ID: 1168296528

View in Genome Browser
Species Human (GRCh38)
Location 19:55379728-55379750
Sequence CAGTGAAGACAGAAGGAGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 662
Summary {0: 1, 1: 0, 2: 7, 3: 55, 4: 599}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168296528 Original CRISPR CAGTGAAGACAGAAGGAGGC CGG Intronic
900540817 1:3201819-3201841 CAGTGGACACAGAAGTGGGCGGG - Intronic
900614107 1:3556751-3556773 CAGTGAAAACACAAGGATGCAGG + Intronic
900852706 1:5156679-5156701 GAGTGAGGAGAGAAGGAGGGAGG + Intergenic
900967863 1:5971840-5971862 CACTGGAGACAGAGGGAGACGGG + Intronic
901186357 1:7375869-7375891 CAGGGTGGACAGAAGGGGGCAGG + Intronic
901235944 1:7667665-7667687 CAGAAAGGACAGAAGGAGTCAGG - Intronic
901808588 1:11752845-11752867 CAATGAGGTCAGAAGGTGGCTGG + Intronic
901956974 1:12793412-12793434 CAGTGATCCCAGAGGGAGGCAGG - Exonic
901980370 1:13029548-13029570 CAGTGATCCCAGAGGGAGGCAGG - Intronic
902001717 1:13199383-13199405 CAGTGATCCCAGAGGGAGGCAGG + Intergenic
902020945 1:13345108-13345130 CAGTGATCCCAGAGGGAGGCAGG + Exonic
902546519 1:17193842-17193864 CAGAAAAGAGAGCAGGAGGCAGG + Intergenic
902797657 1:18809902-18809924 AAGGGAAGAAAGAAGAAGGCAGG + Intergenic
903122822 1:21227389-21227411 CCCTGAAGCCAGAGGGAGGCTGG + Intronic
904193542 1:28766415-28766437 CAGTGAAGACAGACTTAGGAGGG - Intronic
905052403 1:35063044-35063066 AAGAGAAGACGGAAGGAGTCTGG - Intronic
905120664 1:35679428-35679450 CAGAGAAGCCAGGAGGAGGGAGG - Intergenic
905456351 1:38090706-38090728 CAGTGAACACAGAAGGGTGAAGG + Intergenic
905515382 1:38558552-38558574 AGGTGAAGATAGAAGGGGGCTGG - Intergenic
906291039 1:44619318-44619340 CAAAGAAGCCAGAGGGAGGCTGG + Intronic
906513157 1:46423123-46423145 CAGAGAAGACATGAGGAGACTGG - Intergenic
906747781 1:48233802-48233824 CAGTGGAGATTGGAGGAGGCTGG - Intronic
906922981 1:50084581-50084603 CATACAAGACAGAAGGGGGCAGG - Intronic
907695345 1:56721073-56721095 CTGTGAATACAAAAGGAGACTGG - Intronic
907904687 1:58773558-58773580 AAGTGAAGTCAGAAAGAGGCAGG - Intergenic
908424373 1:63991570-63991592 AAGGAAAGACAGAAAGAGGCAGG + Intronic
909169759 1:72281171-72281193 AAGTGAAGACTGATGGAGGGAGG + Intronic
909659064 1:78062372-78062394 CAGAGAACACAGAAGAAGGAAGG - Intronic
910455095 1:87389394-87389416 CAGGGAAGACAGAAAGAAGTGGG + Intergenic
910465273 1:87492596-87492618 CATGGAAGCCAGAAGGAGGATGG + Intergenic
910852901 1:91666099-91666121 CAGTGTTGGGAGAAGGAGGCTGG + Intergenic
911176848 1:94825842-94825864 CAAAGAAGACAGGAGGAGGAAGG + Intronic
911210568 1:95134312-95134334 CAGTGAGGAAAGGAGGAGGGTGG + Intronic
911679411 1:100697598-100697620 GAGTGAAGAGGGAAGGAGGGTGG - Intergenic
912370235 1:109168062-109168084 AAGTGAAGACAGAAGGAACTTGG - Intronic
912579556 1:110707799-110707821 CAGAGAAGAGAAAAGGAGGCAGG - Intergenic
912972671 1:114298730-114298752 CAGAGAAACCAAAAGGAGGCTGG - Intergenic
