ID: 1168296406

View in Genome Browser
Species Human (GRCh38)
Location 19:55379136-55379158
Sequence GCCTCACCTCAGGTGTGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 219}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168296393_1168296406 10 Left 1168296393 19:55379103-55379125 CCCAGGGCTCCTGGTCTCCCCAG 0: 1
1: 0
2: 0
3: 57
4: 407
Right 1168296406 19:55379136-55379158 GCCTCACCTCAGGTGTGGCCAGG 0: 1
1: 0
2: 0
3: 15
4: 219
1168296402_1168296406 -8 Left 1168296402 19:55379121-55379143 CCCAGGGCAGGGGCAGCCTCACC 0: 1
1: 1
2: 5
3: 72
4: 517
Right 1168296406 19:55379136-55379158 GCCTCACCTCAGGTGTGGCCAGG 0: 1
1: 0
2: 0
3: 15
4: 219
1168296394_1168296406 9 Left 1168296394 19:55379104-55379126 CCAGGGCTCCTGGTCTCCCCAGG 0: 1
1: 0
2: 3
3: 45
4: 575
Right 1168296406 19:55379136-55379158 GCCTCACCTCAGGTGTGGCCAGG 0: 1
1: 0
2: 0
3: 15
4: 219
1168296403_1168296406 -9 Left 1168296403 19:55379122-55379144 CCAGGGCAGGGGCAGCCTCACCT 0: 1
1: 0
2: 5
3: 83
4: 533
Right 1168296406 19:55379136-55379158 GCCTCACCTCAGGTGTGGCCAGG 0: 1
1: 0
2: 0
3: 15
4: 219
1168296401_1168296406 -7 Left 1168296401 19:55379120-55379142 CCCCAGGGCAGGGGCAGCCTCAC 0: 1
1: 0
2: 22
3: 568
4: 4476
Right 1168296406 19:55379136-55379158 GCCTCACCTCAGGTGTGGCCAGG 0: 1
1: 0
2: 0
3: 15
4: 219
1168296400_1168296406 1 Left 1168296400 19:55379112-55379134 CCTGGTCTCCCCAGGGCAGGGGC 0: 1
1: 1
2: 5
3: 47
4: 514
Right 1168296406 19:55379136-55379158 GCCTCACCTCAGGTGTGGCCAGG 0: 1
1: 0
2: 0
3: 15
4: 219
1168296391_1168296406 18 Left 1168296391 19:55379095-55379117 CCTATATCCCCAGGGCTCCTGGT 0: 1
1: 0
2: 3
3: 28
4: 251
Right 1168296406 19:55379136-55379158 GCCTCACCTCAGGTGTGGCCAGG 0: 1
1: 0
2: 0
3: 15
4: 219
1168296392_1168296406 11 Left 1168296392 19:55379102-55379124 CCCCAGGGCTCCTGGTCTCCCCA 0: 1
1: 0
2: 1
3: 48
4: 473
Right 1168296406 19:55379136-55379158 GCCTCACCTCAGGTGTGGCCAGG 0: 1
1: 0
2: 0
3: 15
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168296406 Original CRISPR GCCTCACCTCAGGTGTGGCC AGG Intergenic
900099773 1:956822-956844 TGCTCACCTCAGGTGAGGCAAGG + Intronic
900140620 1:1138038-1138060 GGCTCACGTCCTGTGTGGCCTGG + Intergenic
900496504 1:2978384-2978406 CCCTCCCCTCTGGTGGGGCCTGG - Intergenic
900653712 1:3744706-3744728 GGCTCACCTTTGGTGTGTCCAGG - Intergenic
901640447 1:10690499-10690521 GCCTCCCCACAGTTGAGGCCTGG + Intronic
903221209 1:21870636-21870658 GCCTCACCTGCTGTGTGGTCTGG - Intronic
904374251 1:30069841-30069863 GCCTCACCTCTGGTGAGTACAGG - Intergenic
904586035 1:31581168-31581190 GGCTCACATCAGCTGTGCCCAGG + Intronic
905050307 1:35045313-35045335 GCCTCACATCAGTTCTGGTCAGG + Intergenic
