ID: 1168289983

View in Genome Browser
Species Human (GRCh38)
Location 19:55352913-55352935
Sequence GACAGCGGCCTCTGCGGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 126}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168289983 Original CRISPR GACAGCGGCCTCTGCGGGGT GGG Intronic
900352127 1:2240169-2240191 GACAGCAGCCTCTGTGGTGGGGG - Intronic
900701157 1:4049457-4049479 GACAGTGGCCTCTACTGAGTGGG + Intergenic
901047354 1:6405220-6405242 GGCTCCGGCCTCTGCTGGGTGGG - Intergenic
901934850 1:12619922-12619944 GACACCAGCCGCTGCTGGGTGGG - Intergenic
902622000 1:17656126-17656148 GAGAGCAGCCTCTGCAGGGCTGG + Intronic
903808156 1:26020075-26020097 GACAGCGAGCTCTGGAGGGTGGG + Intronic
906678104 1:47708023-47708045 GACAGCGGGATCTGGGGGGAAGG - Intergenic
910387878 1:86704756-86704778 GACAGCTGCGGCTGCGGGGCTGG + Intronic
912413608 1:109493987-109494009 CACAGCGCCCTCTGGGGGCTGGG - Intergenic
914680658 1:149936278-149936300 GGCAGCTGCCTCTGGGGAGTTGG - Intronic
915091640 1:153430268-153430290 GACAGTGGCTCCTGCGGGGCAGG - Intergenic
918248952 1:182684738-182684760 GACAGCTGCCTCCGAGGGGCTGG + Intergenic
922185067 1:223266989-223267011 GACAGAGGCCTCTGAGGAGGAGG + Intronic
923687155 1:236161276-236161298 GACAGCGGCCTCTTCCTGGCTGG + Intronic
1067799241 10:49347640-49347662 GTGAGCTGCCTCTGCGGAGTAGG - Intergenic
1069991594 10:72319788-72319810 GTCAGCGGGCGCTGGGGGGTGGG + Intergenic
1070161008 10:73866748-73866770 GACGGCGGCCTCTGCTGCTTGGG - Intronic
1070569156 10:77627983-77628005 GAGAGTGGCCTCTGCTGGCTGGG - Intronic
1071502126 10:86211601-86211623 GACAGCGGACTCTCAGGGGTGGG + Intronic
1072294207 10:93993907-93993929 GACAGCGGCGGCTGCGCGGGCGG - Intergenic
1073249795 10:102114588-102114610 GACAGCGGCCGCCGCGGGGCGGG - Intronic
1074825210 10:117209719-117209741 GACAGCTTCATCTGCGGGCTTGG - Exonic
1074827606 10:117225792-117225814 GAAAGAGGGCTCTGAGGGGTCGG + Intergenic
1076876445 10:133218476-133218498 GACAGCGGCCTCTCCCTGGGTGG + Intronic
1078023215 11:7672402-7672424 GACTGGGGCCTCTGGGGGCTAGG - Intronic
1078667729 11:13340289-13340311 GACAGCTGCTGCTGAGGGGTGGG - Intronic
1080488926 11:32741814-32741836 CACAGGGGCCTGTGGGGGGTGGG - Intronic
1081671720 11:44946215-44946237 CACAGCGGCCTCTGGGGTGCAGG + Intronic
1091582274 12:1797117-1797139 GGCTGCGGCCTCGGCGGGGTGGG + Intronic
1092181048 12:6447222-6447244 GACAGCGGCCCCGGCAGGGTTGG + Intronic
1095753082 12:45730826-45730848 GACAGCGACGTCCGCGGGTTGGG - Intronic
1095950377 12:47778459-47778481 GACTGTGGCCTCTGAGGGCTGGG + Intronic
1097566801 12:61280440-61280462 CACAGGGGCCTGTGGGGGGTGGG + Intergenic
