ID: 1168291493

View in Genome Browser
Species Human (GRCh38)
Location 19:55359725-55359747
Sequence GCCCCTGGGGATGGAAGAGT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 403
Summary {0: 1, 1: 1, 2: 4, 3: 44, 4: 353}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168291480_1168291493 11 Left 1168291480 19:55359691-55359713 CCTGGTGGGAGCCCATAGGCCCG 0: 1
1: 0
2: 0
3: 11
4: 104
Right 1168291493 19:55359725-55359747 GCCCCTGGGGATGGAAGAGTAGG 0: 1
1: 1
2: 4
3: 44
4: 353
1168291482_1168291493 0 Left 1168291482 19:55359702-55359724 CCCATAGGCCCGGCCTTTTCCCT 0: 1
1: 0
2: 1
3: 8
4: 176
Right 1168291493 19:55359725-55359747 GCCCCTGGGGATGGAAGAGTAGG 0: 1
1: 1
2: 4
3: 44
4: 353
1168291475_1168291493 18 Left 1168291475 19:55359684-55359706 CCCGGCCCCTGGTGGGAGCCCAT 0: 1
1: 0
2: 2
3: 29
4: 283
Right 1168291493 19:55359725-55359747 GCCCCTGGGGATGGAAGAGTAGG 0: 1
1: 1
2: 4
3: 44
4: 353
1168291484_1168291493 -8 Left 1168291484 19:55359710-55359732 CCCGGCCTTTTCCCTGCCCCTGG 0: 1
1: 0
2: 8
3: 100
4: 935
Right 1168291493 19:55359725-55359747 GCCCCTGGGGATGGAAGAGTAGG 0: 1
1: 1
2: 4
3: 44
4: 353
1168291474_1168291493 19 Left 1168291474 19:55359683-55359705 CCCCGGCCCCTGGTGGGAGCCCA 0: 1
1: 0
2: 2
3: 30
4: 229
Right 1168291493 19:55359725-55359747 GCCCCTGGGGATGGAAGAGTAGG 0: 1
1: 1
2: 4
3: 44
4: 353
1168291483_1168291493 -1 Left 1168291483 19:55359703-55359725 CCATAGGCCCGGCCTTTTCCCTG 0: 1
1: 0
2: 1
3: 12
4: 190
Right 1168291493 19:55359725-55359747 GCCCCTGGGGATGGAAGAGTAGG 0: 1
1: 1
2: 4
3: 44
4: 353
1168291486_1168291493 -9 Left 1168291486 19:55359711-55359733 CCGGCCTTTTCCCTGCCCCTGGG 0: 1
1: 0
2: 5
3: 88
4: 677
Right 1168291493 19:55359725-55359747 GCCCCTGGGGATGGAAGAGTAGG 0: 1
1: 1
2: 4
3: 44
4: 353
1168291478_1168291493 13 Left 1168291478 19:55359689-55359711 CCCCTGGTGGGAGCCCATAGGCC 0: 1
1: 0
2: 0
3: 7
4: 124
Right 1168291493 19:55359725-55359747 GCCCCTGGGGATGGAAGAGTAGG 0: 1
1: 1
2: 4
3: 44
4: 353
1168291476_1168291493 17 Left 1168291476 19:55359685-55359707 CCGGCCCCTGGTGGGAGCCCATA 0: 1
1: 0
2: 3
3: 13
4: 167
Right 1168291493 19:55359725-55359747 GCCCCTGGGGATGGAAGAGTAGG 0: 1
1: 1
2: 4
3: 44
4: 353
1168291479_1168291493 12 Left 1168291479 19:55359690-55359712 CCCTGGTGGGAGCCCATAGGCCC 0: 1
1: 0
2: 0
3: 15
4: 176
Right 1168291493 19:55359725-55359747 GCCCCTGGGGATGGAAGAGTAGG 0: 1
1: 1
2: 4
3: 44
4: 353

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168291493 Original CRISPR GCCCCTGGGGATGGAAGAGT AGG Exonic
900218770 1:1495961-1495983 GCCCCTGGGGCAGAAGGAGTGGG + Exonic
900380848 1:2383064-2383086 CCACATGGGGATGGAGGAGTTGG - Intronic
900411399 1:2514304-2514326 GGCCCTCTGGATGGAAGAGGTGG + Intronic
900432952 1:2611562-2611584 ACCCATGGGGATGGAAGATGGGG - Intronic
900511966 1:3065052-3065074 GCCCTTGGGGATGGCTGACTTGG - Intergenic
901005650 1:6170464-6170486 GCCCCGTGGGATGCAAGGGTGGG - Intronic
901220211 1:7579362-7579384 GGCCCTGGGCATGGCAGCGTGGG + Intronic
902881224 1:19373098-19373120 GCCCCTGAGGATGGCAGAGAAGG + Intronic
903009830 1:20321757-20321779 GGCACAGGGGATGGAAGAGCAGG + Intronic
903304405 1:22402495-22402517 GCCCCTGGAGAGGGATCAGTGGG + Intergenic
903327411 1:22577367-22577389 GCAGCTGGGGATGGCAGAGCTGG + Intronic
903389488 1:22953900-22953922 GCCGCTGGGGATGGCAGACACGG - Exonic
903541761 1:24100422-24100444 GCCCCTGGGGATGGCTTGGTAGG - Intronic
903964033 1:27074812-27074834 GCCCCTGGGGCTGGAGAAGGAGG - Intergenic
905207590 1:36351748-36351770 GGCCCTGGGGAAGTGAGAGTTGG + Intronic
906104992 1:43286262-43286284 TGCTCTGGGCATGGAAGAGTGGG - Intergenic
906530474 1:46520904-46520926 GCCCCTTGGGGTGGATGTGTGGG - Intergenic
906680164 1:47720917-47720939 GCCCCTGGGGCAGGAGGAGATGG - Intergenic
907045111 1:51295968-51295990 GGCACTGGGGAGGGAGGAGTAGG - Intronic
907359454 1:53903038-53903060 GCACCTGGGGATGGGAGAGTGGG - Intronic