905091814 1:35436184-35436206 CCCTTAAGTCAGGTGTGGCCAGG - Intronic
905995318 1:42376332-42376354 CACTGACATCAGGTGTGGCCAGG + Intergenic
906403529 1:45522857-45522879 GCCTCACCTCCGGAGTGTCTGGG + Intronic
906645742 1:47473135-47473157 GCCTCATTTCAGAGGTGGCCTGG + Intergenic
915273721 1:154773789-154773811 GGCTCAGCTCAGGTCTGGCAGGG - Intronic
918402099 1:184173765-184173787 GGATCACCTGAGGTCTGGCCAGG + Intergenic
919897519 1:202018485-202018507 GCATCCCCTCAGGTGTGTCCTGG + Intergenic
920676371 1:208041217-208041239 TCCTCACCCCACGTGGGGCCTGG + Intronic
1063112600 10:3049628-3049650 GTCTCACCTACGGTGTTGCCAGG + Intergenic
1063767431 10:9158896-9158918 GACTCACCTAAGGTGTGGTGAGG - Intergenic
1066513795 10:36132463-36132485 GCATCACCACAGGTGTGGACTGG - Intergenic
1066534892 10:36380879-36380901 GCCTCATCTCAGCCGTGGTCTGG - Intergenic
1067161196 10:43826202-43826224 GGCTGACTCCAGGTGTGGCCTGG + Intergenic
1073805923 10:107097602-107097624 GCCTCTGCTAATGTGTGGCCTGG - Intronic
1074534691 10:114320438-114320460 GCCTGACCTCAGGTCCTGCCTGG - Intronic
1076450829 10:130555983-130556005 GCCTCACCTGAGAAGGGGCCAGG - Intergenic
1076450830 10:130555987-130556009 GCCCCTTCTCAGGTGAGGCCAGG + Intergenic
1076736032 10:132459397-132459419 CCCTCCCGTCAGGTGAGGCCTGG + Intergenic
1077335440 11:2001506-2001528 GCCTCACCTCGGCTCTGCCCTGG - Intergenic
1077467513 11:2740553-2740575 GCCTCAGCTCAGCTGGAGCCAGG + Intronic
1078000130 11:7487206-7487228 GCTTCACCTCAGGTCAGGACTGG - Intronic
1078417045 11:11174430-11174452 GCCTTAAATCAGGAGTGGCCGGG - Intergenic
1079187333 11:18249113-18249135 GCCACATCTCATGTGTGCCCTGG + Intergenic
1080666678 11:34342447-34342469 TCCTGTCCTCAGGAGTGGCCTGG - Intronic
1080829389 11:35877208-35877230 GCCTCAACTTTGCTGTGGCCAGG + Intergenic
1081876198 11:46410004-46410026 TCCTCACCCCAAGTGTGCCCAGG + Intronic
1085040347 11:73323168-73323190 GCCAGACTGCAGGTGTGGCCTGG - Intronic
1085197228 11:74680024-74680046 GCCTTTGCTCAGGTGTGGCTAGG + Intergenic
1087713160 11:101577789-101577811 GCCTCGCCTCAGGTGTGCAGAGG + Intronic
1089514598 11:119024562-119024584 GCCTCACTTCAGGTGGGGATGGG + Exonic
1090395191 11:126414178-126414200 GCCTCATCTCAGACCTGGCCAGG - Exonic
1202818423 11_KI270721v1_random:56688-56710 GCCTCACCTCGGCTCTGCCCTGG - Intergenic
1091617970 12:2064383-2064405 GGCTCCCCTCATGTGTGGCTGGG + Intronic
1091845231 12:3650653-3650675 GCCTCTCTCCAGGGGTGGCCAGG + Intronic
1095950581 12:47779738-47779760 CCCTCACCTGCTGTGTGGCCTGG - Intronic
1096648456 12:53050388-53050410 GCATCCCCTCCGGAGTGGCCAGG + Intronic
1100199594 12:92284233-92284255 GGCTCACCTCAATTGTGACCTGG - Intergenic