1100423485 12:94460083-94460105 GACAGCGGCAGCGGCGGGGCCGG + Intergenic
1101997718 12:109536944-109536966 GACAGCTGCCTCTGGGAAGTGGG - Intergenic
1104739668 12:131163674-131163696 GACAGCGGGCTCTGAGGGCTCGG + Intergenic
1104792797 12:131494237-131494259 GACAGCGGGCTCCACGGGCTTGG - Intergenic
1105447493 13:20470328-20470350 GGCAGCGGCCGCTGCAGGGAAGG + Intronic
1108359966 13:49659960-49659982 GCCTGCAGCCTCTGCAGGGTAGG + Intergenic
1112506589 13:99979914-99979936 GGCAGCGGCCCCTGCGTGGAAGG - Intergenic
1113279855 13:108777495-108777517 GGCAGTGGCCTCTGCATGGTGGG + Intronic
1114438226 14:22725976-22725998 GACAGCAGCCTCTGTGGACTGGG - Intergenic
1115754278 14:36517678-36517700 GACAGCGGCGGCGGCGGGGGCGG - Exonic
1117842164 14:59870841-59870863 GGCAGCGGCCGCGGCGGGGCCGG - Exonic
1119555053 14:75546732-75546754 GACAGGGGCCTCTGCGGGATGGG - Exonic
1121118988 14:91364138-91364160 GACAGAGGCCTCAGCGAGGCTGG - Intronic
1121253619 14:92516381-92516403 GACAGGGGGCTCTTCTGGGTGGG + Intronic
1122040547 14:98984774-98984796 GTCAGCGGCCTCTGCAGGGCTGG + Intergenic
1123021436 14:105399532-105399554 GACAGCGGCCTCAGGCGGGCTGG - Intronic
1129600678 15:76996487-76996509 CAGAGCGTCCTCTTCGGGGTTGG - Intronic
1132712914 16:1277181-1277203 GAGAGCGGCCGGGGCGGGGTTGG + Intergenic
1132729631 16:1355054-1355076 GTCTGCCGCGTCTGCGGGGTCGG + Intronic
1132729648 16:1355118-1355140 GTCTCCCGCCTCTGCGGGGTCGG + Intronic
1132896409 16:2231323-2231345 GACAGAGGCCTCTGATGGGGAGG - Intronic
1134683653 16:16143936-16143958 GTCAGCTGCCTCTCCAGGGTAGG + Intergenic
1135572177 16:23557699-23557721 CCCAGCGGCCTCTGCGGGAGCGG + Exonic
1135707411 16:24686742-24686764 GACAGAGGCCTCTGCAGGGGTGG + Intergenic
1137273193 16:46916488-46916510 GAGGGGGGCCTCTGCGGGGAGGG + Intronic
1139546625 16:67652853-67652875 GACAGCGGCGGCGGCGGGGGAGG + Intronic
1141699802 16:85637186-85637208 GACAGCGGCCGCCGGGGGCTGGG - Intronic
1142150352 16:88509938-88509960 GACAGGGGCCTCTGGGGCCTCGG + Intronic
1142590745 17:1004722-1004744 GACAGCCGCCTCTAGGGGCTGGG - Exonic
1143452372 17:7043509-7043531 GTCATCGCCGTCTGCGGGGTGGG + Exonic
1144854075 17:18258495-18258517 GACTGCGGCCGGGGCGGGGTGGG - Intronic
1147015690 17:37489883-37489905 GCCACCGGCTTCTGCGGGCTGGG - Exonic
1147015827 17:37490301-37490323 GTAGGCGGCCTCAGCGGGGTCGG - Intronic
1147705953 17:42424879-42424901 GTCAGCTGCCTCTGAGGGGGCGG - Intergenic
1151418439 17:73982025-73982047 GACAGCGGGGGCTGCGGGGAGGG - Intergenic
1151941610 17:77295792-77295814 GAAAGGGGCCTCCGTGGGGTGGG - Intronic
1152498891 17:80695048-80695070 GACATGGGCCTGTGCGGGGCTGG + Intronic
