ID: 1168292390

View in Genome Browser
Species Human (GRCh38)
Location 19:55362883-55362905
Sequence CCCTCTCAGCCCCGGGGCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 285}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168292381_1168292390 7 Left 1168292381 19:55362853-55362875 CCAGCACGGGGGGCCTTGCTTCC 0: 1
1: 0
2: 1
3: 9
4: 115
Right 1168292390 19:55362883-55362905 CCCTCTCAGCCCCGGGGCACTGG 0: 1
1: 0
2: 3
3: 27
4: 285
1168292378_1168292390 10 Left 1168292378 19:55362850-55362872 CCCCCAGCACGGGGGGCCTTGCT 0: 1
1: 0
2: 0
3: 16
4: 125
Right 1168292390 19:55362883-55362905 CCCTCTCAGCCCCGGGGCACTGG 0: 1
1: 0
2: 3
3: 27
4: 285
1168292379_1168292390 9 Left 1168292379 19:55362851-55362873 CCCCAGCACGGGGGGCCTTGCTT 0: 1
1: 0
2: 0
3: 12
4: 172
Right 1168292390 19:55362883-55362905 CCCTCTCAGCCCCGGGGCACTGG 0: 1
1: 0
2: 3
3: 27
4: 285
1168292382_1168292390 -6 Left 1168292382 19:55362866-55362888 CCTTGCTTCCCCTCTGTCCCTCT 0: 1
1: 1
2: 12
3: 181
4: 1801
Right 1168292390 19:55362883-55362905 CCCTCTCAGCCCCGGGGCACTGG 0: 1
1: 0
2: 3
3: 27
4: 285
1168292372_1168292390 21 Left 1168292372 19:55362839-55362861 CCTCTCAAGATCCCCCAGCACGG 0: 1
1: 0
2: 1
3: 14
4: 110
Right 1168292390 19:55362883-55362905 CCCTCTCAGCCCCGGGGCACTGG 0: 1
1: 0
2: 3
3: 27
4: 285
1168292380_1168292390 8 Left 1168292380 19:55362852-55362874 CCCAGCACGGGGGGCCTTGCTTC 0: 1
1: 0
2: 0
3: 5
4: 92
Right 1168292390 19:55362883-55362905 CCCTCTCAGCCCCGGGGCACTGG 0: 1
1: 0
2: 3
3: 27
4: 285
1168292370_1168292390 27 Left 1168292370 19:55362833-55362855 CCGTTCCCTCTCAAGATCCCCCA 0: 1
1: 0
2: 2
3: 36
4: 318
Right 1168292390 19:55362883-55362905 CCCTCTCAGCCCCGGGGCACTGG 0: 1
1: 0
2: 3
3: 27
4: 285
1168292369_1168292390 28 Left 1168292369 19:55362832-55362854 CCCGTTCCCTCTCAAGATCCCCC 0: 1
1: 0
2: 2
3: 17
4: 252
Right 1168292390 19:55362883-55362905 CCCTCTCAGCCCCGGGGCACTGG 0: 1
1: 0
2: 3
3: 27
4: 285
1168292371_1168292390 22 Left 1168292371 19:55362838-55362860 CCCTCTCAAGATCCCCCAGCACG 0: 1
1: 0
2: 2
3: 4
4: 152
Right 1168292390 19:55362883-55362905 CCCTCTCAGCCCCGGGGCACTGG 0: 1
1: 0
2: 3
3: 27
4: 285

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168292390 Original CRISPR CCCTCTCAGCCCCGGGGCAC TGG Intronic
900335931 1:2163452-2163474 GCCTCTCAGCCCCCAGCCACTGG + Intronic
900343628 1:2200491-2200513 CCCTTCCAGCCCCGGGCCCCCGG - Intronic
900457235 1:2783229-2783251 CCCTCTCAACACCGGGGGCCAGG + Intronic
900793521 1:4694154-4694176 CCAGCTCAGCCCAGGGGCACGGG + Intronic
902550209 1:17214820-17214842 GTCTCCCAGCCCCGGGGCAAGGG + Intronic
903003061 1:20280082-20280104 CCCTCTCTGGCCCTGGGCATTGG + Intergenic
904032727 1:27543259-27543281 CCCTATCAGACCCTGGGGACAGG - Intronic
904558058 1:31378365-31378387 CCCTCCCTGCCCTGGGGGACAGG + Intergenic
905793412 1:40802279-40802301 CCCTCTCCGCCCCTGGCCTCGGG + Intronic
906548243 1:46638088-46638110 CTCTCTCAGCCCCTGGCTACAGG + Intronic
909590325 1:77341406-77341428 TCCTCTCAGCCCTCGGGCCCGGG + Intronic
912879124 1:113390950-113390972 CCGTCTCAGCCCGGGGGCCCTGG - Exonic