1103013446 12:117475739-117475761 TCCTCCCCTTAGGTGTGGACTGG + Intronic
1105855728 13:24370565-24370587 TCCTCACCCCTGGTGTGACCAGG + Intergenic
1110274898 13:73632419-73632441 GCCTCAGCTCTGGTGCTGCCTGG + Intergenic
1110611970 13:77498636-77498658 GTCTCTCATCAGGTGTGGTCAGG + Intergenic
1115518609 14:34210128-34210150 GCCTCTAGTCTGGTGTGGCCAGG - Intronic
1118019334 14:61695366-61695388 GCCTCACCTGAGGTGGAGGCGGG - Intergenic
1119515001 14:75240967-75240989 GCCTCACCCAGGGTGTGGCCTGG - Intronic
1119551461 14:75516972-75516994 GCCTCCCCTCAAGTGTGGGCTGG + Intergenic
1119679792 14:76584012-76584034 CCCTGCCCTCATGTGTGGCCTGG - Intergenic
1121106485 14:91283322-91283344 GACTCACCTTTGGTGCGGCCTGG + Exonic
1121311104 14:92935548-92935570 GGCCCAGCTCAGGTGTGGCTGGG - Intergenic
1122294935 14:100700104-100700126 TCCACAGCTCAGGTGTGGGCAGG - Intergenic
1122408997 14:101516690-101516712 GCCTCACATGGGGTGTGGGCTGG - Intergenic
1122623850 14:103074301-103074323 GCCACACCCCAGCTGGGGCCTGG - Intergenic
1123017656 14:105383067-105383089 GCCTCCCCTCAGTTGTGGGCGGG + Intronic
1124589847 15:31043306-31043328 GCCTCACCTCTGGAGTAGCTGGG + Intronic
1124949240 15:34301193-34301215 TCCTGACCTCAGGTGAGGTCAGG + Intronic
1130858216 15:87861043-87861065 GCCTCAGAACAGGTGTGCCCAGG + Intronic
1130878038 15:88031429-88031451 GGCTCACCCCAGGACTGGCCTGG - Intronic
1131911955 15:97215883-97215905 CTCTCACCTGAGGAGTGGCCAGG - Intergenic
1132350081 15:101133958-101133980 GCTGCAGCTCAGGCGTGGCCTGG + Intergenic
1132543365 16:521705-521727 GCTTCTCCACAGGTGCGGCCTGG + Exonic
1132756263 16:1486965-1486987 GGCTCAAATCAGGTGTGGACAGG + Intronic
1134449815 16:14356253-14356275 GACTGACCTCATGGGTGGCCAGG - Intergenic
1136640875 16:31564066-31564088 ACCTCAGCTCTGGTGTGTCCAGG - Intergenic
1136664091 16:31793248-31793270 ACCTCAGCTCTGGTGTGTCCAGG + Intronic
1137447731 16:48542140-48542162 GCCACAGCTGAGGAGTGGCCGGG - Exonic
1137710216 16:50561594-50561616 GCCTCACCTCATGAGTAGCTTGG + Intronic
1140339741 16:74146103-74146125 GCCTGCCCTCTGTTGTGGCCTGG - Intergenic
1141745738 16:85924988-85925010 GCCTGAGATCAGGTGTGCCCTGG - Intergenic
1141904822 16:87017526-87017548 GCCTGACCTCAGGGATGCCCAGG + Intergenic
1142174103 16:88637088-88637110 CCCCCACCTCTGATGTGGCCAGG + Intergenic
1142178466 16:88655872-88655894 GCGTCACCCCTGCTGTGGCCGGG - Intronic
1143182195 17:4990255-4990277 TCCTCACCTCAGGTGTTCCAGGG - Exonic
1144672875 17:17142784-17142806 GCAGCACCTCAGGGGTGGCTCGG + Intronic
1145250002 17:21292076-21292098 GCGTCACCTCAGGCGTGTCCTGG + Intronic
1147689327 17:42305810-42305832 GCCTCACCTCACCTCTGGGCTGG - Intronic
1147769765 17:42859464-42859486 GCCTCCCCTCATCTGGGGCCTGG - Intergenic