914360099 1:146927668-146927690 CATGGAAGCCAGAAGGAGGATGG + Intergenic
914456413 1:147841146-147841168 CAGGGAACCCAGAGGGAGGCGGG - Intergenic
914493648 1:148172228-148172250 CATGGAAGCCAGAAGGAGGATGG - Intergenic
914782011 1:150793896-150793918 GAGAGAAGAAAGAAAGAGGCCGG - Intergenic
914939237 1:152007430-152007452 CAGAGATCAAAGAAGGAGGCTGG - Intergenic
915548313 1:156616386-156616408 CAGTGAGGACAGAATGAGAAAGG - Intergenic
915625876 1:157113819-157113841 CAGGGAAGACAGGAGCAGGAAGG - Intergenic
915902568 1:159856939-159856961 CAGTGAGGACAGGAGAAGCCAGG + Intronic
915972178 1:160362671-160362693 CAGGGAAGACAGATGGATGGGGG + Intergenic
916324198 1:163538906-163538928 AAGGGAATAAAGAAGGAGGCTGG + Intergenic
916741619 1:167651380-167651402 CAGGCATGACAGAAGGAGCCAGG - Intronic
916811036 1:168306056-168306078 CACTGAGGAAGGAAGGAGGCTGG - Intronic
917202667 1:172533470-172533492 CAGAGAGCACAGAAAGAGGCAGG - Exonic
917483451 1:175433120-175433142 GAGAGAAGACAGAAGGAGCCTGG + Intronic
920004889 1:202825890-202825912 CAGTGAAGACAGCTCCAGGCGGG - Exonic
920056534 1:203196919-203196941 CTGTGAAGGCAGAAGCAAGCCGG - Intergenic
920070080 1:203296478-203296500 CAGTGAAGACGGGATGAGGTGGG - Intergenic
920181153 1:204132260-204132282 TGGGGAAGACAGAAGGAAGCTGG + Intronic
921778584 1:219132796-219132818 CAGGGAAGAAAGAAGGTGACTGG + Intergenic
921884153 1:220287639-220287661 CAGTGAAAAGTGAAGGAGGATGG - Intergenic
922184831 1:223265048-223265070 TAGTTAAGACAGAGGGAGGGTGG + Intronic
923044624 1:230346607-230346629 CACTTAAGACAAAAGTAGGCAGG - Intronic
923070382 1:230558838-230558860 CATTGTAGACTGAAGGAGGGTGG - Intergenic
923809356 1:237295293-237295315 CAGGAAAGTCAGAAGGAGGAAGG + Intronic
924114544 1:240732225-240732247 CAGAGAAAAAAGAATGAGGCAGG - Intergenic
924131859 1:240917673-240917695 CAGAGAAGGCAGAAAGAGACAGG + Intronic
924433189 1:244015035-244015057 CAGTGACGGCAGAGGGAGCCAGG + Intergenic
924440602 1:244082362-244082384 AAGTGAAGACAGGAGGAAGTGGG + Intergenic
924469399 1:244326981-244327003 CCATGAAGATAAAAGGAGGCTGG - Intergenic
924660034 1:246007511-246007533 AAGAAAAGGCAGAAGGAGGCCGG + Intronic
1063149253 10:3321824-3321846 CACGGAAGAAAGATGGAGGCCGG - Intergenic
1063167254 10:3474475-3474497 CAGTGAAGAAAGAGGGTTGCTGG - Intergenic
1063236590 10:4123263-4123285 CTGTGAAGACTGAAAGAAGCAGG + Intergenic
1063335033 10:5203903-5203925 CAGTGAAGAGTGTGGGAGGCAGG + Intronic
1063736853 10:8766782-8766804 AAGTGAAGACGGAGGGAGGAAGG - Intergenic
1064376346 10:14799966-14799988 TAGAGGAGAAAGAAGGAGGCAGG + Intergenic
1064844670 10:19638310-19638332 CAGGGAAAACAAAAGGAGGTGGG + Intronic
1065736560 10:28758296-28758318 AAGTAGAGACAGAAGGAGGAAGG - Intergenic
1065788996 10:29242552-29242574 CAGTGAATACAAGAGGAAGCGGG + Intergenic
1065969603 10:30795968-30795990 CAGTGAGGCCAGAGGCAGGCAGG + Intergenic