913045815 1:115072750-115072772 ACCTCTGAGCCCCTGTGCACTGG - Intronic
915238582 1:154502931-154502953 CCCTCTGAGCCCGGGGGCACGGG - Intronic
915320135 1:155051836-155051858 CCCGCTCAGCGCCCTGGCACCGG - Intronic
915354912 1:155250358-155250380 CCCTCACCCCACCGGGGCACCGG - Exonic
915938164 1:160100992-160101014 CCTTCCCAGCCCCAGGCCACAGG - Intergenic
916057788 1:161079926-161079948 CCAGCTCACCCGCGGGGCACCGG + Exonic
917226593 1:172790077-172790099 TCCTGTCAGCCCTGGGGCAATGG + Intergenic
919820421 1:201468836-201468858 CCCTCTCGGCCCCGCAGCGCAGG + Exonic
919824382 1:201493198-201493220 CCCTCTCAGTCCCTGGTCCCAGG + Intronic
919912879 1:202122808-202122830 CCCTCCCAGCCTCCGGCCACAGG - Intergenic
922219895 1:223550429-223550451 CCCTCTGAGCCCCAGCCCACAGG - Intronic
922748547 1:228060323-228060345 CCCTCGGATCCCAGGGGCACGGG - Exonic
922985870 1:229865563-229865585 CCCTCACAGCCCGGGGCCGCAGG - Intergenic
1063976054 10:11416471-11416493 AGCTCACAGCCCAGGGGCACAGG + Intergenic
1067061377 10:43079674-43079696 CCCTCTCTGCCCCTGGGCCCCGG + Intronic
1069215350 10:65812305-65812327 CCCTCACTGCCCCGGGCCAGCGG + Intergenic
1069753170 10:70757851-70757873 CCCTTTCTGTCCCCGGGCACTGG + Intronic
1069905662 10:71730767-71730789 CCCTCTCAGGCTGGGGCCACTGG - Intronic
1069956250 10:72053787-72053809 CCCTCTCAGCCCTGGCCCAGGGG + Intergenic
1070611848 10:77938899-77938921 CCCTATCAGGCCCGGTGCAGTGG + Intergenic
1072685527 10:97534292-97534314 CCATCTCAGTCCCAGGGCTCAGG - Intronic
1073143015 10:101261373-101261395 CCCTCTGAGCCCCGGGGGAGGGG - Intergenic
1073143110 10:101261853-101261875 TCCTCTCAGCCCAGGGGCAAAGG - Intergenic
1073494556 10:103879579-103879601 CCCTCCCAGCCCAGCCGCACGGG - Intergenic
1074109232 10:110410774-110410796 ACCTCTCAGCTCCTGGGGACTGG + Intergenic
1074715565 10:116215544-116215566 CCTTCTCAGCCCCGTGACAGGGG - Intronic
1076593625 10:131609415-131609437 CACGCTCAGCCTCCGGGCACAGG + Intergenic
1076625035 10:131816439-131816461 CCCTGTCAGCCCCAGAGCTCCGG - Intergenic
1076727030 10:132418773-132418795 CCCTCTGAGCTCCGGTGCCCAGG + Intergenic
1077252349 11:1566232-1566254 CCATCTCATCCCTGGGACACAGG + Intronic
1077414002 11:2416068-2416090 GCCTCACAGAGCCGGGGCACAGG + Intronic
1083272722 11:61580411-61580433 CGCTGGCACCCCCGGGGCACCGG + Intronic
1084153859 11:67303385-67303407 CCCGCCCAGCCCCTGGGCACAGG - Intergenic
1084682409 11:70674028-70674050 CTCTCTCAGCCCCGGGAGAATGG - Intronic
1085533039 11:77202946-77202968 CACTCTCAGCCTCTGGACACAGG + Intronic
1088517716 11:110656605-110656627 CCCTCTCATCCCCAGGGCCTAGG - Intronic
1089455886 11:118625580-118625602 CCCCCTCAGCCCAGCTGCACAGG + Intronic
1090306264 11:125693720-125693742 CTGTCTCAGCCCAGGGCCACAGG - Intergenic
1091238128 11:134035036-134035058 TCCTCTCTGCTCCTGGGCACTGG - Intergenic
1091352448 11:134907946-134907968 CCTTCCCAGCCCAGGGGCATGGG - Intergenic
1091694472 12:2618521-2618543 CCCTGGCTGCCCCAGGGCACCGG - Intronic
1092229012 12:6766650-6766672 CCGTCTCGGCCCCGGGACCCCGG + Exonic
1096253698 12:50050544-50050566 CCCTCTCAGCCTCGGCTCACAGG - Intergenic