1149496550 17:57121960-57121982 GCCACAGCTCAGGCTTGGCCAGG - Intergenic
1149498572 17:57134566-57134588 GCCTCCCCCCAGGTGTGGAATGG + Intergenic
1151450306 17:74194702-74194724 CCCTCAGCACAGGTGGGGCCTGG - Intergenic
1151685746 17:75645765-75645787 GATTCTCCCCAGGTGTGGCCAGG - Intronic
1152045260 17:77930885-77930907 GCCATCCCTCAGCTGTGGCCTGG + Intergenic
1152327666 17:79650969-79650991 GCCCCACCTCAGGCGAGTCCCGG - Intergenic
1152860979 17:82697181-82697203 CCCTAAGCTGAGGTGTGGCCGGG + Intronic
1152928761 17:83099662-83099684 GCCGCTCCTCAGGTGGGGGCAGG - Intergenic
1154197255 18:12275697-12275719 GGCCCACCTCAGGTGAGGCCAGG - Intronic
1154197257 18:12275701-12275723 GCCTCACCTGAGGTGGGCCAGGG + Intronic
1160969331 19:1760465-1760487 GCCGATCCTCAGGTGGGGCCAGG + Intronic
1161262669 19:3346352-3346374 GCCTGAGCTCAGTTCTGGCCAGG + Intergenic
1161315307 19:3614754-3614776 CCCTCCCCTCCGCTGTGGCCAGG - Intronic
1163316368 19:16542891-16542913 GCTCCACCTCCGGTCTGGCCGGG - Intronic
1163366190 19:16877309-16877331 GGCGCTCCTCAGCTGTGGCCTGG + Intronic
1163862079 19:19747874-19747896 GCCCCCTCTCAGGTGTTGCCTGG - Intergenic
1164544056 19:29144530-29144552 GGCCCAGGTCAGGTGTGGCCTGG - Intergenic
1165209736 19:34224543-34224565 GCCTCTGCTTAGGTGTTGCCAGG + Intronic
1165330466 19:35138923-35138945 GCCTCACCCCTGGTCTGGCTGGG + Intronic
1165430159 19:35767620-35767642 CCCTCAGCTCAGGGGTGTCCTGG + Intronic
1166903047 19:46081125-46081147 CCCTGACCTTTGGTGTGGCCTGG - Intergenic
1168113755 19:54209418-54209440 GCCTCATCTCAGGGGCGTCCAGG - Intronic
1168134944 19:54344635-54344657 GCCTCACCTCCGGAGTAGCTGGG + Intergenic
1168296406 19:55379136-55379158 GCCTCACCTCAGGTGTGGCCAGG + Intergenic
925119918 2:1410368-1410390 GACTCACCTGACATGTGGCCAGG - Intronic
926087345 2:10028704-10028726 TGCTCAGCTCAAGTGTGGCCGGG + Intergenic
926275640 2:11401203-11401225 GCCGCACCTGAGGAGTAGCCTGG + Intergenic
927519442 2:23690122-23690144 GCCTCAGCACAGGCATGGCCAGG - Intronic
927822268 2:26278086-26278108 ACCCCACCTCATGTGTGGCGGGG + Intronic
927879342 2:26679715-26679737 ACCTCACCTCAGGTGGGGATTGG + Intergenic
927893250 2:26765404-26765426 GCCTCCCCTCTGTTGTGGGCAGG + Intronic
928441902 2:31299238-31299260 GCCTGGCCTCTGCTGTGGCCAGG + Intergenic
933194416 2:79372100-79372122 GCCTCACCTCAGGTTCACCCCGG - Intronic
936429614 2:112450836-112450858 CCCTCCCCTTAAGTGTGGCCTGG + Intergenic
937767686 2:125680485-125680507 GCCTCCCCTAAGTTCTGGCCTGG + Intergenic
938116534 2:128606325-128606347 GCACGCCCTCAGGTGTGGCCAGG + Intergenic
938116555 2:128606442-128606464 GCACGCCCTCAGGTGTGGCCAGG + Intergenic
