ID: 1168290090

View in Genome Browser
Species Human (GRCh38)
Location 19:55353352-55353374
Sequence GACAGCTACGAGCCAGCCCA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 100}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168290090_1168290099 18 Left 1168290090 19:55353352-55353374 CCCTGGGCTGGCTCGTAGCTGTC 0: 1
1: 0
2: 1
3: 9
4: 100
Right 1168290099 19:55353393-55353415 GCTGGAATGGAGAGGGAGAAGGG 0: 1
1: 0
2: 18
3: 142
4: 983
1168290090_1168290101 20 Left 1168290090 19:55353352-55353374 CCCTGGGCTGGCTCGTAGCTGTC 0: 1
1: 0
2: 1
3: 9
4: 100
Right 1168290101 19:55353395-55353417 TGGAATGGAGAGGGAGAAGGGGG 0: 1
1: 2
2: 17
3: 164
4: 1594
1168290090_1168290100 19 Left 1168290090 19:55353352-55353374 CCCTGGGCTGGCTCGTAGCTGTC 0: 1
1: 0
2: 1
3: 9
4: 100
Right 1168290100 19:55353394-55353416 CTGGAATGGAGAGGGAGAAGGGG 0: 1
1: 0
2: 9
3: 127
4: 1010
1168290090_1168290093 0 Left 1168290090 19:55353352-55353374 CCCTGGGCTGGCTCGTAGCTGTC 0: 1
1: 0
2: 1
3: 9
4: 100
Right 1168290093 19:55353375-55353397 AACGCGAGGCATCTACCTGCTGG 0: 1
1: 0
2: 0
3: 3
4: 39
1168290090_1168290098 17 Left 1168290090 19:55353352-55353374 CCCTGGGCTGGCTCGTAGCTGTC 0: 1
1: 0
2: 1
3: 9
4: 100
Right 1168290098 19:55353392-55353414 TGCTGGAATGGAGAGGGAGAAGG 0: 1
1: 0
2: 7
3: 97
4: 812
1168290090_1168290103 25 Left 1168290090 19:55353352-55353374 CCCTGGGCTGGCTCGTAGCTGTC 0: 1
1: 0
2: 1
3: 9
4: 100
Right 1168290103 19:55353400-55353422 TGGAGAGGGAGAAGGGGGACGGG 0: 1
1: 0
2: 16
3: 197
4: 2013
1168290090_1168290095 10 Left 1168290090 19:55353352-55353374 CCCTGGGCTGGCTCGTAGCTGTC 0: 1
1: 0
2: 1
3: 9
4: 100
Right 1168290095 19:55353385-55353407 ATCTACCTGCTGGAATGGAGAGG 0: 1
1: 0
2: 1
3: 10
4: 154
1168290090_1168290102 24 Left 1168290090 19:55353352-55353374 CCCTGGGCTGGCTCGTAGCTGTC 0: 1
1: 0
2: 1
3: 9
4: 100
Right 1168290102 19:55353399-55353421 ATGGAGAGGGAGAAGGGGGACGG 0: 1
1: 1
2: 64
3: 772
4: 3725
1168290090_1168290104 28 Left 1168290090 19:55353352-55353374 CCCTGGGCTGGCTCGTAGCTGTC 0: 1
1: 0
2: 1
3: 9
4: 100
Right 1168290104 19:55353403-55353425 AGAGGGAGAAGGGGGACGGGAGG 0: 1
1: 1
2: 10
3: 239
4: 2261
1168290090_1168290094 5 Left 1168290090 19:55353352-55353374 CCCTGGGCTGGCTCGTAGCTGTC 0: 1
1: 0
2: 1
3: 9
4: 100
Right 1168290094 19:55353380-55353402 GAGGCATCTACCTGCTGGAATGG 0: 1
1: 0
2: 1
3: 9
4: 126
1168290090_1168290096 11 Left 1168290090 19:55353352-55353374 CCCTGGGCTGGCTCGTAGCTGTC 0: 1
1: 0
2: 1
3: 9
4: 100
Right 1168290096 19:55353386-55353408 TCTACCTGCTGGAATGGAGAGGG 0: 1
1: 0
2: 1
3: 20