1096812896 12:54183013-54183035 CCCTCTCAGCCCCAAGCCTCAGG + Intronic
1096879810 12:54658472-54658494 CCGTGTCAGCCCAAGGGCACTGG - Intergenic
1097014358 12:55974530-55974552 CCCAGTCACCCCCGGGGCTCGGG - Intronic
1101177664 12:102172152-102172174 CTCTTTCTGCCCCAGGGCACTGG + Intronic
1101253915 12:102958904-102958926 CCCGCTCAGCCCCGAGGAGCAGG + Exonic
1103433010 12:120904059-120904081 CCCGCCCCGCCCCGGGGCCCAGG - Exonic
1103506065 12:121442950-121442972 ACCGCTCAGGCCTGGGGCACAGG + Intronic
1103942122 12:124506839-124506861 CCGTCACAGCCCAGGGGCACGGG - Intronic
1103953500 12:124564781-124564803 CCCTCTCAGCCAGGGGGAAACGG + Intronic
1104439691 12:128784805-128784827 CCATCTCAGCCCTGGGGCATAGG + Intergenic
1104705816 12:130946644-130946666 CCCTGCCAGCCGCAGGGCACAGG - Intergenic
1104779471 12:131410840-131410862 CACTGTAAGCCCCAGGGCACAGG - Intergenic
1104989188 12:132615592-132615614 CCCACTCTCCCCCGGGACACAGG + Intergenic
1105705507 13:22965540-22965562 CCCTGTCAGCTCCAGGGCAGAGG - Intergenic
1105858409 13:24390524-24390546 CCCTGTCAGCTCCAGGGCAGAGG - Intergenic
1118144812 14:63123964-63123986 CCCTCTCACTCCAGGGGCACAGG - Intergenic
1119464409 14:74843714-74843736 CCCTCTCAGCCTCAGGGTTCAGG + Intronic
1120070871 14:80100783-80100805 TGCTCTCAGCCCTGGGGCCCTGG + Intergenic
1121219442 14:92274792-92274814 CCCACTTTGCCCCTGGGCACGGG + Intergenic
1121417569 14:93789346-93789368 ACCTTTCAGCCCCGGCGCCCGGG - Intergenic
1121733822 14:96204652-96204674 CCCTCTGAGCCCTGGGGGCCAGG - Intergenic
1122231872 14:100310193-100310215 CCCTCTCAGGGCCTTGGCACTGG + Intergenic
1122246027 14:100404209-100404231 CCCTCTCAGCCCCAGGTCCTTGG - Intronic
1122619301 14:103045456-103045478 CCCTCCCAGCCCCGAGGAGCAGG + Intronic
1122807515 14:104267527-104267549 GTCTCACAGCCCCCGGGCACTGG + Intergenic
1122886811 14:104713891-104713913 CCCTCTGAGCCCAAGGGCATCGG - Intronic
1123061764 14:105597742-105597764 TCCTCTCAGCCACGCGGCAGGGG - Intergenic
1123086502 14:105719473-105719495 TCCTCTCAGCCACGCGGCAGGGG - Intergenic
1124166172 15:27327783-27327805 CTCTCACTGCCCCGGGGCACAGG + Intronic
1126592448 15:50354421-50354443 GCCTCTCGGCCCCGCAGCACAGG + Intronic
1128078580 15:64842978-64843000 CCCTCTCAGCCCAAGGGAAGGGG + Intronic
1128219744 15:65960386-65960408 CTCTCTGAGCCCCAAGGCACTGG + Intronic
1128770599 15:70278840-70278862 CCTTCTCATCCCCGGGCCTCAGG - Intergenic
1129365053 15:75049042-75049064 CCCTCTCAGGCCTTGGGCTCTGG + Intronic
1129461601 15:75702643-75702665 GCCTCTGAGCCCTGGGGCTCTGG - Intronic
1129703958 15:77784024-77784046 CCCACTCATCCCCGAGGCAAGGG + Intronic
1129706214 15:77796004-77796026 CCCTCTCTGCCTGTGGGCACTGG + Intronic
1129723252 15:77889203-77889225 GCCTCTGAGCCCTGGGGCCCTGG + Intergenic
1129850240 15:78789623-78789645 CCCTCGCAGCCTGGGGGCACCGG - Intronic
1130540466 15:84817705-84817727 CCCTCTCAGCCCCAAGGCCCAGG + Intronic
1131258282 15:90875634-90875656 ACCAGTCAGCCCCGGGCCACAGG + Exonic
1131990556 15:98088845-98088867 CGCGTTCAGGCCCGGGGCACCGG - Intergenic
1132099587 15:99014451-99014473 CGCGTTCAGGCCCGGGGCACCGG + Intergenic
