAGG - Intergenic
1202427372 Y:24734020-24734042 GAGGAGGAGGAGGAGGGAGGGGG - Intergenic
1202443419 Y:24936074-24936096 GAGGAGGAGGAGGAGGGAGGGGG + Intergenic
1202443421 Y:24936080-24936102 GAGGAGGAGGGAGGGGGAGGAGG + Intergenic