938116563 2:128606481-128606503 GCATGCCCTCAGGTGTGGCCAGG + Intergenic
938116571 2:128606520-128606542 GCATGCCCTCAGGTGTGGCCAGG + Intergenic
938378328 2:130823039-130823061 GCCTCAGCTCAGGGTGGGCCTGG + Intergenic
939626258 2:144481258-144481280 CCCTGACCTCAAGTGTGCCCCGG + Intronic
943511827 2:188835971-188835993 GCCTCACCTATGGTGTGGGAAGG - Intergenic
945656573 2:212631815-212631837 GCCTCATGTAAGGTGTGGTCAGG - Intergenic
946255369 2:218438123-218438145 CCCTCACCTCAAGTGTGTGCTGG + Intronic
947739814 2:232479987-232480009 CCCTCACTTCAGGAGGGGCCTGG - Exonic
948778739 2:240304137-240304159 GCCTCAGCTCAGCTCTGACCTGG + Intergenic
1170635287 20:18099119-18099141 GCCTCACCCTTGGTGTTGCCTGG + Intergenic
1171317118 20:24205131-24205153 AGCTCAGCTCAGGTCTGGCCAGG + Intergenic
1172534661 20:35664255-35664277 TCCTCCCCACAGGTGTGACCTGG + Intronic
1175698647 20:61121540-61121562 GCCCCTCCTCAGGTGAAGCCAGG - Intergenic
1176104921 20:63381446-63381468 CCCTCACCTCCTGTGTGGCTCGG + Intergenic
1179551418 21:42146315-42146337 GCCTGTCCTCAGCTGTGACCAGG + Intergenic
1179646745 21:42780693-42780715 GCATCACCTCAACAGTGGCCAGG + Intergenic
1180075370 21:45459140-45459162 GCCCCTTCCCAGGTGTGGCCTGG + Intronic
1180166729 21:46034352-46034374 GCGTCACCTGCGGTGTGGACGGG + Intergenic
1180166743 21:46034408-46034430 GCGTCACCTGCGGTGTGGACGGG + Intergenic
1180166757 21:46034464-46034486 GCGTCACCTGCGGTGTGGACGGG + Intergenic
1180166771 21:46034520-46034542 GCGTCACCTGCGGTGTGGACGGG + Intergenic
1180166785 21:46034576-46034598 GCGTCACCTGCGGTGTGGACGGG + Intergenic
1180166825 21:46034744-46034766 GCGTCACCTGCGGTGTGGACGGG + Intergenic
1180166839 21:46034800-46034822 GCGTCACCTGCGGTGTGGACGGG + Intergenic
1180166853 21:46034856-46034878 GCGTCACCTGCGGTGTGGACGGG + Intergenic
1180166923 21:46035136-46035158 GCGTCACCTGCGGTGTGGACGGG + Intergenic
1180166937 21:46035192-46035214 GCGTCACCTGCGGTGTGGACGGG + Intergenic
1180166991 21:46035416-46035438 GCGTCACCTGCGGTGTGGACGGG + Intergenic
1180167005 21:46035472-46035494 GCGTCACCTGCGGTGTGGACGGG + Intergenic
1181045134 22:20210778-20210800 CGCTCACCTCAGCTGTGGCGTGG + Intergenic
1183661632 22:39224890-39224912 GCCTCCCCTCAGAGCTGGCCAGG + Exonic
1184302910 22:43573027-43573049 GCCTCACCTCCGGGGTCCCCTGG - Intronic
1184386785 22:44181316-44181338 GCCTCAGCTCAGGGGCGGGCAGG + Intronic
1184531702 22:45060412-45060434 GCCTCTGCTCAGGAGTCGCCGGG + Intergenic
1185247486 22:49780834-49780856 GCCCCACCTCAAGGCTGGCCTGG - Intronic
949281917 3:2355978-2356000 ACCTCCCCTCAGTTGTTGCCTGG + Intronic
949850169 3:8412840-8412862 GCCTCAAGGCAAGTGTGGCCTGG - Intergenic
953492593 3:43363900-43363922 GCCTCACCTCAAAAGTGGCCAGG - Intronic