1158126259 18:54102635-54102657 GAGAGGGGCCTCTGAGGGATTGG + Intergenic
1158884701 18:61816029-61816051 AACAGCAGCCTCTGCAAGGTGGG - Exonic
1161861537 19:6801754-6801776 GACAGAGGCCTCTGGGGTCTGGG - Intronic
1163269014 19:16238644-16238666 GACTGGGGCCTCTGCTGTGTTGG + Intronic
1163681140 19:18683399-18683421 GACAGCGGCCTCTGGGCTGTTGG - Intergenic
1164690196 19:30205164-30205186 GACAGAGGCCTCTGTGGTGAGGG - Intergenic
1164869324 19:31630097-31630119 GCCAGAGGCCTCTGCGGGCAGGG - Intergenic
1167308068 19:48720187-48720209 GGCAGGGGCCTCTGGGGTGTTGG + Intergenic
1168289983 19:55352913-55352935 GACAGCGGCCTCTGCGGGGTGGG + Intronic
925149465 2:1605328-1605350 GAGAGCGGCCTCTGCGCGCCGGG + Intergenic
925412799 2:3649697-3649719 GACAGCGTCCTCTCCAGGGCTGG - Intergenic
926142116 2:10373911-10373933 CACAGGGGCTTCTGCGGGGTTGG + Intronic
928175956 2:29034563-29034585 GACAGTGGGCTCTGCTGGATGGG + Intronic
930634343 2:53787641-53787663 GAAAGCTGCTTCTGCAGGGTGGG - Intronic
931021310 2:58047272-58047294 GTCAGGGGCCGCGGCGGGGTTGG + Intronic
931591497 2:63888582-63888604 GATGGCGGCCTGTGCAGGGTTGG - Intronic
935645344 2:105329707-105329729 GGAAGCGGCGGCTGCGGGGTCGG - Exonic
937841216 2:126526531-126526553 GGCAGAAGCCTCTGCAGGGTTGG - Intergenic
944535524 2:200705815-200705837 GACAGCGACATCTGCAGGGTGGG - Intergenic
946153127 2:217789594-217789616 TACAGGTGCCTCAGCGGGGTGGG + Intergenic
948892929 2:240915981-240916003 GCCCGGGGCCTCTGCGGGGTGGG - Intergenic
1170816813 20:19720929-19720951 GGCAGCAGCCTTTGGGGGGTTGG - Intronic
1171310292 20:24140000-24140022 TACAGAGGGCTGTGCGGGGTGGG + Intergenic
1171972134 20:31571023-31571045 TACAGTGGCCTCTGCGGTGCCGG - Exonic
1175312429 20:58020960-58020982 GACATCTGCCACTGCGGGCTGGG - Intergenic
1176049584 20:63110817-63110839 GCCACCTGCCTCTGCAGGGTGGG + Intergenic
1176887505 21:14273964-14273986 GACAGCTGACTCTGCCGGGGCGG + Intergenic
1183179775 22:36252265-36252287 GGCAGTGGCCTCTGCTGGGGAGG + Intergenic
1183261101 22:36796548-36796570 GACAGGGGACTCAGCGGGGAAGG - Intergenic
1184387734 22:44185924-44185946 GGCAGCGGCCTCCACGGGGCGGG + Intronic
1185333412 22:50261527-50261549 GCCCGCAGGCTCTGCGGGGTGGG - Exonic
1185380917 22:50507256-50507278 GGCAGTGGGCTCTGCTGGGTGGG - Intronic
951149187 3:19267106-19267128 CACAGCCGCCTCTGGGAGGTTGG + Intronic
952451855 3:33440329-33440351 CAGAGCGGCGTCGGCGGGGTTGG - Exonic
961531349 3:127542243-127542265 GACTGAGGGCTCTGCGTGGTAGG + Intergenic
961865391 3:129950077-129950099 GACAGGGGCCTCTGCTGAGATGG - Intergenic
966724761 3:183099416-183099438 GGCGGCGGCCTCTGCGGTGTCGG - Exonic