1066009108 10:31177290-31177312 CAGTGAAGGGAGAAGGTGGAGGG - Intergenic
1066095432 10:32067677-32067699 CATTGAAGACATGAGGATGCTGG - Intergenic
1068357695 10:55931258-55931280 CAGTGAGGACAACAGCAGGCTGG - Intergenic
1068416963 10:56735304-56735326 AAGGAAAGACAGAAGAAGGCAGG - Intergenic
1068425700 10:56860770-56860792 CATGGAAGACAGATGTAGGCTGG + Intergenic
1070518083 10:77226420-77226442 CAGTGAAGACAGAAAGAGACAGG - Intronic
1070699577 10:78591288-78591310 CAGTGAACAAAGAAGGAAACAGG + Intergenic
1071249370 10:83801326-83801348 CAATGGAGAAAGATGGAGGCTGG + Intergenic
1071796896 10:89017723-89017745 CAGCGAGGGCAGAAGGAGGAAGG - Intergenic
1071927017 10:90421725-90421747 TAGTGAAGACAGAAAGGGACAGG + Intergenic
1072163948 10:92793782-92793804 CAGAGAAGAGACAAGGAGCCAGG - Intergenic
1072237898 10:93468980-93469002 CTGTGTAGCCAGAAAGAGGCAGG - Intronic
1073509373 10:104033834-104033856 CTGTGAAGACAGAATCAAGCAGG - Intronic
1073643864 10:105279431-105279453 AAATGAAGAAAGAAGGAGGGAGG - Intergenic
1074122211 10:110501189-110501211 CAGTCAAGAGAGAATGAGGCAGG - Intronic
1074855441 10:117469708-117469730 CAGTGAAGCCAGGAGGGAGCAGG - Intergenic
1075873172 10:125785967-125785989 CAGGAAGGACACAAGGAGGCTGG + Intronic
1076273167 10:129174488-129174510 CAGAGCAGAAAGAAGGAGGCAGG - Intergenic
1076407899 10:130225562-130225584 CCGAGAAGACAGAAGGTGCCAGG - Intergenic
1076686219 10:132199602-132199624 CAGTGCGGACAGCAGGAGGAGGG - Intronic
1077010708 11:377996-378018 CAGTGATGACAGGCAGAGGCAGG + Intronic
1077612715 11:3653975-3653997 CAGTGAGGACAGACAGAGGTAGG - Intronic
1077612761 11:3654353-3654375 CAGTGAGGACAGACAGAGGTAGG - Intronic
1077612777 11:3654479-3654501 CAGTGAGGACAGACAGAGGTAGG - Intronic
1077612785 11:3654542-3654564 CAGTGAGGACAGACAGAGGTAGG - Intronic
1077612817 11:3654794-3654816 CAGTGAGGACAGACAGAGGTAGG - Intronic
1078011908 11:7578916-7578938 CAGTGATGGCAGACAGAGGCGGG + Intronic
1078170407 11:8925189-8925211 TAGTGAAGAAAGAAAAAGGCAGG + Intronic
1078192522 11:9103737-9103759 CAGTGACCACAGAAGAAAGCGGG - Intronic
1078456366 11:11478837-11478859 CACTGAAGAGAGATGGGGGCGGG + Intronic
1078917046 11:15788087-15788109 CAGTGAAGACAGAAAAAGTAAGG + Intergenic
1079130497 11:17744424-17744446 GAGTGAGGACAGGATGAGGCAGG - Intronic
1079524954 11:21374976-21374998 CAGAGAAGAAGGAAGAAGGCAGG + Intronic
1080120064 11:28666866-28666888 CAGTGAGCACAGCAGGAGGGAGG + Intergenic
1080186521 11:29493846-29493868 CAAAGAAGACAGAAGGAAGAGGG - Intergenic
1081565766 11:44260157-44260179 CAGGGAAGCTAGAAGGGGGCAGG - Intergenic
1081721098 11:45288947-45288969 CAGTTAAGACAGTCTGAGGCTGG + Intergenic
1081751422 11:45513867-45513889 AAGTGAAGGCAGAGGGAGGAAGG + Intergenic
1081779208 11:45698495-45698517 CAGAGAAGAAAAAGGGAGGCAGG + Intergenic
1081905885 11:46669605-46669627 CAGGGAAGATAGAAGGTGGTAGG - Intronic