1132150399 15:99454575-99454597 CCCTGCCATCCCCGGGGCCCTGG - Intergenic
1132275354 15:100558960-100558982 CACACTCAGGTCCGGGGCACCGG + Intergenic
1132735585 16:1384278-1384300 CCCTTTCAGCCCCTGGGGAAAGG - Intronic
1132782546 16:1635805-1635827 GGCTCCCAGCACCGGGGCACAGG - Intronic
1134565386 16:15247309-15247331 CCCTCTGAGCCCCGGGGGTGGGG - Intergenic
1134737110 16:16509389-16509411 CCCTCTGAGCCCCGGGGGTGGGG + Intergenic
1135754765 16:25087715-25087737 CCCTGTGAGCCCAGGGGCAGTGG - Intergenic
1136023604 16:27455766-27455788 CCCACCCAGTCCCAGGGCACCGG + Intergenic
1136398160 16:30004247-30004269 CCCTCCCAGCCTCAGGACACTGG - Intronic
1136598524 16:31268178-31268200 CCCTCTCCACCTAGGGGCACTGG + Intronic
1138581002 16:57940321-57940343 CCCACCCCGCCCCGGGTCACAGG - Exonic
1139468080 16:67164699-67164721 CCTACTCCGCCCCGGGGCGCCGG - Exonic
1139476099 16:67203272-67203294 CCCTGGCAGCCCCGGGGCCCAGG - Intronic
1140410536 16:74738165-74738187 CCGTCTCAGCCCAGAGACACAGG + Intronic
1141032651 16:80603014-80603036 CCCTTGCAGCCCAGGGGCACAGG + Exonic
1141295605 16:82765758-82765780 CACTCTCTTCCCCGGGCCACAGG - Intronic
1141731269 16:85824731-85824753 CCCTCACAGCCCCAGACCACTGG - Intergenic
1141778803 16:86142981-86143003 ACTTCTCTGCCCCCGGGCACCGG + Intergenic
1142289343 16:89185600-89185622 CCCTCTCAGCCTCATGGCAACGG + Intronic
1142474271 17:180410-180432 CCCTCTCTGCCCGGGGGCCGCGG + Intronic
1142799631 17:2337279-2337301 CGCTCTCAGCCGCGGGGCCGCGG + Exonic
1143502387 17:7347016-7347038 CCCTCTCTCCCCCAGGGCTCAGG + Exonic
1143641998 17:8204490-8204512 CTCCCACAGCCCAGGGGCACTGG - Intergenic
1146935403 17:36809807-36809829 CCCCCCCAGCCCCAGAGCACAGG + Intergenic
1147307743 17:39575286-39575308 CCCTCTCAGCCCTGGGAAAGAGG + Intergenic
1147945411 17:44077692-44077714 CCCTCTCAGCCCCGGGGAAGGGG + Exonic
1148907326 17:50919709-50919731 CCCTCTCCGCCCCCCGGCATCGG + Intergenic
1150657664 17:67051047-67051069 CCCTCTCTGCCCCGCTGCCCTGG - Intronic
1152367233 17:79863318-79863340 GGCTCTCAGCCCCTGGACACGGG - Intergenic
1152695327 17:81741176-81741198 CCCTCACAGCCCCGGGCCTGAGG + Intergenic
1152721315 17:81925081-81925103 CCCTCTCAGCCCAGGTCCAGAGG - Intronic
1152813436 17:82393074-82393096 ACCTCTCAGGCCCCGGGCCCTGG - Intronic
1153480830 18:5544142-5544164 CCCTCCCAGCCGCGGGGGAGGGG + Exonic
1154954795 18:21242828-21242850 CCCTCACTGCCCCTGGGCTCGGG - Intronic
1156474671 18:37398008-37398030 CCCACTCAGGCCCGGGTCAGTGG + Intronic
1157601261 18:48894454-48894476 GCCTCCCAGCCCCAGGGCAGGGG - Intergenic
1160026401 18:75221008-75221030 CCCTCCAAGCTCCTGGGCACAGG + Intronic
1160323603 18:77919333-77919355 CTCTCTGAGGCCCTGGGCACAGG - Intergenic
1160680386 19:409307-409329 CCCAGTCAGCCCCCGGGCCCTGG - Intergenic
1160757768 19:766568-766590 CCCTCACTGCCCCTGGGCGCTGG + Intergenic
1160947860 19:1651955-1651977 CCCCCCCAGCCCGGGCGCACGGG - Intronic
1161008469 19:1948178-1948200 CCCTCTCATCCCCAGGGTGCTGG + Intronic
1161514798 19:4690365-4690387 GCCTCTCAGGCCCTGGGCACAGG - Intronic
1162790731 19:13061395-13061417 CCCACTCAGGCCCAGGCCACTGG - Intronic