907544450 1:55247269-55247291 GTCCCTGTGGATGGAAGACTTGG - Intergenic
907930805 1:58998095-58998117 GACCCTGCATATGGAAGAGTGGG + Intergenic
910223859 1:84916717-84916739 GTCGCTGGGGCTGGGAGAGTCGG + Intergenic
912696141 1:111843521-111843543 GCCTCTGGGAATGGGTGAGTGGG + Intronic
913513924 1:119586759-119586781 GCCCCTGGGGCTGCAAGGGATGG - Intergenic
913517601 1:119617734-119617756 GCCCCTGGGGCTGCAAGGGATGG - Intergenic
914689999 1:150017389-150017411 TCCCCTGAGGATGTAAGAATGGG + Intergenic
915325007 1:155077320-155077342 GCCCCTTGGGATGGGAGTGGGGG - Intergenic
917453832 1:175168976-175168998 AGCCCTGGGGATGGCAGAGATGG + Intronic
918421838 1:184372107-184372129 GCCCCTGCAGATGGTGGAGTGGG + Intergenic
918497458 1:185156661-185156683 GCCCCTGGAGAAGGAGGAGGTGG - Exonic
919858137 1:201719622-201719644 GTCTCTGGGCTTGGAAGAGTTGG - Intronic
920848235 1:209611286-209611308 GCCCCTGGGCAAGTAAGAGTCGG - Intronic
921833117 1:219750342-219750364 TTCCCTGGGGAAGGCAGAGTAGG + Intronic
922349464 1:224723487-224723509 GCCCCATGGGATGGAAAAGTGGG + Intronic
923185986 1:231573897-231573919 GCCTCTGGAGATGGCAGGGTTGG - Intronic
924208870 1:241744128-241744150 GCCCCTGGCCATGGAAGAAGTGG - Intronic
924260883 1:242229963-242229985 TCCCCTGGGGATGGGGCAGTGGG - Intronic
1063096414 10:2912940-2912962 CACCCTGGGGATGGACGAGACGG + Intergenic
1063162196 10:3426627-3426649 GCCCCTGGGGACTGAAGTGCAGG - Intergenic
1065486246 10:26238968-26238990 GCCCCGGGGGATGGTGGGGTGGG + Intronic
1067690203 10:48496991-48497013 GCCCTGGGGGATGGAGCAGTGGG - Intronic
1070406464 10:76101905-76101927 TCCCCAAGGGCTGGAAGAGTGGG - Intronic
1071485453 10:86099195-86099217 ATCCCTGGGGATGGCAGAGCTGG - Intronic
1071803709 10:89093504-89093526 TGCCCTGGGGAAGTAAGAGTAGG - Intergenic
1072414445 10:95235178-95235200 TCCCCTGGGTATGGAAGCATAGG + Intergenic
1072976903 10:100066757-100066779 TCCCCTTGGGATGGAAAAGATGG - Intronic
1075989626 10:126824400-126824422 GCCCAGGGAGATGGAAGAGGAGG + Intergenic
1076135649 10:128044286-128044308 GCCCCTGGGGAAGGAGGGCTTGG + Intronic
1076674549 10:132141331-132141353 ACCCCCGGGGCTGGAAGGGTTGG - Intronic
1076806617 10:132862206-132862228 GCCTCTGAGGAGGGAAGAGGGGG + Intronic
1077390458 11:2298622-2298644 CCCCGTGGGGGTGGAGGAGTGGG - Intronic
1078087464 11:8242873-8242895 GCACCAGGGGATGGGAGATTAGG + Intronic
1080667734 11:34350495-34350517 GCTCCTGGGGATGGAAGAAGAGG - Intronic
1081583105 11:44365882-44365904 GCCCCTGAGGTTGGGAGTGTGGG - Intergenic
1081666016 11:44917533-44917555 GGCCCTGGGGCTGGCAGGGTGGG + Intronic
1083692669 11:64419737-64419759 GCCCCGGGGTATGGAAGAGTGGG - Intergenic
1084168656 11:67389691-67389713 GGCCTTGGAGATGGAAGAGGAGG + Intronic
1084279481 11:68078048-68078070 TCCCCTGGGGACAGAAGAGGAGG + Intronic
1084423449 11:69071845-69071867 TCCCCAGGGGAGGGAAGGGTCGG + Intronic
1084859777 11:72010851-72010873 CCACCTGGGGAGGGAAGAGGAGG + Exonic
1085405521 11:76259560-76259582 GCCCATGGAGCTGGAAGAGGAGG + Intergenic
1088797648 11:113277348-113277370 GCTCCTGGGGATGGAAATGGAGG + Exonic
1089316229 11:117593139-117593161 GGCCCAGGGGATGGAGGAGCTGG - Intronic
1089334675 11:117714962-117714984 GCCCATGTGGATGGCAGAGTAGG - Intronic
1090074944 11:123574496-123574518 GGCCCTGGGGAAGGAAGGGAAGG + Intronic
1090272925 11:125400468-125400490 GCCCCTGGGGGTGGAAGGGAGGG + Intronic
1090739236 11:129642014-129642036 CCTGCTGGGGATGGATGAGTGGG + Intergenic
1091216943 11:133907872-133907894 GCCCCGGGGCAGAGAAGAGTCGG + Intergenic
1091444389 12:535236-535258 GCCTCTGGGGATGGTAGAACTGG - Exonic
1094023773 12:25941477-25941499 GGGCCTGGGGAGGGAAGAGAAGG + Intergenic
1096541042 12:52307351-52307373 GCCCCGTGTGATGGAGGAGTGGG - Intronic
1096657543 12:53101022-53101044 GGCCCTGGGGAAGGGAGAGTAGG - Exonic
1097953304 12:65456841-65456863 GCCCTTGTGGATGGAGGAGGGGG + Intronic