1082655431 11:55850481-55850503 CAGTGAAGTCAGAAGGTGAACGG + Intergenic
1082718673 11:56646561-56646583 CAGGGGAGACAGAAGAAGGATGG - Intergenic
1083048419 11:59755984-59756006 CAGGAAAGGGAGAAGGAGGCTGG - Intronic
1083148337 11:60774697-60774719 CAGTGATGACAGAAAGGGGCTGG + Intronic
1083380608 11:62265289-62265311 TAGTGAAGAAAGAAGATGGCTGG - Intergenic
1083471117 11:62884679-62884701 CAGTGAAGACAGGTGGGTGCAGG + Exonic
1083659918 11:64247168-64247190 CAATGAGGACAGAATGAGGAAGG - Intergenic
1083713375 11:64562129-64562151 CAGTGAACTCAGAAAGATGCCGG - Exonic
1084147024 11:67270415-67270437 CAGGGAAGCCAGAAAGGGGCAGG - Intronic
1084176026 11:67422831-67422853 CACTGAAGAGAGAGGGAGGGTGG - Intronic
1084346090 11:68549923-68549945 CTGTGGAGACAGCAGGAGTCTGG + Intronic
1084429403 11:69102854-69102876 CAGTGAAGACAGGAGAACACGGG + Intergenic
1084542678 11:69797322-69797344 CAGTGAGCAGAGAAGGACGCTGG + Intergenic
1085395510 11:76205296-76205318 CAGATAAGACAGCAGGGGGCAGG - Intronic
1085567147 11:77524550-77524572 CAGAGAACACAGAAGAGGGCAGG - Intronic
1085751702 11:79167816-79167838 CTGTGGACACAGAAGGAGCCTGG - Intronic
1086093412 11:83026515-83026537 CAGTCATGACAGAAGGTGACCGG - Intronic
1087679364 11:101202346-101202368 GAGTGGAGGCAGAAGGAGCCAGG - Intergenic
1087897023 11:103597520-103597542 CAGAGTAGACAGAAGGAAACAGG - Intergenic
1088750658 11:112839642-112839664 CAGTGTACACAGGAGGTGGCAGG + Intergenic
1089014707 11:115156574-115156596 AGGGGAAGACAGAAGGAGGGAGG - Intergenic
1089120424 11:116130628-116130650 CAGTAGAGAAAGGAGGAGGCAGG - Intergenic
1089558868 11:119333414-119333436 CAGGGCAGACTGAAGGAGGACGG + Intergenic
1089846638 11:121463999-121464021 CTGTGAGGACAGAAGGAGCCAGG - Intronic
1089899811 11:121968624-121968646 AAGCCAAGACTGAAGGAGGCAGG - Intergenic
1090319883 11:125833065-125833087 CAGGGAAGGCAGAGGGAGGATGG + Intergenic
1090710186 11:129376627-129376649 CAGTGGAGACAGTAGGAGGCTGG - Intronic
1091217052 11:133908521-133908543 CAGTGGAGGCAGGAGGAGGAGGG - Intergenic
1091284942 11:134403291-134403313 CAGGGATGAGAGCAGGAGGCTGG + Intronic
1091322139 11:134659069-134659091 CAGTGAAGAAAAAAAAAGGCAGG + Intergenic
1091691994 12:2603620-2603642 CAATGGAGACAGCAGGAGACAGG - Intronic
1091849460 12:3683516-3683538 GAGTGAAGAAAGAGTGAGGCTGG - Intronic
1091966498 12:4746652-4746674 CTGTGAGTACAGAAGCAGGCTGG - Intronic
1092387912 12:8050410-8050432 CAGGGAAGAGAGAAGGAGGATGG + Intronic
1092456885 12:8651867-8651889 AATTGAAGACATTAGGAGGCAGG + Intronic
1092461146 12:8687417-8687439 AAGTGACCACAGAAGGAGGATGG - Intronic
1092857469 12:12688162-12688184 CAGTGAAGAGAGTGGGAGGGGGG + Intronic
1093546217 12:20352237-20352259 CAGAGAAGACAGAAAGTTGCCGG + Intergenic
1093925511 12:24904497-24904519 CAGTTAATACAGATGGAGGCCGG - Intronic
1093930762 12:24953016-24953038 CAGTGAGGACAAAATGAAGCTGG - Intergenic
