ID: 1168290102

View in Genome Browser
Species Human (GRCh38)
Location 19:55353399-55353421
Sequence ATGGAGAGGGAGAAGGGGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4563
Summary {0: 1, 1: 1, 2: 64, 3: 772, 4: 3725}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168290091_1168290102 23 Left 1168290091 19:55353353-55353375 CCTGGGCTGGCTCGTAGCTGTCA 0: 1
1: 0
2: 0
3: 6
4: 104
Right 1168290102 19:55353399-55353421 ATGGAGAGGGAGAAGGGGGACGG 0: 1
1: 1
2: 64
3: 772
4: 3725
1168290090_1168290102 24 Left 1168290090 19:55353352-55353374 CCCTGGGCTGGCTCGTAGCTGTC 0: 1
1: 0
2: 1
3: 9
4: 100
Right 1168290102 19:55353399-55353421 ATGGAGAGGGAGAAGGGGGACGG 0: 1
1: 1
2: 64
3: 772
4: 3725

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168290102 Original CRISPR ATGGAGAGGGAGAAGGGGGA CGG Intronic
Too many off-targets to display for this crispr