1098838325 12:75448046-75448068 GCACCTGGAGATGGAGGACTAGG + Intergenic
1099931929 12:89084953-89084975 GTCCCTGGTGATGTAAGAGTGGG - Intergenic
1100478616 12:94956637-94956659 GCCCCTGGGGCTGGGAGAAGGGG + Intronic
1100581306 12:95942883-95942905 GCTCCTGGAGAGGGCAGAGTAGG - Exonic
1101568040 12:105928097-105928119 TCCCGTGGGGATGGAACAGATGG + Intergenic
1102013165 12:109631436-109631458 GCGCCTGGGGATGGGGGAGGAGG - Intergenic
1102507866 12:113395241-113395263 GCTCCTGGGGAAGGGAGAGGGGG - Intronic
1102910977 12:116713977-116713999 GCTCCTGAGGTTGGAAGGGTAGG - Exonic
1104007750 12:124905982-124906004 GGCCCTGGGGCTGGAAGACTTGG - Intergenic
1104014688 12:124953993-124954015 GCGCCTGGGGAACGAAGAGGGGG + Exonic
1104053072 12:125209322-125209344 GCCCCAGGGGATGGTGCAGTGGG + Intronic
1104079147 12:125415093-125415115 AGCCCAGGGGATGGAAGAGGAGG - Intronic
1104745125 12:131205652-131205674 GCTCCTGGGGATGGAAGGGCCGG + Intergenic
1104789269 12:131471747-131471769 GCTCCTGGGGATGGAGGGGCCGG - Intergenic
1105020474 12:132813378-132813400 GCCCCTGGAGAAGGAGGAGCAGG - Exonic
1106118633 13:26838711-26838733 GTCCCTGCGGACGGAAGTGTTGG + Intergenic
1107556513 13:41520626-41520648 GGCCCAGGGGATGGAGGAGGAGG + Intergenic
1107828610 13:44353604-44353626 ACCCCTGGGGAAGGAAGAAGTGG + Intergenic
1108519871 13:51237049-51237071 GAAGCTGGGGATGGAAGAGGTGG - Intronic
1108832798 13:54500170-54500192 GCCCCTGTGGATGGAGGACCCGG + Intergenic
1109715720 13:66219596-66219618 GCCCCTAGGGATGAAAGGGGAGG + Intergenic
1109961506 13:69638268-69638290 GTGCCTGGGCATTGAAGAGTTGG + Intergenic
1110507349 13:76303154-76303176 TCCCATAGGGATGGAAGATTAGG + Intergenic
1110798755 13:79670583-79670605 TCACCTGGGGATGGGAGTGTGGG - Intergenic
1111722957 13:91970266-91970288 GGGCCCGGGGATGGAAGAGTGGG + Intronic
1112201874 13:97284273-97284295 GCCCCTGGGGTTGGGGAAGTTGG + Intronic
1112811020 13:103218863-103218885 GCCCCTGGTTATTAAAGAGTAGG + Intergenic
1113028751 13:105970829-105970851 GCCCCTGGCTATGTAAGAGGAGG + Intergenic
1113361364 13:109634736-109634758 TCACCTTGGGATGGAAGAGATGG - Intergenic
1113361400 13:109634897-109634919 TCACCTTGGGATGGAAGAGATGG - Intergenic
1113379400 13:109787679-109787701 GCCCCTGTGGAAGGAAGGGGGGG - Intergenic
1113498362 13:110752083-110752105 ACCTGTGGGGATTGAAGAGTAGG - Intergenic
1113966278 13:114155488-114155510 GGGCATGGGGATGGAAGATTAGG + Intergenic
1114531612 14:23400068-23400090 GGTCCTGGGAAAGGAAGAGTGGG + Intronic
1117346917 14:54841652-54841674 GCTGTTGGGGAAGGAAGAGTAGG - Intergenic
1120934671 14:89882866-89882888 GGTCCTGGGGGTGGAAAAGTGGG + Intronic
1121273636 14:92653310-92653332 GCCCCTGATGGTGGAAGAGAGGG - Intronic
1121405889 14:93719269-93719291 TCGCCTGGGGCTGGAAGATTAGG + Exonic
1121727781 14:96165782-96165804 GCCTCTGGGGATGGGGGAGAAGG - Intergenic
1121823645 14:96992508-96992530 GGCCCAGGGGGTGCAAGAGTGGG + Intergenic
1122265299 14:100543962-100543984 GGCCCTGGGGGTGGGACAGTGGG + Exonic
1122353740 14:101111681-101111703 GCTCTTGGGGATGAAAGAGCTGG + Intergenic
1122857625 14:104567436-104567458 GCCCCTGGGGTAGGAAGGGCCGG + Intronic
1124179462 15:27458858-27458880 GGCCCTGGGCATGTAGGAGTGGG + Intronic
1127392998 15:58522016-58522038 GCACCTGGGGCAGGTAGAGTTGG + Intronic
1128114044 15:65094430-65094452 GCCCCAGGGGATGGAAGGGATGG - Intronic
1128245516 15:66130042-66130064 GTCTCTGGGGATGGAGGAGTGGG - Intronic
1128772749 15:70294651-70294673 GGCCCTGGGGCGGGAAGGGTTGG + Intergenic
1129271810 15:74422910-74422932 GCTCCAGGGGAGGGCAGAGTGGG + Intronic
1129272585 15:74427267-74427289 CTCCCTGGGAATGGAAGACTTGG - Intronic
1130674713 15:85941520-85941542 GGCCCTGGGAATGGGAGAATGGG - Intergenic
1131200545 15:90392131-90392153 GCCCCAGGAGAAGGAAGAATGGG - Intronic
1131340285 15:91592977-91592999 TCCCCTGTGGATGGACAAGTTGG + Intergenic
1132028421 15:98421507-98421529 GCCCCTTGGGGTGGCAGAGTAGG - Intergenic