954366959 3:50151375-50151397 GGCTCACCTCAGGTGGGGAGAGG - Intergenic
955706201 3:61730294-61730316 GACTCACAACAGATGTGGCCTGG - Intronic
960048188 3:113217083-113217105 GCCTGGCATCAGGTGTGGGCTGG + Intronic
960169678 3:114444416-114444438 ACCTCACCTCGGATGTGGCAGGG - Intronic
962835189 3:139183565-139183587 CCCTCATCTCAGCTGTGCCCAGG - Intronic
967933686 3:194709355-194709377 ACCTCACATCTGGGGTGGCCTGG - Intergenic
968866978 4:3219325-3219347 GCCTATCCTCAGGTGTGCTCTGG - Intronic
968871392 4:3244481-3244503 ATCCCACCTCTGGTGTGGCCGGG + Intronic
969201997 4:5613868-5613890 GTCTCCCATCAGGTGTGTCCAGG - Intronic
969461942 4:7333607-7333629 GCCTCACCTGGGGACTGGCCAGG + Intronic
969686091 4:8675069-8675091 GGCTCTCCCCAGCTGTGGCCTGG - Intergenic
971544102 4:27862522-27862544 TCCTGACCTCAGGTTTGGCATGG + Intergenic
973069202 4:45835965-45835987 GCCTCCCCTGAGTTCTGGCCAGG + Intergenic
979507500 4:121514749-121514771 GCCCCACATCAGGAGAGGCCAGG - Intergenic
979985520 4:127309407-127309429 GCCTCAGGACAGGGGTGGCCTGG - Intergenic
985733915 5:1566316-1566338 GCCTCCCCTGAGGTGGGTCCCGG - Intergenic
985775772 5:1841044-1841066 TCCTCAACTCAGGGGTCGCCAGG - Intergenic
986783095 5:11085016-11085038 GGCTCATTTCAGATGTGGCCAGG - Intronic
993806032 5:92410606-92410628 GCCACATTTCAAGTGTGGCCAGG + Intergenic
994024801 5:95070207-95070229 GCCTGACTGCAGATGTGGCCTGG - Intronic
1001775784 5:174328127-174328149 GCCTGTCCCCAGGTGTGACCGGG - Intergenic
1002520266 5:179789018-179789040 TCCTGACCTCAGGTGAGGACAGG + Intronic
1002528994 5:179832589-179832611 GCCACACGGCAGGTGGGGCCAGG - Intronic
1005654800 6:27924390-27924412 GCCTCACCTCCGGCGTTTCCTGG + Intergenic
1006452852 6:34115086-34115108 ACCTCTCCTCAGGGGTTGCCTGG + Intronic
1011470234 6:87701439-87701461 GCCTCACCACAGGTGGGACCCGG - Exonic
1011627044 6:89291225-89291247 GCCCCTCATCAGCTGTGGCCTGG + Intronic
1016830011 6:148424725-148424747 GCCCCACCTGAAGTCTGGCCTGG - Intronic
1017125555 6:151060954-151060976 GCCTAACCTGAGGTGTAGGCAGG + Intronic
1017619046 6:156276041-156276063 GCTCCACCTCAGTTGTGGCGTGG - Intergenic
1018109790 6:160524028-160524050 GGCTCTGCTCTGGTGTGGCCTGG + Intergenic
1019126960 6:169846925-169846947 GCGTGAGCTCAGGTGGGGCCAGG - Intergenic
1019338241 7:495100-495122 GCCCCACCCCAGGGGTGGGCTGG - Intergenic
1019684539 7:2373767-2373789 GCCTCTCCTGAGGTTTGGCATGG + Intronic
1019925944 7:4191820-4191842 CCATCTCCACAGGTGTGGCCGGG + Intronic
1019938857 7:4273648-4273670 CCCTCAGCACACGTGTGGCCTGG + Intergenic
1020151710 7:5686958-5686980 TGCTCACCTCCTGTGTGGCCTGG + Intronic
1022514249 7:30965385-30965407 GCCTCCCCTCAGGGGTGGGTGGG + Intronic