1094398954 12:30040327-30040349 CAATGAAGGCAGAAGGATACAGG - Intergenic
1094526087 12:31232159-31232181 CACTGAAGGCAGCAGGAAGCTGG + Intergenic
1094568287 12:31619494-31619516 GAATGAAGAAAGAAGCAGGCTGG - Intergenic
1094771252 12:33662762-33662784 CAGTGAATCCAGAGGGAAGCAGG + Intergenic
1095629293 12:44355795-44355817 CAGTGATGGCAGCAAGAGGCTGG + Intronic
1096239987 12:49954668-49954690 CAGTGACGACAGCTGGAGCCAGG - Exonic
1096280857 12:50252200-50252222 AAGTGAAGGCAGGAGGAGGAAGG + Intronic
1096368016 12:51044989-51045011 CAGAGAAGATAGAAGGAAGCTGG + Intergenic
1096628068 12:52907322-52907344 CAGGGAAGGCGGAAGGAGGGAGG + Intronic
1096770555 12:53933560-53933582 TAGTGAAGCCAGAAGGCGGGAGG + Intergenic
1098246072 12:68519326-68519348 CAGTGAGGCCTGAAGGAGGAAGG - Intergenic
1098809446 12:75067782-75067804 TTATGAAAACAGAAGGAGGCAGG - Intronic
1100289694 12:93202013-93202035 CAGGGAAGAACGAAGGTGGCTGG - Intergenic
1101498823 12:105281844-105281866 AAGGGAAAACAGAAGGAGCCTGG + Intronic
1102052956 12:109876503-109876525 CAGAGAAGAAAGAAAGAGGGAGG + Intronic
1102180498 12:110909109-110909131 CAGTGAAGGCAGGAGGACCCAGG - Intergenic
1102429340 12:112869763-112869785 CAGTGAAGATAGGAGGGGCCCGG + Exonic
1102511347 12:113417675-113417697 CAGTGAGGCTAGAAGCAGGCTGG + Intronic
1102511352 12:113417708-113417730 CAGTGAGGCTAGAAGCAGGCTGG + Intronic
1102688563 12:114742695-114742717 CAGAAAAGAGAGATGGAGGCAGG + Intergenic
1104271718 12:127288270-127288292 CAGAGAAGAAAGAAAGAGCCTGG + Intergenic
1104384862 12:128341927-128341949 GAGAGAAGACAGCAGGAAGCAGG - Intronic
1106355833 13:28982169-28982191 CAGTGAAGACAGATGGAAAAAGG + Intronic
1109576478 13:64265229-64265251 CAGTCAAGACAGAAGCAGTATGG + Intergenic
1111182412 13:84686584-84686606 CACAGGAGAAAGAAGGAGGCTGG - Intergenic
1111342610 13:86907463-86907485 CAGAGAAGACATCAGCAGGCAGG - Intergenic
1111549220 13:89784719-89784741 CCGTGAAGCCAGAGGGAGCCAGG - Intergenic
1112730978 13:102361943-102361965 CAATGAAGACTGAAGGAGACTGG - Intronic
1112740449 13:102467182-102467204 GAGTGAAGCCAGAAGTAGGCTGG + Intergenic
1113285636 13:108845461-108845483 CAGGGCGGACAGCAGGAGGCAGG + Intronic
1113504225 13:110802439-110802461 CACTGAAGACAGAAGGAAATAGG + Intergenic
1114080774 14:19200273-19200295 CAGAGGACACAGAAGGAGGGAGG + Intergenic
1114525323 14:23364490-23364512 AAGAGAAGACAGAGGGAGGAGGG - Intronic
1114719448 14:24864927-24864949 CAGTAGAGAGAGAAGGTGGCGGG - Intronic
1115163717 14:30424593-30424615 CAGAGAAGAGAAAATGAGGCAGG + Intergenic
1116175768 14:41468704-41468726 CAATGAGAAAAGAAGGAGGCTGG - Intergenic
1116444358 14:44991327-44991349 CAGTGCTGACAGAAGGAGACTGG - Intronic
1116723759 14:48534224-48534246 CAGTGATGGCAGAAGGAGTTGGG + Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1118049688 14:62013501-62013523 CAGTGAATGAAGAAGCAGGCAGG - Intronic