1132496754 16:266954-266976 GCCCCTGGCCATGGAGGGGTGGG + Intronic
1132630824 16:916536-916558 GCCCCTGGGGCTGGATGATGGGG + Intronic
1132677261 16:1125928-1125950 GCCGCTGTGGATAGGAGAGTCGG - Intergenic
1132991512 16:2798174-2798196 GCCCCTGGTGCTGGAGGAGGTGG + Intergenic
1133061265 16:3175850-3175872 GCCCCTGGCGATGCAAGATTTGG + Intergenic
1133061932 16:3180484-3180506 GCCCCTGGCAATGCAAGACTTGG - Intergenic
1133155690 16:3873957-3873979 GCCCCTGGGGAGGGAAGTGCTGG + Intronic
1134368310 16:13599853-13599875 GTCCCTGGGGATTAAAAAGTAGG + Intergenic
1135469733 16:22719549-22719571 GCCTTTGGGGATGGAATAGGTGG + Intergenic
1136189310 16:28606355-28606377 GGCCCTGGGGGTTGAGGAGTTGG - Intronic
1136286818 16:29249000-29249022 ACCCCTGGGGATGCATGACTGGG - Intergenic
1137044342 16:35642027-35642049 CCCCGTGGGGGTGGAAGAGAGGG + Intergenic
1137621536 16:49879684-49879706 GCCCCTTGGGATGACAGAGGAGG + Intergenic
1137963838 16:52911679-52911701 GACTCTGGGGATGAAAGAGAAGG + Intergenic
1138224132 16:55277990-55278012 TCCCCTTGGGTTGGAAGAGGAGG - Intergenic
1138797644 16:59989201-59989223 GCCACTGGAGAGGGAAGAATGGG + Intergenic
1139260605 16:65589878-65589900 TCCCCTGGGGGTGGAAGGGAGGG + Intergenic
1139316102 16:66070342-66070364 TTCCCTGGGGATGGAATAGGAGG + Intergenic
1139428932 16:66900791-66900813 GCACCGGGGGGTGGGAGAGTGGG - Intergenic
1141564421 16:84891758-84891780 GCCCCTGGGGAGGGCAGGGATGG + Intronic
1141656147 16:85417635-85417657 GTCCCTGGGTATGGAAGGCTGGG + Intergenic
1142596326 17:1031669-1031691 ACCCCTGGCGCTGGAGGAGTCGG - Intronic
1143115057 17:4577383-4577405 GCCACTGGGAATTGAAGAGGGGG - Intergenic
1143318382 17:6050664-6050686 CCCCCAGGGGCTGGAAGAGGAGG - Intronic
1143500636 17:7336670-7336692 GCCCCTGGGGATGCAGGTGGAGG - Exonic
1143739840 17:8944591-8944613 TTCCCTGGGGAATGAAGAGTGGG + Intronic
1143742891 17:8966681-8966703 GCCCCTGGGGAAGGGAGTGAGGG + Intergenic
1143886835 17:10071233-10071255 GCCCAAGGGGATGGTGGAGTCGG - Intronic
1144124067 17:12184328-12184350 GCCTCTGGGGAGGGAAGTGGGGG - Intergenic
1145207708 17:20993466-20993488 TCCCCTGTGGATGGAAGGTTAGG + Intergenic
1145796643 17:27659341-27659363 GACCCTGGGGCTGGAAGACATGG + Intergenic
1146128695 17:30251075-30251097 GGCACTCAGGATGGAAGAGTGGG + Intronic
1146612482 17:34319961-34319983 GCCCATGAGGATGAAAGACTGGG + Intronic
1147339505 17:39745332-39745354 GCCCAAGGGGATGGGAGGGTGGG + Intronic
1147360877 17:39928801-39928823 CCCCCTGGGGAAGGAAAGGTAGG - Intergenic
1147363580 17:39946124-39946146 CACCCTGGGGCTGGAAGAGAGGG + Intergenic
1147421574 17:40324472-40324494 GCCCCTGGGGATGGAGGAGTTGG + Intronic
1147425786 17:40345337-40345359 GCCCCTGGGGATGGTTGGGGAGG - Intronic
1147427759 17:40354445-40354467 GCCCCTGGAGATGGATGATGCGG + Exonic
1148157482 17:45432200-45432222 GGCCCTGGTGAGGGAAGAGGTGG - Intronic
1148165507 17:45481652-45481674 GGCACTGGGGGTGGGAGAGTGGG + Intronic
1148444734 17:47730779-47730801 GGCCCTGGGGCTGGAAAGGTGGG - Intergenic
1148588234 17:48796223-48796245 GCCCCTGGGGCTTGAAGGGATGG + Intronic
1148775150 17:50091063-50091085 GACCCTGGGGAGGGACGAGCAGG + Intergenic
1148789519 17:50165674-50165696 GGGCCTGGGGTTGGAAGGGTAGG + Intronic
1149439288 17:56661714-56661736 GCCCCTGGGGAAGTGAGAGAGGG + Intergenic
1149785131 17:59428239-59428261 TCCCGTGGGGTGGGAAGAGTAGG + Intergenic
1150396734 17:64828368-64828390 GGCACTGGGGGTGGGAGAGTGGG + Intergenic
1151305540 17:73260806-73260828 GCACCTGGGGAGGGAAAATTGGG - Intronic
1151450122 17:74193683-74193705 GCTCCTGGGGAGGGCAGAGGAGG - Intergenic
1151863676 17:76785298-76785320 GCTGGTGGGGACGGAAGAGTGGG + Intergenic
1152231755 17:79117404-79117426 GCCCCGGGTGATGGGAGCGTGGG - Intronic
1152466471 17:80469564-80469586 GCCCCATGAGATGGAGGAGTGGG + Exonic
1152595174 17:81234340-81234362 GCACCTGGGGCAGGGAGAGTGGG - Intronic
1152655572 17:81517778-81517800 GCCTCTGGGGAGGAAGGAGTGGG - Intronic