1162797101 19:13092640-13092662 CCCCCTCAACCTCGGGGCAATGG + Intronic
1162944160 19:14032150-14032172 CCCACCCCGCCCCGGGGCTCCGG - Intronic
1163002199 19:14375499-14375521 CCCCCTCAGCCCCGGAGCACGGG + Intergenic
1163243056 19:16076213-16076235 CCTTCCCGGCCCCGGGGCTCCGG - Intronic
1163451601 19:17380677-17380699 CTCTCACAGGCCTGGGGCACCGG - Intergenic
1165096147 19:33410970-33410992 TCCTCCCTGCCCCGGGGCAGCGG + Intronic
1166361406 19:42254268-42254290 CCTCCTCAACCCCGGGCCACCGG + Intronic
1166944056 19:46386345-46386367 CCCTGTGAGCCCAGGGACACGGG - Intronic
1167541489 19:50090891-50090913 CCCTCTCTGTCCCTGGGGACTGG - Intergenic
1167600278 19:50450979-50451001 CCCTCGCAGACCCAGGGCCCGGG + Intronic
1167628599 19:50608623-50608645 CCCTCTCTGTCCCTGGGGACTGG + Intergenic
1168292390 19:55362883-55362905 CCCTCTCAGCCCCGGGGCACTGG + Intronic
925109150 2:1318908-1318930 CTCTGTCATCCCCGGGGCTCAGG + Intronic
925128928 2:1480946-1480968 CTCCCTCAGCCCTGGGCCACAGG + Intronic
929491382 2:42399739-42399761 CCCTCTCAGCTTAGGTGCACAGG + Intronic
932476693 2:72011039-72011061 CCCTGGCAGCCCCAGGGTACGGG - Intergenic
934620184 2:95798860-95798882 CCCTCCCAGCCCCAGGACAGAGG - Intergenic
934624299 2:95834590-95834612 CTCTGTCAGCCCCGGAACACTGG + Intergenic
934640704 2:96025697-96025719 CCCTCCCAGCCCCAGGACAGAGG + Intronic
934810002 2:97269803-97269825 CTCTGTCAGCCCCAGGACACTGG - Intergenic
934827690 2:97438136-97438158 CTCTGTCAGCCCCAGGACACTGG + Intergenic
936972391 2:118187849-118187871 CCCTCTCAGCCCAGGTACATGGG - Intergenic
937982451 2:127623509-127623531 CCCTCCCAGCCACCAGGCACAGG + Intronic
938062016 2:128261821-128261843 CCAGCTCAGCCCCGGGCCTCGGG - Intronic
938701800 2:133886052-133886074 CCAGCTCAGCCCTGGAGCACTGG - Intergenic
940337346 2:152543276-152543298 CCTTCTCAGGCCAGGGGCAGGGG - Intronic
940971991 2:159904838-159904860 CCCGCTCCGCCCCGGGGCCGAGG - Intergenic
941911854 2:170771328-170771350 CCCTGGCAGCCACGGGGCCCGGG - Intergenic
942224958 2:173806992-173807014 CCCTCCCAGCCCAGGGCCAGAGG + Intergenic
946159979 2:217830169-217830191 CCCTCGCAGCCCCTGTGCCCAGG + Intronic
946405113 2:219488356-219488378 CCCTCCCATCCCCTGGGCTCAGG - Intronic
947118722 2:226796856-226796878 CCCTTTCGGCCACTGGGCACTGG + Exonic
948280857 2:236747107-236747129 CCATCTCAGCACCGGGGCTGTGG + Intergenic
948302717 2:236920047-236920069 TCATCTAAGCCCGGGGGCACAGG + Intergenic
1173543066 20:43869120-43869142 GCCTCTCATCACCGGTGCACAGG + Intergenic
1174387210 20:50194237-50194259 CCCTCCCAGCCCTGGGCAACTGG + Intergenic
1174500748 20:50982254-50982276 CTCTCTCTGCCGAGGGGCACCGG + Intergenic
1174595266 20:51678726-51678748 CCCTCTCTGACCCTGGGCTCTGG - Intronic
1175273209 20:57749250-57749272 CCCTCTCAGGCCCTGGGAGCTGG - Intergenic
1175797290 20:61779814-61779836 CCCTCTCTGGCCCGTGGCAGGGG + Intronic
1175960607 20:62634589-62634611 CCCTCACAACCCCGTGGCTCTGG - Intergenic
1175964105 20:62651874-62651896 CCCGCTCAACGCCCGGGCACTGG - Intronic
1175966087 20:62660910-62660932 CCCTCGCAGCCCCGGGGAGGCGG - Intronic