1022629897 7:32075399-32075421 GCCTCACATCTGGTGTGGGCGGG - Intronic
1023652920 7:42389851-42389873 TAATCAGCTCAGGTGTGGCCTGG - Intergenic
1023989879 7:45122364-45122386 GGCTGACCTCAGGTCAGGCCTGG + Intergenic
1025557230 7:62324290-62324312 TCCTCACCCCAGCAGTGGCCAGG + Intergenic
1029791617 7:102848769-102848791 GCATCACCTGAGGTGAGGTCAGG + Intronic
1029931432 7:104375221-104375243 GCCTCACCCCCGGTGTAGCTGGG - Intronic
1037568360 8:20136695-20136717 GCCTCACCTCCCGAGTGGCTCGG - Intergenic
1037937114 8:22922369-22922391 AGCTCACCTCAGGTTTGTCCAGG - Intronic
1039553545 8:38460514-38460536 GCCTCCTCCCAGGTGTGGGCTGG + Intronic
1039810555 8:41044275-41044297 GCCTCCCCTGAGTTCTGGCCAGG + Intergenic
1041528525 8:58836314-58836336 ACCACACCTCAGGTTTGGCAGGG + Intronic
1043150267 8:76706131-76706153 GCCTCACCCCAGGCTTGCCCGGG + Exonic
1044868179 8:96592896-96592918 GCCTCAGCACAGGTCTGGGCTGG + Intronic
1049236418 8:141514581-141514603 GCCTCCACTCAGGAGTGGGCTGG - Intergenic
1049317190 8:141975566-141975588 ACCCCTCCTCAGGGGTGGCCGGG - Intergenic
1049535903 8:143181634-143181656 GCCTCACCCCAGGGCAGGCCTGG + Intergenic
1049805835 8:144538428-144538450 TCCACCCCTCAGGTGTGGGCCGG - Intronic
1052821875 9:33144073-33144095 GTCTCACCTGAGATGTTGCCAGG + Intronic
1053145227 9:35707341-35707363 GCCTCACCTCAGGGCTGATCTGG + Exonic
1057047790 9:91899288-91899310 GCCCAGCCTCAGCTGTGGCCTGG - Intronic
1057432246 9:95004976-95004998 GCATCACCTCAGGCGCGGCGCGG - Intronic
1058161814 9:101578488-101578510 GTCTCACCACAGGAGAGGCCAGG + Intronic
1061687544 9:132294072-132294094 GCCTCACCTTAGTCCTGGCCCGG + Intronic
1061746913 9:132746771-132746793 TGCTCGCCTCACGTGTGGCCCGG - Intronic
1062292857 9:135805052-135805074 GCCTCACCCCATGTCTGGCCTGG + Intergenic
1062657944 9:137613858-137613880 CCCTCACCTCAGCTGGGGACAGG - Intronic
1186227211 X:7412499-7412521 CCCTCCCCTCAGGTATGGGCTGG - Intergenic
1187599669 X:20814267-20814289 CCCTCTCTTCAGGTCTGGCCTGG - Intergenic
1188002352 X:24994628-24994650 GCCTCTCCTCAGGTGCGGGCTGG + Intronic
1188543641 X:31277637-31277659 GCCTCAACTCAGGTGTACCTCGG - Intronic
1189310135 X:40012976-40012998 GCCTCTGCTCTGGTGTGGGCTGG + Intergenic
1189858836 X:45251580-45251602 CCCTGCCCTCAGGTGTGGCTGGG + Intergenic
1190318292 X:49164990-49165012 GCCTCACCTTAGGTGGGGGCCGG + Exonic
1191995819 X:67094330-67094352 GCCTCAGCTCAGAAGTGCCCAGG + Intergenic
1199048208 X:143202903-143202925 GCCTCTGCTCAGGTGTGGGAGGG + Intergenic
1199979751 X:152914512-152914534 GCCGCACCAAAGGTGAGGCCTGG + Exonic
1200118262 X:153778682-153778704 GCCTCCCCTCCGGAGTGCCCTGG - Intronic
1200247848 X:154535367-154535389 GCTTCTCCTCTGGGGTGGCCTGG + Exonic