1118247502 14:64125589-64125611 CAGAGAAGATAGTAGGAGACAGG + Intronic
1118400200 14:65372711-65372733 TACTAAAGAAAGAAGGAGGCCGG - Intergenic
1118842513 14:69523910-69523932 CAGAGAAGACAGGGTGAGGCTGG + Intronic
1118964869 14:70571390-70571412 AAGTGCAGAGAGAAGGTGGCGGG - Intergenic
1118971889 14:70643751-70643773 CTGGGAAGACAGAGGTAGGCTGG - Intronic
1118978170 14:70695090-70695112 CAATCAAGAAAGAAGAAGGCCGG + Intergenic
1119476773 14:74934977-74934999 CAGAGAAGAGAGAAGGAGAAGGG + Intergenic
1119680111 14:76585720-76585742 AAGTGATGACATTAGGAGGCGGG - Intergenic
1119744080 14:77032168-77032190 CAGTGAAGACAGAGACAGACAGG - Intergenic
1119783588 14:77296024-77296046 CAGAGAAAACAGAAGGGTGCAGG + Intronic
1119785499 14:77310650-77310672 CAGGGAAGGCAGGAGGAGGCAGG - Intronic
1119893027 14:78197332-78197354 CAGAGAAGCAAGAAGGAGGGAGG - Intergenic
1120082455 14:80231016-80231038 CACTGAAGAAAGATGTAGGCTGG + Intronic
1120241405 14:81953624-81953646 TAGTGTAGAGAGAAGGAAGCAGG - Intergenic
1120486859 14:85124979-85125001 CAATTCAGACAGAAAGAGGCCGG + Intergenic
1120525819 14:85575739-85575761 GAGGGAAGACAGAATGAGCCTGG + Intronic
1120600322 14:86496362-86496384 CAGTGGTGACAGCAGCAGGCAGG + Intergenic
1120698887 14:87676119-87676141 CAGTGAAGACATAGAGAGACAGG + Intergenic
1120818715 14:88891919-88891941 CAGTGAAGGGGAAAGGAGGCTGG - Intergenic
1120896599 14:89538439-89538461 AAGTGAAGACAGAATGAAGCAGG + Intronic
1120915967 14:89710738-89710760 AAGAGAAGAAAGATGGAGGCTGG - Intergenic
1121260008 14:92559161-92559183 CAAGGAAGAGAGAAGGGGGCCGG - Intronic
1122122288 14:99561009-99561031 CTGTGGAGACTGAGGGAGGCAGG - Intronic
1122319595 14:100845732-100845754 CAGAGACAACACAAGGAGGCAGG - Intergenic
1122617344 14:103028693-103028715 CACAGAATATAGAAGGAGGCAGG - Intronic
1122950631 14:105042548-105042570 CAGTGACACCACAAGGAGGCAGG + Intergenic
1124719116 15:32096946-32096968 GGATGAAGACAGGAGGAGGCAGG - Intronic
1124848766 15:33315694-33315716 CGGTGAGGTGAGAAGGAGGCTGG + Intronic
1125021552 15:34991488-34991510 CATGGGAGACAGTAGGAGGCAGG + Intergenic
1125225502 15:37390734-37390756 CAGGAAAGACAGAATGAGGAGGG + Intergenic
1125442063 15:39713821-39713843 CAGTGAAAACAGCTGGAGCCAGG + Intronic
1125518862 15:40337447-40337469 CTGTGTAGACAGAGGGAGTCAGG + Intronic
1125750841 15:42027172-42027194 CAGTGTTGACAGGAAGAGGCAGG + Intronic
1126912237 15:53429262-53429284 AAGTGAAGACAAAGAGAGGCTGG + Intergenic
1127608063 15:60609907-60609929 CAATGAAAACAGAAGCAGGGAGG + Intronic
1128681274 15:69653652-69653674 CAGTGAATAGGAAAGGAGGCTGG + Intergenic
1129039173 15:72670884-72670906 CAGTGCAGACAGGAGAAGGAGGG - Intergenic
1129139264 15:73582405-73582427 CAGTCAAGACAGAAGCAAGAAGG + Intronic
1129166845 15:73783329-73783351 CAGTCCAGACAGAGTGAGGCTGG - Intergenic
1130148256 15:81292028-81292050 CAGGGTAGACAGAGGGAGGACGG + Intronic