1176146083 20:63566160-63566182 CCTGCTCAGCCCTGGGGCACTGG - Exonic
1178915684 21:36704597-36704619 CCCTTTCCGCCCCGGGGTTCAGG - Intronic
1179360716 21:40705784-40705806 CCCTATCAGCCTCAGGACACTGG + Intronic
1179640599 21:42745202-42745224 CCCTCAAAGCCCCGGGGGCCTGG + Intronic
1179726909 21:43345953-43345975 CCCTCTCGGCGACGGGGAACTGG - Intergenic
1179809900 21:43864385-43864407 CCCTCTCAGCCCCAGGACAGCGG - Intergenic
1179890074 21:44330906-44330928 CCCTCTCAGCAGCGGCGCCCAGG - Exonic
1179908283 21:44435294-44435316 CCCTCCCGGCCCCTGAGCACTGG - Intronic
1180763058 22:18223543-18223565 CCCTCTCAGCTCCCGGGCTGGGG - Intergenic
1180772585 22:18401004-18401026 CCCTCTCAGCTCCCGGGCTGGGG + Intergenic
1180803965 22:18650620-18650642 CCCTCTCAGCTCCCGGGCTGGGG + Intergenic
1180806798 22:18718829-18718851 CCCTCTCAGCTCCCGGGCTGGGG - Intergenic
1180951026 22:19720695-19720717 TACTCTCAGCCCCAGGGCCCTGG - Intronic
1181042067 22:20196972-20196994 TCCCCTGAGCCCTGGGGCACGGG + Intergenic
1181217754 22:21344639-21344661 CCCTCTCAGCTCCCGGGCTGGGG - Intergenic
1181532021 22:23522219-23522241 CCCTCCCGGGCCCTGGGCACCGG - Intergenic
1184293631 22:43510728-43510750 CCCAGGCAGCCCCGAGGCACAGG + Intergenic
1184302012 22:43566946-43566968 CCCTCCCAACCCCTGGGCTCTGG + Intronic
1185052860 22:48562899-48562921 CTCTCACAGCCCCGGGACCCCGG + Intronic
1185227057 22:49659260-49659282 CTCCCTCAGTCCCGGGGCACCGG + Intergenic
1185329177 22:50244463-50244485 CCTTCTCAGCTCCGGGCCCCCGG + Exonic
1203234423 22_KI270731v1_random:141992-142014 CCCTCTCAGCTCCCGGGCTGGGG + Intergenic
949921786 3:9008791-9008813 CCCTCTCAGGCCATGGGGACTGG + Intronic
950100834 3:10355709-10355731 CCCCCTCAGGCCCTGGGCATGGG + Intronic
950419697 3:12891588-12891610 CCCTCTCAGTCCCAGGCCACAGG + Intergenic
950687434 3:14628654-14628676 CCCTCTCTGCACAGGGGCAGTGG - Intergenic
951728398 3:25783805-25783827 ACCCCTCAGCCCCGGAGCCCAGG - Intronic
953007630 3:38993026-38993048 CCCACTCAGCCCCAGAGAACTGG + Intergenic
953549938 3:43894335-43894357 CCCGCTCCGCCCCGGCGCAGGGG + Intergenic
958004296 3:87792781-87792803 CGCCCCCAGCCCCGGGGCGCGGG - Intergenic
959479427 3:106853574-106853596 CTCTCTCAGCCAAGAGGCACAGG - Intergenic
961673620 3:128551687-128551709 CCCTCCCAGCACAGGGGAACAGG + Intergenic
961812449 3:129529654-129529676 CCCTCTCAGCCCCTGTCCTCAGG + Intronic
962247274 3:133806075-133806097 CCCTCTCAGCCCCGCGTCCCCGG - Intronic
964570357 3:158103511-158103533 CCCTCGCTGCCCCTGGGCTCGGG + Intronic
966819041 3:183910685-183910707 CTCTCTCAGACCAGCGGCACTGG - Intergenic
968453189 4:684613-684635 GCGTCTCAGCCCCGGAGCCCGGG + Intronic
968562203 4:1290030-1290052 CCCTCGCGGCCCGAGGGCACTGG - Intronic
969140488 4:5067078-5067100 CCTTCTCAGCCACGTGGAACTGG - Intronic
969453788 4:7289617-7289639 CCCTCCCAGGCCCAGGGCAAAGG + Intronic
969506485 4:7591334-7591356 CCCTCCCAGCCCTGGGACTCTGG - Intronic
969540798 4:7787777-7787799 CCCTCGGAGCCCCGAGGCCCTGG - Intronic
969589604 4:8114293-8114315 CCAGCTCTGCCCTGGGGCACAGG + Intronic
969602143 4:8182823-8182845 CCCTCTGAGACCCCTGGCACTGG - Intronic