1152755224 17:82084415-82084437 GCCCCTCGGGAGGGAAGGGCAGG - Intronic
1153447965 18:5195624-5195646 CTCCCTGGGGATGGTAGAGTAGG + Intronic
1153533994 18:6080562-6080584 GCCTCTGCAGATGGCAGAGTGGG + Intronic
1155055109 18:22175403-22175425 GCCCCTCTGGATAGAGGAGTGGG - Intronic
1156462344 18:37328112-37328134 GCCTCTGGGGATCCATGAGTAGG - Intronic
1157934168 18:51855627-51855649 GGCCCTGGGGATGGGAGAGGGGG + Intergenic
1160023900 18:75203961-75203983 GCCCGTGGGGGTGGAAGTGACGG + Intronic
1160957339 19:1699690-1699712 GCCGCTGGGGAGGGGAGGGTGGG + Intergenic
1161238983 19:3211370-3211392 GCCACTGGGGATGGAATGGCGGG + Intergenic
1161239003 19:3211430-3211452 GCCACTGGGGATGGAATGGTGGG + Intergenic
1161285193 19:3464834-3464856 GCCCTTGGGGATCAAAGCGTGGG + Intronic
1161582735 19:5089749-5089771 AGCTCTGGGGAGGGAAGAGTGGG + Intronic
1162762335 19:12896186-12896208 GATCCTGGGGATGGAACAGTCGG - Exonic
1163109100 19:15147615-15147637 GCACCTGGGGTGGGAAGAGAAGG - Intergenic
1163639293 19:18452233-18452255 GCCCCCGGGAATTGAACAGTTGG - Intronic
1163740643 19:19009792-19009814 GACCCTGGAGATGGGAGAGTAGG + Intronic
1163985295 19:20941276-20941298 CCACCTGGGGCAGGAAGAGTGGG - Intronic
1164555546 19:29248275-29248297 GTCCCTGGGGAAAGAAGAGCAGG + Intergenic
1164754714 19:30681105-30681127 GCCCCTGGGGTTCGGAAAGTCGG - Intronic
1164895128 19:31870117-31870139 ACCCCTGGGGTTTGAGGAGTGGG - Intergenic
1165179291 19:33954033-33954055 GCCCCAGGTGGTGGCAGAGTGGG - Intergenic
1165181905 19:33978942-33978964 GCCTCTGGGGATGGGAGAGGGGG - Intergenic
1165832561 19:38736735-38736757 GCAGATGGGGAAGGAAGAGTTGG - Intronic
1166667927 19:44692421-44692443 GACCCGGGGGGTGGGAGAGTTGG - Intergenic
1166963450 19:46513762-46513784 GCCCCTGGGGATGGTGTTGTAGG + Intronic
1167258851 19:48446366-48446388 GCGCCTGGGGATGGAAGGCGGGG - Exonic
1167473798 19:49689104-49689126 GGCCCTGAGGGTGGAAGGGTGGG - Exonic
1167724545 19:51201316-51201338 GGACCTGGGGATGCAAGAGCTGG - Intergenic
1167972486 19:53197188-53197210 GACCCGGGGGATGGAAGAAGGGG - Intergenic
1168149148 19:54435706-54435728 GGTCCTGGGGAGGGAAGAGGAGG + Intronic
1168240817 19:55088045-55088067 GACCCTGGGGATGGAAAGGAGGG - Intergenic
1168291493 19:55359725-55359747 GCCCCTGGGGATGGAAGAGTAGG + Exonic
1168315937 19:55484814-55484836 GTCCCTGGGGATGGGGGAGTCGG + Intergenic
925437591 2:3853910-3853932 CCCCCTGGGGAAAGAAGAGTGGG - Intergenic
927203699 2:20593798-20593820 CGCCACGGGGATGGAAGAGTGGG + Intronic
927471253 2:23379350-23379372 CTCCCTGGAGATGGAAGTGTTGG - Intergenic
927854453 2:26519106-26519128 GAGCCTGGGGATGGCAGAGGGGG + Exonic
928588222 2:32784809-32784831 ACCCCTGTGGATGGGAGAGCTGG + Intronic
929864825 2:45709123-45709145 GCCTCTGGGTGTGAAAGAGTAGG + Intronic
930035600 2:47083481-47083503 GCTCCTGGGGATGGACTTGTAGG - Intronic
930710042 2:54542531-54542553 CCCCCTGGGGATGGAAATCTAGG - Intronic
931242032 2:60462050-60462072 GCGCCTGGGGGCGGAAGAGATGG - Exonic
932327164 2:70871027-70871049 GGCCCTGGGAACAGAAGAGTCGG - Intergenic
932978153 2:76629628-76629650 GCCCCTGGTGATAGAAGAATTGG + Intergenic
934544750 2:95205704-95205726 TCTCCTGCGGAAGGAAGAGTGGG + Intergenic
935814510 2:106834779-106834801 GCCCCTGAGGATGGGTGAGATGG + Intronic
937098361 2:119250218-119250240 GCCCCAGGGCCTGGCAGAGTAGG - Intronic
937302056 2:120848584-120848606 GACCCTGGGGAGGGAAGAGTTGG + Intronic
942392907 2:175514785-175514807 CCGCCTAGGGATAGAAGAGTTGG - Intergenic
942858155 2:180577116-180577138 GCTCCTGAGGGTTGAAGAGTAGG + Intergenic
945017839 2:205538268-205538290 GGACCTGGTGATGGAAGAGAGGG + Intronic
945905807 2:215591827-215591849 GCTCATGGGGAAGGAAGAATAGG - Intergenic
948179091 2:235966006-235966028 TCCTCTGGGGATGGAGGAGAGGG + Intronic
948179101 2:235966037-235966059 TCCTCTGGGGATGGAGGAGAGGG + Intronic
948179112 2:235966068-235966090 TCCTCTGGGGATGGAGGAGAGGG + Intronic