1130448952 15:84031415-84031437 CTGTGATGACAGAAAGAGGTAGG + Exonic
1130941302 15:88511561-88511583 CAGTGGAGACAGATGAAGGAAGG - Intronic
1131362607 15:91806452-91806474 CAGAGAAGAATGAAGGAAGCTGG + Intergenic
1131441501 15:92463213-92463235 AAGTGAAGAGAGAAGGGTGCAGG - Intronic
1131569683 15:93522121-93522143 CAGAGTAGACAGAAAGGGGCTGG - Intergenic
1132519077 16:379131-379153 CAGTGGACACAGCAGGGGGCGGG + Intronic
1132761401 16:1510207-1510229 CAGTGAGGGCAGAACCAGGCTGG + Exonic
1133056382 16:3147490-3147512 AAGTGAGGGCAGTAGGAGGCCGG - Intronic
1133234069 16:4379568-4379590 CAGGGCAGACAGAAGAAAGCAGG - Intronic
1133981684 16:10637385-10637407 CAGTGAATAAAGAAGGAAGAAGG + Intronic
1134397663 16:13880159-13880181 CACTGAAGACAAAATGAGGCTGG + Intergenic
1136017749 16:27415424-27415446 CAGTCAAGACAAAAGCAGACCGG + Intronic
1136066142 16:27760175-27760197 CAGAGCAGGCAGAAGGAAGCAGG - Intronic
1136267198 16:29128746-29128768 CAGTGGAGGGGGAAGGAGGCTGG + Intergenic
1136398005 16:30003509-30003531 CTGTGAAGACAGAAGCAGGTTGG + Intronic
1136556390 16:31010142-31010164 CCATGAAGACACAAGGGGGCAGG - Intronic
1136670660 16:31854076-31854098 CACTGAAGACAGTAGAAGTCTGG - Intergenic
1139737978 16:69008998-69009020 CAATGGAGAAAGAATGAGGCTGG - Intronic
1140024951 16:71278951-71278973 CAGTTAATACAGAAGGAACCTGG + Intergenic
1140123380 16:72101757-72101779 CAGTGAAGAGACCAGGAGGAAGG - Intronic
1141130820 16:81435297-81435319 CAAAGAAGAGAGAAGAAGGCAGG - Intergenic
1141259418 16:82439160-82439182 GAAAGAAGAGAGAAGGAGGCCGG - Intergenic
1141710318 16:85695213-85695235 CAGTGAAGACACGAGGAGATGGG + Intronic
1141767759 16:86070101-86070123 CACCGAAGCCAGAGGGAGGCAGG + Intergenic
1142070490 16:88089069-88089091 CAGTGGAGGGGGAAGGAGGCTGG + Intronic
1142312974 16:89324641-89324663 CATGGAAGAAAGATGGAGGCTGG - Intronic
1142511351 17:395749-395771 AAGTTAAGATAGAATGAGGCCGG + Intergenic
1142988209 17:3710629-3710651 TATTTAAGACAGCAGGAGGCCGG + Intergenic
1143083156 17:4396431-4396453 CAAAGAAGGCACAAGGAGGCCGG + Intergenic
1143972240 17:10804030-10804052 CAGAGAAGGCAGCAGCAGGCAGG - Intergenic
1144155216 17:12493821-12493843 CACGGGAGAAAGAAGGAGGCCGG - Intergenic
1144209015 17:12999383-12999405 CAGTGAAGATGGTAAGAGGCAGG + Intronic
1144422846 17:15113855-15113877 CAGGGAAGAGATGAGGAGGCTGG + Intergenic
1144580554 17:16456633-16456655 GAGGGAACACAGAGGGAGGCAGG + Intronic
1144621072 17:16818849-16818871 CTGTGAAGACAGAAAAGGGCAGG + Intergenic
1144702323 17:17347751-17347773 CATTGAAGACAGGCGGAGGAAGG + Intergenic
1145043870 17:19596947-19596969 TAGTGAGGGTAGAAGGAGGCTGG + Intergenic
1145056378 17:19706506-19706528 CAGTGAAGCTGGAAGGGGGCTGG + Intronic
1146542368 17:33708518-33708540 AAGAGAAGAAAGAAGGAGACAGG - Intronic
1146672740 17:34753008-34753030 TAGCGAAGAGGGAAGGAGGCAGG - Intergenic
1146798509 17:35800036-35800058 CAGTGCAGAGAGAGGGAGGGAGG - Intronic