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168290090 Original CRISPR GACAGCTACGAGCCAGCCCA GGG (reversed) Exonic
900343120 1:2197917-2197939 GACAGCTGCCTGCCAGCCGAGGG + Intronic
902629182 1:17694767-17694789 GCCAGCTACGAGCAAAACCAGGG - Intronic
905277080 1:36825311-36825333 GACCTCTACGAGCCTGCCAATGG + Intronic
906918773 1:50040853-50040875 AACACCTACAAGACAGCCCAGGG - Intergenic
910766424 1:90787149-90787171 GACAGACACCAGCCAGCCAAGGG - Intergenic
915268008 1:154732472-154732494 GAAAGGCAAGAGCCAGCCCAGGG + Intronic
916584953 1:166142344-166142366 GACAGCTACCACCCAGGCCTGGG + Intronic
916689236 1:167174561-167174583 CACAGCTCAGAGCCACCCCACGG - Intergenic
917735454 1:177915890-177915912 GAGAGCAACGAGCCAGGCCAAGG - Intergenic
919746906 1:201014439-201014461 GACAGGGAGGAGGCAGCCCAGGG + Intronic
921033495 1:211354297-211354319 GACAGGGACCAGCCTGCCCAGGG + Intronic
921945712 1:220884663-220884685 AAAAGCCCCGAGCCAGCCCAAGG + Exonic
922041908 1:221904985-221905007 GACAGCTACTATCAAGTCCAGGG + Intergenic
923055766 1:230425484-230425506 GACACCCACAAGCCAGCCCACGG + Intronic
1067088146 10:43253596-43253618 TACAGCTCCGAGCCAGCCACAGG - Intronic
1067148799 10:43712619-43712641 TACAGGTACAAGCCAGGCCAGGG + Intergenic
1067544186 10:47181063-47181085 GGCAGCTTCGAAACAGCCCAAGG + Intergenic
1069550996 10:69364105-69364127 TACCGCTACCACCCAGCCCAAGG - Intronic
1071954344 10:90741622-90741644 TACAGTTATGGGCCAGCCCATGG + Exonic
1076742853 10:132496534-132496556 GTCTGCTACGTGCCAGCCAAGGG - Intergenic
1078317026 11:10302887-10302909 GACAGCTAGGCGTCGGCCCACGG - Intergenic
1080087402 11:28301108-28301130 GACAGGTAGGAGCCAGTTCATGG - Intronic
1080773708 11:35366057-35366079 GAGAGCTACCATCCAGACCAGGG - Intronic
1087659993 11:100976148-100976170 GTCAGCTTCCTGCCAGCCCAGGG + Exonic
1091408118 12:221445-221467 CAGAGCCAGGAGCCAGCCCAGGG + Exonic
1103142331 12:118559620-118559642 CACAGCTCTGAGCCAGCCGAGGG + Intergenic
1104097124 12:125567970-125567992 GACACCTCGGAGCCAGCCCAGGG + Intronic
1107332051 13:39311862-39311884 GACAGCTACCAGGAAGCCAAAGG - Intergenic
1108283225 13:48880033-48880055 GACAGCTGCCAGCCGGCCCCAGG + Intergenic
1116658659 14:47680017-47680039 GACATCAACGATCCAGCCTAGGG - Intergenic
1119172567 14:72546102-72546124 GACAGCAACAAGCTGGCCCAGGG - Intronic
1120203806 14:81566745-81566767 GATAGCTGCAAGCCAGCCCCTGG - Intergenic
1120256011 14:82120606-82120628 GCAAGCTAAGAGCCTGCCCAAGG + Intergenic
1122147164 14:99698299-99698321 GACGGCTATGATCCAGACCAAGG - Intronic
1123050734 14:105540809-105540831 GACAGCATCCAGCCTGCCCAGGG - Intergenic
1124882769 15:33657509-33657531 GAAATCTGGGAGCCAGCCCAGGG + Intronic