973613556 4:52658895-52658917 CCGTCTCAGCCCCGGGACCTCGG - Intronic
976390312 4:84498939-84498961 CCCTCTGGCCCACGGGGCACTGG + Intergenic
978189388 4:105895328-105895350 CCCTCCCAGCCCCGGGCGAAGGG - Intronic
979944191 4:126805215-126805237 CCCTCTCACTCCCATGGCACAGG + Intergenic
980115212 4:128672771-128672793 CCCTCACTGCCCGGGGGCAGCGG - Intergenic
980824108 4:138053151-138053173 CCCTCACTGCCCCGGGCCAGCGG + Intergenic
981021039 4:140029116-140029138 TGCTCTCAGCCCAGGGGGACAGG + Intronic
981033691 4:140151072-140151094 CCCTCCCAGCCCAGCGGCCCCGG + Intronic
982929076 4:161378991-161379013 CCGTCTCACCCCCAGGGAACAGG - Intergenic
984734901 4:183099522-183099544 TCCTCCCAGCCCCGGGGCAGCGG - Exonic
985643727 5:1075331-1075353 CCCTTACAGACCCGGCGCACGGG - Intronic
988167772 5:27616743-27616765 CCCTCCCAGCCTGGAGGCACTGG + Intergenic
993661667 5:90645191-90645213 CAGTCTCAGCACCGGGACACGGG + Intronic
994551525 5:101240168-101240190 CCCTTTCAGCCCCTGGGTTCTGG + Intergenic
999247052 5:150160622-150160644 CCCTCTCAGCCCCAGGACCGTGG + Intergenic
1001312937 5:170624063-170624085 TCCTCTCAGCTCCCGGGCCCAGG + Intronic
1002046295 5:176543366-176543388 CCCTCTCCGGCCCGGTGCAGGGG + Intronic
1002259138 5:177982151-177982173 CCCTCCCACCCCCAGGGCACGGG + Intergenic
1002870192 6:1160129-1160151 TCCTCTCAGCCCTGGAGGACAGG - Intergenic
1003152728 6:3566230-3566252 CCCTCCCACCCCCGAGCCACAGG + Intergenic
1004933185 6:20481442-20481464 CCCCCTCAGAGCCGGGGCATGGG - Intronic
1005989837 6:30895997-30896019 CCCTCTTAGCCCTGGGGAAGGGG - Intronic
1006068433 6:31479145-31479167 CCCTCTGAGCCCCAGGGTGCAGG - Intergenic
1006802005 6:36765480-36765502 CCCTCTGGGCCCCAGGGCCCTGG + Intronic
1006808627 6:36805642-36805664 CCGTCCCAGCCCTGGGGCCCAGG - Intronic
1007482677 6:42160355-42160377 CAGGCTCAGCCCCAGGGCACAGG - Intronic
1007622676 6:43224478-43224500 CCCCCTCAGCCCCGTGACTCTGG - Exonic
1008368116 6:50706177-50706199 TCCTCTCAGCCCCAAGTCACTGG - Intergenic
1008592967 6:53011870-53011892 CCCTCTGAGCCTGTGGGCACAGG - Exonic
1011594320 6:89001732-89001754 GCCTCTCTGCCCCGGGCCATGGG + Intergenic
1012131569 6:95499992-95500014 CCCTGTCACCCCCAGGACACAGG + Intergenic
1015044306 6:128760183-128760205 CTCTCTCAGTCCTGGGGCATGGG - Intergenic
1018058421 6:160071302-160071324 GCCTCCCAGGCCCTGGGCACAGG - Intronic
1019699731 7:2468838-2468860 TCCTCTCAGCCCCTGGACTCAGG + Intergenic
1020817585 7:12924548-12924570 CCGTCCCAGCCCCAGTGCACAGG + Intergenic
1021873675 7:25028887-25028909 ACATCTCAGCCCCTGGGCATTGG - Intergenic
1023612109 7:41981667-41981689 CCCTGTCAGCAGCGAGGCACAGG - Intronic
1024043835 7:45574485-45574507 CCCTCGCCGGCCCGGGGCGCCGG - Intronic
1025819061 7:64946448-64946470 CCTTCCCAGCCCAGGGGCACAGG - Intergenic
1027333811 7:77127117-77127139 CCCTCTCACCCACGGGACCCAGG - Intronic
1029781981 7:102744197-102744219 CCCTCTCACCCACGGGACCCAGG + Intergenic
1029926883 7:104328355-104328377 TCCTCTGCGCCCCTGGGCACTGG + Intergenic
1032781976 7:135170796-135170818 CCCTCGCAGTCCCGGCGCCCGGG + Intergenic
1034238553 7:149591912-149591934 CCCTCTGAGCCCAGGCCCACCGG - Intergenic