948179123 2:235966099-235966121 TCCTCTGGGGATGGAGGAGAGGG + Intronic
948179134 2:235966130-235966152 TCCTCTGGGGATGGAGGAGAGGG + Intronic
948179143 2:235966161-235966183 TCCTCTGGGGATGGAGGAGAGGG + Intronic
948179168 2:235966253-235966275 TCCTCTGGGGATGGAGGAGAGGG + Intronic
948429648 2:237911509-237911531 GCTCCTGCGGATGGAAGAGGAGG - Exonic
948570371 2:238913788-238913810 GCCTCTGGGTAAGGCAGAGTGGG + Intergenic
948780876 2:240320836-240320858 GCCCCTGGGGGTGGCAGTGCTGG - Intergenic
948845505 2:240681118-240681140 GCCTCTGGGCACGGAAGAGCAGG + Intronic
948848348 2:240693612-240693634 GCCTCTGGGCACGGAAGAGCAGG - Intronic
1169748105 20:8963780-8963802 ATTCCTGGGGATGGAAGAATGGG + Intronic
1172050510 20:32113813-32113835 GGCTGTGGGGAGGGAAGAGTAGG - Intronic
1172692242 20:36797920-36797942 GCCACTGTGGATGGAGCAGTGGG - Intronic
1173220152 20:41125804-41125826 GCCACTGGGGATGAAAGAAGAGG + Intergenic
1173294902 20:41747893-41747915 GCCTGTGGGGAAGTAAGAGTGGG + Intergenic
1173622181 20:44445151-44445173 GGCCCTTGGGATGGCAGAGTTGG - Intergenic
1173644789 20:44626596-44626618 GCCCCTGGGAAGGGAAGAAAGGG + Exonic
1173694415 20:44996340-44996362 GCCCCTGAGGAAGGCAGGGTTGG - Intronic
1173860857 20:46282746-46282768 CCCCCGGGGGAGGGAAGGGTGGG + Intronic
1174395174 20:50242844-50242866 GCCCCTGAGGAAGGAAGACATGG + Intergenic
1175372461 20:58501089-58501111 ACCCCTGGGGATGGGACAGAAGG - Intronic
1175494257 20:59403299-59403321 GACCCTGGGGACGGAGCAGTGGG - Intergenic
1175919640 20:62444705-62444727 GCCCCAGGGGATGGGAGAGGTGG + Intergenic
1175930821 20:62492996-62493018 GCCCCTGGGGCCTGCAGAGTGGG + Intergenic
1176006082 20:62863210-62863232 TCCCCTGGGGGTGGAAGGATGGG + Intergenic
1178503565 21:33145370-33145392 GCCCCTGGGGAGGGGAGAAGAGG - Intergenic
1178576572 21:33797746-33797768 GACCCTGGGGAAAGAAGAGCTGG - Intronic
1179064790 21:38014958-38014980 GTCTCTGGGGAGGGCAGAGTGGG + Intronic
1179355728 21:40657277-40657299 ACCTCTGGGGATAGAAGATTAGG - Intronic
1179789779 21:43749703-43749725 GCCCCTGGGAGAGGAAGAGGAGG + Intronic
1180964490 22:19779347-19779369 GGCCCTGGGTATTGAAGGGTTGG - Intronic
1181437023 22:22917051-22917073 GCCCCTGGATATGGGAGGGTGGG + Intergenic
1181463175 22:23097165-23097187 GACCCTGGGGATGGGGGAGTGGG + Intronic
1183460567 22:37947460-37947482 CCTCCTGGGGAACGAAGAGTTGG + Exonic
1183563739 22:38597612-38597634 GCCCCTGTGGATGGAAGGCAGGG + Intronic
1183721664 22:39566289-39566311 GCCCCTGGGGATGACACAGCTGG + Intergenic
1183732747 22:39627844-39627866 CCCCATGGGGAAGGAAGAGAGGG + Intronic
1183984833 22:41563617-41563639 TCCCCTGGAGAAGGAGGAGTCGG - Intronic
1184466326 22:44670481-44670503 GCCCCTGTGGGTGGATGAGTGGG - Intronic
1185359032 22:50394103-50394125 GCCCCTGGACATGGAGGAGAAGG + Exonic
949761904 3:7480227-7480249 GCCCCTCAAGATAGAAGAGTTGG + Intronic
949904799 3:8850324-8850346 TCACCAGAGGATGGAAGAGTGGG - Intronic
950397977 3:12748828-12748850 GTCCCTGGGGTGGGAAGGGTGGG - Intronic
950536858 3:13583792-13583814 GAACCTGGGGGTGGAGGAGTAGG + Intronic
950661001 3:14467002-14467024 CATCCTGGGGATGGGAGAGTCGG + Intronic
950702452 3:14759747-14759769 GCCCCTGGAGCAGGAGGAGTTGG + Intronic
951393965 3:22141659-22141681 GCCCCTGGGGGAGGAGGAGGAGG + Intronic
952866312 3:37857546-37857568 GCCCCTGAGGAAGGAACATTGGG - Intergenic
953044016 3:39279800-39279822 GTCCAAGGGGATGGAAGAGTGGG - Intronic
953963574 3:47284697-47284719 ACCTCTGGAGATGGTAGAGTAGG + Intronic
954590500 3:51778052-51778074 GCCCCTGGGGAAGCCAGAGCAGG - Intergenic
954674662 3:52309150-52309172 GCCCCTGGAGATGGGACAATGGG + Intergenic
955511311 3:59683234-59683256 AGCACTGGGGATGGAAGAGTTGG - Intergenic
956575811 3:70751802-70751824 TCCCATGGGTATGGGAGAGTTGG + Intergenic
956655885 3:71549803-71549825 GCCCTTGAGGATGGAAGAAATGG + Intronic
959598458 3:108152924-108152946 ACCCCTGGGAAGGGGAGAGTGGG + Intergenic
961112757 3:124298941-124298963 GCCTCTGGGAGTGGGAGAGTGGG + Intronic