1127298805 15:57632836-57632858 CACAGCTGCGGGCAAGCCCAGGG - Intronic
1131091590 15:89628449-89628471 AACTGCGACGAGCCAGCCCGGGG - Exonic
1138631100 16:58294802-58294824 GACATCAACTAGCCAGTCCAAGG + Intronic
1139094177 16:63684675-63684697 GACAGCTATGAACTAGCACATGG - Intergenic
1139655543 16:68384976-68384998 CACAGCTATGAGCCAGTCCATGG + Intronic
1141452310 16:84113126-84113148 TACAGCTACTTGCCAGCCTAAGG + Intronic
1141949398 16:87330958-87330980 GAAAACCACCAGCCAGCCCAGGG + Exonic
1142287543 16:89177542-89177564 GACAGCTCCTAGCCAGGCCCGGG + Intronic
1144655486 17:17032549-17032571 GACGGCTACGACCGAGGCCATGG + Intergenic
1151655609 17:75494569-75494591 GACACCCAGGAACCAGCCCAGGG - Intronic
1152193617 17:78903269-78903291 GACAGCTGTGAGCCAGCCAGGGG + Intronic
1160975679 19:1791174-1791196 GTCGGCCAGGAGCCAGCCCAGGG - Intronic
1162940720 19:14007220-14007242 GTCAGCCCCGACCCAGCCCAGGG + Intergenic
1168290090 19:55353352-55353374 GACAGCTACGAGCCAGCCCAGGG - Exonic
926969642 2:18453714-18453736 GCCTGCTAGGAGACAGCCCAGGG + Intergenic
927190619 2:20514502-20514524 GACAGCCCCCAGCCAACCCAAGG + Intergenic
929176653 2:38984942-38984964 GATAGCTACGAGCCATGACATGG + Exonic
929180851 2:39037091-39037113 GTCAACTAAGAGCCAGCTCAAGG - Intronic
934174403 2:89566363-89566385 GGCAGCTACGAGCCTCCTCATGG + Intergenic
934284719 2:91640713-91640735 GGCAGCTACGAGCCTCCTCATGG + Intergenic
936968629 2:118152368-118152390 GACAGCCAGGAGTCAGGCCAAGG + Intergenic
938274756 2:130008453-130008475 GTCAGCTTCCTGCCAGCCCAGGG + Intergenic
938440613 2:131328825-131328847 GTCAGCTTCCTGCCAGCCCAGGG - Intronic
942456045 2:176139234-176139256 AACAGCTGCCTGCCAGCCCAGGG - Intergenic
945000328 2:205343680-205343702 CACAGCTGTGAGCCAGGCCAGGG - Intronic
945033497 2:205685575-205685597 CCCAGCCACGCGCCAGCCCAAGG - Intronic
945994480 2:216424509-216424531 GACAGACACGAGCCAACCCTGGG + Intronic
947842053 2:233214117-233214139 GTGAGCTCAGAGCCAGCCCAGGG + Intronic
1175443393 20:59005721-59005743 GACAGCTGCAAACCAGCCCCAGG - Intronic
1176059084 20:63164346-63164368 GAAAGCTGGGGGCCAGCCCAGGG + Intergenic
1179126441 21:38595289-38595311 GGCTGCCACGATCCAGCCCAAGG + Intronic
1179485962 21:41710946-41710968 GACAGCTACAACTCAGCCCCCGG + Intergenic
1179643403 21:42761282-42761304 GCCAGCTGGGAGCCTGCCCAGGG - Intronic
1180244018 21:46534338-46534360 GACAGTTATGAGGGAGCCCATGG + Intronic
1183619704 22:38965302-38965324 GACTCCCACGAGCCAGCCCAGGG - Intronic
1183833471 22:40432745-40432767 GGCAGCTCTGTGCCAGCCCAGGG + Intronic
1185066470 22:48634877-48634899 GACAGGAAGGAGCCAGCCCATGG + Intronic