1034354824 7:150443886-150443908 GCCTCACACCCACGGGGCACAGG - Intergenic
1034946472 7:155265657-155265679 GGCTCACAGCCCTGGGGCACAGG - Intergenic
1035245707 7:157561011-157561033 CCAGCTCAGCCACGGGGCCCAGG - Intronic
1035319170 7:158017423-158017445 CCCTCTCTGCCCCCAAGCACTGG - Intronic
1035588920 8:798447-798469 CCTGGTCAGCGCCGGGGCACGGG - Intergenic
1036581804 8:10081943-10081965 CCCTCACAGCGCTGGGACACAGG - Intronic
1037769322 8:21789480-21789502 CCCCCTCAGACCCGGGCCACCGG - Intronic
1042553168 8:70012230-70012252 CCCTCACAGCCCCGGAGCCTTGG - Intergenic
1044271888 8:90253880-90253902 CCCTCTCACCCCTGTGGCAAAGG + Intergenic
1045062377 8:98421352-98421374 CCCTCTCAGCCTCAGGGGTCTGG - Intronic
1047494237 8:125398278-125398300 TCCTCTCAGTCCAGGGGGACTGG + Intergenic
1048377700 8:133837001-133837023 CCCTCTCAGACCCTGGGTCCTGG + Intergenic
1049218900 8:141420019-141420041 CCCTCTGAGTCCAGGGGCCCAGG + Intronic
1049320205 8:141992208-141992230 CCCTCTCTGCCCTGGGGCATTGG + Intergenic
1049453789 8:142676835-142676857 GCCTCTCAGCCCCTGTCCACCGG + Intronic
1049536628 8:143185626-143185648 CCGGCTCAGCCCCGAGGGACAGG - Intergenic
1049578857 8:143401745-143401767 TCCTCCCAGCCCTGGGTCACAGG - Intergenic
1049593913 8:143474826-143474848 CCCTCCCAGCCCAGGGAAACAGG - Intronic
1049600703 8:143506070-143506092 CCTCCTCAGCCCCAGGGCATGGG + Intronic
1049659014 8:143811456-143811478 CCCTCACAGCCCCTGGAGACCGG + Intronic
1049745174 8:144260248-144260270 CCCTCACAGCCCAGTGGCCCTGG + Exonic
1056190438 9:84179432-84179454 CCCTCTCACCCCTGGGTCAGAGG + Intergenic
1057257012 9:93557980-93558002 CCCTCTCAGGGCAGGGGCAGAGG + Exonic
1060004987 9:119991975-119991997 CCCTCTCAGCCCCAGACCCCCGG - Intergenic
1060967886 9:127721639-127721661 GCAGCCCAGCCCCGGGGCACAGG - Intronic
1061194411 9:129099987-129100009 CCCGGTCAGCCCCAGGGCCCTGG + Intronic
1061281244 9:129598588-129598610 CCCTCTCACCCCAGAGGCAGTGG - Intergenic
1061448372 9:130654972-130654994 CCCTGGCAGCCCCTGGTCACTGG - Intergenic
1061883007 9:133577360-133577382 CCCTCGCAGCCCCGGCCCCCCGG - Intergenic
1062139577 9:134948385-134948407 CCCTCTCACCCCTGGGGAGCTGG - Intergenic
1062310550 9:135933553-135933575 CCCACTCAGCCCACAGGCACAGG + Intronic
1062413541 9:136436596-136436618 CCCTGGCAGCCCCAAGGCACTGG + Intronic
1062464300 9:136674373-136674395 CCCAGGCAGCCCAGGGGCACAGG - Intronic
1185877607 X:3713259-3713281 CGCACTCAGGTCCGGGGCACCGG + Exonic
1187438067 X:19290696-19290718 CGCCCTGAGCCCCAGGGCACTGG - Intergenic
1191025473 X:55908747-55908769 TCCTCCCAGCCCCGGGGCCTGGG - Intergenic
1192203738 X:69082852-69082874 CCCAGAAAGCCCCGGGGCACAGG - Intergenic
1195708584 X:107756626-107756648 TCCTCTCAGGGCCAGGGCACCGG + Intronic
1198215303 X:134549728-134549750 CCCGCTCGGCTCCGGGGCCCGGG + Intergenic
1198310242 X:135422553-135422575 CGGTCTCAGCCCGGGGGCCCTGG + Intergenic
1200045892 X:153400937-153400959 CCCTCTCCGCCCAGGGACCCAGG + Intergenic
1200068157 X:153514808-153514830 CCCTCTCAGCCTCAGGGCTCTGG + Intergenic
1200215922 X:154368241-154368263 CCCTCTCTGCCCAGGGTCCCAGG + Intronic