968756130 4:2417515-2417537 GCCAGCAGCCTCGGCGGGGCGGG - Intronic
968894121 4:3388738-3388760 GACAGGAGCCTGGGCGGGGTCGG + Intronic
969262969 4:6045231-6045253 GACACCGGCCTCAGCCAGGTGGG - Intronic
969533180 4:7740665-7740687 GGCCCCGGCCTCTGCGGGGAAGG - Exonic
976866291 4:89731406-89731428 AACAGCGTCCTGTCCGGGGTGGG + Intronic
981034239 4:140153239-140153261 AACAGCAGCCTCGGCGGGGCCGG - Exonic
985025768 4:185737657-185737679 GGCGGCTGCCTCTGCGGGGATGG + Intronic
985537590 5:473622-473644 GACAGCGGCCTCCTCGGCGCAGG + Intronic
1001330662 5:170760202-170760224 GGCAGGGGCCCCTGTGGGGTTGG + Intergenic
1002399421 5:178983283-178983305 GACAGAGGCCCCTGCGGGTCAGG + Intronic
1002569163 5:180130265-180130287 GCCTGCTTCCTCTGCGGGGTAGG + Intronic
1006295369 6:33167733-33167755 GACGGAGGCATCTGAGGGGTGGG + Intronic
1013793646 6:113860290-113860312 GACAGCGGCCTCCTGGGGCTTGG - Exonic
1016200118 6:141395789-141395811 GCCAGCTGCTGCTGCGGGGTGGG - Intergenic
1018288352 6:162264677-162264699 CACAGTGGCCTCTGCTGAGTAGG - Intronic
1018442025 6:163822245-163822267 GGCAGCTGCCTCTGCAGGATGGG + Intergenic
1018453073 6:163926904-163926926 GGCAGCTGCCTCTGCTGGGAAGG + Intergenic
1019414241 7:920094-920116 GAGAGCGGCGTGTGCTGGGTCGG - Intronic
1019513216 7:1428847-1428869 GACAAAGGCCTCTGCCGGGAGGG + Intronic
1026986069 7:74555746-74555768 GTCAGCTACCTCTGGGGGGTGGG - Intronic
1027202494 7:76072605-76072627 GACAGCGGCCTCTCCGGGCCCGG - Intergenic
1028922405 7:96322273-96322295 AGCGGCGGCCTCTGCGGCGTGGG + Intergenic
1034351161 7:150415711-150415733 GACAGGGGCCTCTGGGGTGTGGG + Intergenic
1044734795 8:95268737-95268759 GACTGCGGGCTCTGCGGGCGGGG + Intronic
1045971446 8:108083335-108083357 TCCAGCGGCCGCCGCGGGGTTGG + Exonic
1049219309 8:141421627-141421649 GACAGCGGCCTCTGACGTGTGGG - Exonic
1050416005 9:5418545-5418567 GACAGCAGCCTCTGCAAGGCAGG - Intronic
1061289423 9:129642214-129642236 GACAGCGCCCCCTGCGGGCTCGG + Intergenic
1061637805 9:131925763-131925785 GACAGCAGCTCCTGCGGGGGCGG + Intronic
1061860702 9:133467343-133467365 GGCTGCGGGGTCTGCGGGGTCGG - Intronic
1062100354 9:134724800-134724822 GAGAGGGGCCTCGGCGGGGGAGG + Intronic
1062339288 9:136086799-136086821 GACAGCAGCCGCTGCTGGGATGG - Intronic
1187247818 X:17568821-17568843 CACTGGGGCCTCTGTGGGGTGGG - Intronic
1190224268 X:48533534-48533556 GACGGGGGCATCTGTGGGGTGGG - Intergenic
1192427831 X:71093053-71093075 GACAGCAACCTCTGAGGGGCAGG - Intergenic
1194765521 X:97843251-97843273 GACAGTGGCCCCTGCCGGGGAGG - Intergenic
1200564753 Y:4751613-4751635 AACCGCGGCCTGTGTGGGGTTGG - Intergenic