961353971 3:126322394-126322416 GGCTCTGAGGATGGAAGAGGGGG - Intergenic
961445986 3:126982093-126982115 GCTCCTGGGGAGGGAGGAGCGGG + Intergenic
961568929 3:127784629-127784651 GGGCCTGGGGGTGGAAGTGTGGG - Intronic
962739213 3:138350447-138350469 GCCTCTGGGGAGGGAGGTGTTGG + Intronic
963274014 3:143312882-143312904 GTTCTTGGGGATGGAAGATTGGG - Intronic
967186203 3:186946803-186946825 GTTCCTGGGGAGTGAAGAGTGGG + Intronic
968131769 3:196196480-196196502 GCCCCTGGGGTTGGGGGGGTCGG - Intergenic
968234704 3:197024730-197024752 GCTGCTGGGGAAGGAAGAGGGGG - Intronic
968446581 4:655285-655307 CCCCGTGGGGCTGGAAGAGGAGG + Intronic
968682164 4:1928864-1928886 GCCCTTGGAGCTTGAAGAGTTGG + Intronic
969216021 4:5723122-5723144 GCACCTGGGGATGGAGGAGCCGG - Intronic
969362591 4:6674183-6674205 GCCCCGCGGGCTGGAAGAGGCGG + Intergenic
969527763 4:7712714-7712736 GACCCTGGGGTGGGAAGAGGAGG - Exonic
970927914 4:21474525-21474547 GCCACTGTGGAAGGGAGAGTAGG - Intronic
977528898 4:98176461-98176483 GCCCATAGGGATGGTAGTGTAGG - Intergenic
977742499 4:100504148-100504170 CTCCTTGGGGATGGAAGAGGTGG - Intronic
985926436 5:3023149-3023171 GCCCCTGGTGTTGGCAGAGGTGG - Intergenic
990365855 5:55069648-55069670 CTCCCTGGGGATGAAAGTGTGGG - Intergenic
991107325 5:62860097-62860119 GTGCCTGGGCATTGAAGAGTTGG + Intergenic
996571400 5:124935983-124936005 GCCTCTGGGGAGGGAAGGGGGGG - Intergenic
997747696 5:136313893-136313915 GGCCCTGGGGATGAATGAGAAGG - Intronic
997803073 5:136886593-136886615 GCCCATGGGCATGGGAAAGTGGG + Intergenic
998149196 5:139747395-139747417 GCCTCTGCGGATGGCAGAGGAGG + Intergenic
998486732 5:142509529-142509551 GCCCCTGGTGCTGGAAGAGTTGG + Intergenic
999268030 5:150279700-150279722 GCCCCTGAGGGTGGACGAGCAGG + Intronic
999696479 5:154191648-154191670 GCCCCTGGGGGTGGAGAAGGGGG + Intronic
1000085028 5:157881272-157881294 GCCCTGAGGGAGGGAAGAGTTGG - Intergenic
1000274188 5:159718389-159718411 GCCCCCAGGGATGAAGGAGTGGG + Intergenic
1001260570 5:170225079-170225101 ACACCTGGTGATGGAAGAATGGG - Intergenic
1001295113 5:170493786-170493808 AAACCTGGGGAAGGAAGAGTGGG - Intronic
1002169622 5:177367743-177367765 GCCGCTGGGTGTGGAGGAGTTGG + Exonic
1002381237 5:178831483-178831505 ACCCCTGGGCATGGAATAGTGGG - Intergenic
1003012241 6:2436681-2436703 TCCCCTGGGGCTGGAACCGTGGG + Intergenic
1003937421 6:10989834-10989856 GCACCTGGGGACGGCAGAGAGGG + Exonic
1004271085 6:14196139-14196161 TCCCCTGGGGTGGGAAGGGTGGG - Intergenic
1005515387 6:26549766-26549788 GGCACTGAGCATGGAAGAGTTGG + Intergenic
1006474268 6:34244768-34244790 GCCTCTGGGGGTGGAAGAGGGGG + Intronic
1006710699 6:36067404-36067426 GGCCCTGGGGATGCAGCAGTGGG - Intronic
1006986393 6:38178527-38178549 GCCCCAGGGCATAGAGGAGTGGG + Intronic
1007581515 6:42962986-42963008 ACCCCTGGGGAGGGGAGAGATGG + Intronic
1007619998 6:43206154-43206176 GCCGCTGGAGCTGGAAGAGGTGG - Exonic
1007645347 6:43375950-43375972 CACCCTGAGGATGGAAGAGAGGG + Intergenic
1008862224 6:56162599-56162621 GACCCTGGAGATGGTAGAGGTGG + Intronic
1009387983 6:63110570-63110592 GCACCTGGGTATTGAAGAGATGG + Intergenic
1010273542 6:73942670-73942692 GTCCCTGGGAATGAAAGAGATGG - Intergenic
1011634244 6:89355049-89355071 GCTCTGGGGGATGGAAGAGGAGG + Intergenic
1013274570 6:108571828-108571850 GAGCCTAGGGATAGAAGAGTGGG + Intronic
1016139059 6:140585867-140585889 GACCCTGGGGCTGAAAGAGGAGG + Intergenic
1016517377 6:144909878-144909900 ACCTCAGGGGTTGGAAGAGTAGG + Intergenic
1016536212 6:145109588-145109610 GCCCCTGGGAATGTAAAAATGGG + Intergenic
1016594656 6:145785806-145785828 GCCTCTGGGGCTGGCAGATTGGG - Intergenic
1017019339 6:150127719-150127741 TCCTCTGGGGATGGGAGAGTGGG + Intergenic
1017302532 6:152879188-152879210 GACCCTGGGGGTGGGGGAGTGGG + Intergenic
1017864559 6:158431767-158431789 ACTCCTGGGGCTGGAGGAGTCGG + Intronic
1022936483 7:35184229-35184251 TCCCCTGGAGAGAGAAGAGTGGG + Intergenic