949194508 3:1289284-1289306 GACTGGGAGGAGCCAGCCCATGG + Intronic
950422400 3:12906681-12906703 GACAGCCACGTGCCGGCCCCAGG - Intronic
951008263 3:17645414-17645436 GACAGCTGCGAGTCAGCCTCTGG - Intronic
954632963 3:52056753-52056775 GTCAGCTCCGAGCTAGTCCAGGG - Intergenic
954689815 3:52389679-52389701 GGCAGCTCCGAGCCAGGCCCTGG - Intronic
955687911 3:61563473-61563495 GACAGCTACGAGGGAGCTCGGGG - Intronic
956017353 3:64897668-64897690 GACAGATATGAGGCAGTCCATGG - Intergenic
962708020 3:138063494-138063516 GACAGCTCAGAGTCAGCCAAGGG + Intronic
964415552 3:156444131-156444153 GACAGATGCGAGCCAGAACAAGG + Intronic
966940174 3:184741154-184741176 AACAGCTACGAGTGAGCCTAGGG - Intergenic
968735256 4:2291845-2291867 GACAGCCACCAGCCAGTCCATGG + Intronic
973156790 4:46965129-46965151 GACAGCTATGAACCAGTCCATGG + Exonic
981316914 4:143349474-143349496 GACTGCTACACCCCAGCCCAGGG - Intronic
987374208 5:17218512-17218534 AACTGCTCCGAGGCAGCCCACGG - Intronic
990867454 5:60395974-60395996 GATAGCTAAAACCCAGCCCACGG + Intronic
992413685 5:76532723-76532745 GACAAGAACGAGCCAGTCCAGGG - Intronic
995853273 5:116569360-116569382 GACAGATTCAAGCAAGCCCAAGG + Intronic
1000800091 5:165714881-165714903 GACAGATGCTAGCAAGCCCAAGG + Intergenic
1003466222 6:6382608-6382630 GACAGCTTCGTGCAAGCCAAGGG - Intergenic
1005037250 6:21568580-21568602 GACAGCTACAAACAAGCCCAGGG - Intergenic
1006790456 6:36697911-36697933 GAGAGGTAGGAGCCATCCCAAGG + Exonic
1019642915 7:2114301-2114323 GAGAGCCCTGAGCCAGCCCACGG + Intronic
1020137829 7:5596412-5596434 GGCAGCTCTGGGCCAGCCCAAGG - Intronic
1023879553 7:44310423-44310445 GAGAGTTACGTGGCAGCCCAAGG + Intronic
1026594493 7:71723126-71723148 GACAGATAGGATCCATCCCAAGG - Intergenic
1028832681 7:95344276-95344298 GACAGATATGAGCCAGCCCAAGG + Intergenic
1034400083 7:150856478-150856500 GGCAGCCACGGCCCAGCCCAGGG - Exonic
1034530869 7:151695799-151695821 GACAGCTAAGAACAAGGCCAGGG - Intronic
1038428293 8:27479616-27479638 CAGAGCTGCCAGCCAGCCCACGG + Intronic
1040324301 8:46333966-46333988 GAATGCTGCGAGCCTGCCCAAGG + Intergenic
1045630665 8:104117854-104117876 TACAGCTATTAGGCAGCCCAAGG - Intronic
1049005459 8:139852753-139852775 CAGAGCTCCCAGCCAGCCCAAGG - Intronic
1049202001 8:141344921-141344943 CACACCTGAGAGCCAGCCCAGGG - Intergenic
1051606784 9:18924298-18924320 GACCACTTCCAGCCAGCCCAGGG + Intergenic
1053850869 9:42288432-42288454 GAGAGAGACGACCCAGCCCACGG + Intergenic
1056081225 9:83095948-83095970 GACAGCTCCATGCCAGCACATGG + Intergenic
1061401499 9:130370786-130370808 GACACCTAGGAGGGAGCCCATGG - Intronic
1199902462 X:152189841-152189863 GACGGCTATGAACCAGTCCATGG + Exonic