1023999936 7:45183461-45183483 TTCCCTGGGGATGGGAGAGCGGG + Exonic
1024978949 7:55140725-55140747 GCCCCTGGTGATAGGAGAGAGGG + Intronic
1025017291 7:55449558-55449580 GCGCCTGGGGAGGGAAGGCTGGG - Intronic
1026046055 7:66905883-66905905 GGCCCTGGTGAGGAAAGAGTTGG - Intergenic
1028082738 7:86598947-86598969 GCCCCTGGAGGTGGGGGAGTAGG + Intergenic
1028373632 7:90121337-90121359 TCCCCTGGAGAGAGAAGAGTGGG - Intergenic
1029457327 7:100677854-100677876 GCCCCTGAGGCAGGAAGTGTGGG - Intronic
1029582739 7:101448114-101448136 ACCCCTGGGGCAGGCAGAGTTGG + Intronic
1029832716 7:103278343-103278365 TCCCCTGGAGAGAGAAGAGTGGG + Intergenic
1030162257 7:106520899-106520921 GCTACTGGGGATGGAGGAGTGGG + Intergenic
1031995451 7:128227464-128227486 GGCCATGGGGGTGGCAGAGTTGG - Intergenic
1033155220 7:138950989-138951011 GACCTTGGGGATGAAGGAGTAGG - Intronic
1034858502 7:154576687-154576709 GCCCCTGTGGATGGATGCGCGGG + Intronic
1036821500 8:11943272-11943294 TCCTCTGAGAATGGAAGAGTTGG - Intergenic
1039689281 8:39846286-39846308 GCCCCAGGGAATGCAAGAATGGG + Intergenic
1039741938 8:40390822-40390844 GGGCCTGGGGTTGGGAGAGTAGG + Intergenic
1041319991 8:56603098-56603120 GCCTCTGGGGAGGTAAGAGTGGG - Intergenic
1044124541 8:88441008-88441030 TCCTCTGGGGAGGGAAGAGTGGG + Intergenic
1046604293 8:116353667-116353689 GCCTCTTGGGCTGCAAGAGTTGG + Intergenic
1046725030 8:117664976-117664998 TTCCCTGGAGAGGGAAGAGTAGG + Intergenic
1047615248 8:126557876-126557898 TCCTCTGGGGATGGATGCGTTGG - Intronic
1047851585 8:128863199-128863221 TCCCCTGGGGATTGGAGAGTGGG - Intergenic
1049528552 8:143142146-143142168 ACCCCTGAGGCTGGAAGAGGCGG + Intergenic
1053105335 9:35403669-35403691 GCCCGGGGGGATGGCAGACTGGG + Intronic
1053585276 9:39451770-39451792 CGCCCTGGGGGTGGAAGAGGAGG + Intergenic
1054581042 9:66913453-66913475 CCCCCTGGGGGTGGAAGAGGAGG - Intronic
1054697213 9:68372505-68372527 GCCCCTGCTGCTGGTAGAGTAGG + Intronic
1054761967 9:69012330-69012352 GCCCCTGGGGAGGGGGGAGGGGG + Intergenic
1055434252 9:76276520-76276542 GCCAGTGGGGCTGGAAGAGATGG - Intronic
1055951511 9:81733994-81734016 GCAGTTGGGGCTGGAAGAGTTGG + Intergenic
1056072950 9:83007793-83007815 GAGCATGGGGATGGAAGAGCTGG - Intronic
1058413732 9:104763855-104763877 GCCCCTGGAGAAGGAAGGGGAGG - Intergenic
1059439375 9:114297034-114297056 GCTCCTGGAGATGGGAGGGTAGG + Intronic
1061714724 9:132511469-132511491 GGCACTGGGGAAGGAGGAGTGGG - Intronic
1061799671 9:133106978-133107000 GCCCCTGGGAAGGGTAGACTGGG + Intronic
1061849054 9:133403851-133403873 GCCCCTGGGGCTGGGAGGGGTGG + Intronic
1062084391 9:134641466-134641488 GCACCTGGGGTGGGAACAGTGGG + Intergenic
1062191389 9:135249615-135249637 GGCCCTGGGGAGAGAAGAGAAGG + Intergenic
1062503218 9:136860071-136860093 GCCCCTGGGGATGGGTGGGCAGG + Intronic
1062598826 9:137311108-137311130 GGCCCTGGGGCTGGAGGTGTTGG + Intronic
1062600695 9:137317501-137317523 GCCCCTGGGGATGGAGGACCTGG - Intronic
1203794016 EBV:166611-166633 GCTCCAGGGGGTGGAAGCGTTGG + Intergenic
1187064613 X:15821193-15821215 GGCTCGGGGGATGGAAGAGGTGG + Intronic
1189021970 X:37350033-37350055 GCCCTGGGGGATGGGAGAGCGGG + Intronic
1190306589 X:49086473-49086495 GCCCCTGGGCATGGGTGGGTGGG + Intronic
1190627117 X:52346734-52346756 GCCCCAAGAGAAGGAAGAGTGGG + Intergenic
1190759856 X:53430296-53430318 TCTCCTTGAGATGGAAGAGTAGG + Intronic
1192557629 X:72103102-72103124 GCCACTAGGGAGGGAAAAGTTGG - Intergenic
1196580256 X:117370854-117370876 GCACCTTGGAATGGTAGAGTGGG - Intergenic
1197710982 X:129667092-129667114 TCACCTGGGGATGGAGGAGAGGG + Intergenic
1197725120 X:129771103-129771125 GTCCCAGGGGAGGGAAGAGCTGG - Intergenic
1197970447 X:132109895-132109917 GACCCTGGGGCTGGAAAAGTGGG + Intronic
1199657011 X:150006174-150006196 GCTCCTGGATATGGAAGAGAAGG - Intergenic
1201144021 Y:11052840-11052862 GCCCCAGTGGAAGGATGAGTGGG - Intergenic