1147847552 17:43415457-43415479 CAGTGGAGAGTGTAGGAGGCAGG + Intergenic
1148062733 17:44847882-44847904 CAGTGAAGACAGAATGAGCTGGG + Exonic
1148624965 17:49062284-49062306 CAGTAAAGATACAATGAGGCCGG - Intergenic
1149023537 17:51998092-51998114 CAGTGCAGACAGACAGAGGAAGG + Intronic
1149393255 17:56213521-56213543 CAAGGAAAACAGAGGGAGGCAGG + Intronic
1149594823 17:57858714-57858736 CTCTGAAGAATGAAGGAGGCAGG - Intergenic
1149789135 17:59462037-59462059 CAGGCAAGACATAAGGAGGTAGG + Intergenic
1149816638 17:59731684-59731706 CAGTGATGGCAGAAGGAGCCTGG + Intronic
1151160866 17:72164512-72164534 CAGAGAAGACAAAAAGAGCCAGG + Intergenic
1151820234 17:76493082-76493104 CAGTCAGGACAGAAGGAGGGCGG + Intronic
1152158099 17:78648104-78648126 CTGTGGAGTCAGAAGGAAGCCGG + Intergenic
1152329898 17:79666588-79666610 CAGAAAAGAGAGAATGAGGCTGG + Intergenic
1152480754 17:80550749-80550771 CAGTGGAGACAAAATGAAGCAGG - Intronic
1152523620 17:80875044-80875066 CGGGGAAGGCATAAGGAGGCAGG - Intronic
1152551652 17:81033375-81033397 CAGGGAACACAGCAGGAAGCTGG + Intergenic
1152640824 17:81448504-81448526 CAGGGAAGACGGCAGGAAGCGGG - Intronic
1152844186 17:82589537-82589559 CAGTGAATACAGAACGAATCAGG - Intronic
1153052941 18:917359-917381 CAGCGAAGAGAGAAAGGGGCAGG - Intergenic
1154055837 18:11013303-11013325 CTTTGAAGACAGAAGGGGCCAGG + Intronic
1156535783 18:37863261-37863283 AAGTCAAGGTAGAAGGAGGCAGG - Intergenic
1156550477 18:38011143-38011165 CAAAGAAGACAGAAGGAGGGAGG + Intergenic
1156598429 18:38575062-38575084 CGATTAAGACAGCAGGAGGCCGG - Intergenic
1156749080 18:40428593-40428615 CAGTGATGACAGAAGATGGTAGG + Intergenic
1158577984 18:58656316-58656338 CAGTGAGGAAGGAAGGAGGTAGG - Intergenic
1159194794 18:65099185-65099207 CAGTAAGGACAAAAGGAGTCAGG - Intergenic
1160032804 18:75277708-75277730 CAGTAATGGCAGAAGGAGGTAGG - Intronic
1160232906 18:77061977-77061999 CAGTGAACACAGACGCGGGCTGG + Intronic
1160484362 18:79275274-79275296 TACTCAAGAAAGAAGGAGGCAGG - Intronic
1160672812 19:374214-374236 CAGTGGGGACAGGAGGAGCCCGG + Intronic
1161058310 19:2201413-2201435 CAGGGAAGACAGCAGGAGCGAGG - Intronic
1161330190 19:3683233-3683255 CAGTGCAGACAGCACGAGCCTGG + Intronic
1161458413 19:4381575-4381597 CAGGGTAGACAGAGAGAGGCAGG - Intronic
1162998061 19:14348894-14348916 CACAGAAGACAGAATGGGGCTGG + Intergenic
1163098409 19:15078143-15078165 CAGTAAAGACAGAAGTAGCGGGG - Intergenic
1163458715 19:17423906-17423928 CTGTAAAGACTGAAGGAGCCAGG + Intronic
1164554637 19:29241801-29241823 GGGGGAAGAAAGAAGGAGGCTGG - Intergenic
1164648648 19:29876377-29876399 CAGGAGACACAGAAGGAGGCTGG - Intergenic
1164982456 19:32624555-32624577 GAGAGAAGCCAGAAGGAGGGCGG + Intronic
1165084926 19:33337911-33337933 GAGGAAAGAGAGAAGGAGGCCGG + Intergenic
1165956545 19:39504933-39504955 CAGTGTAGACAGAAGCGAGCAGG + Intronic
1165974392 19:39662058-39662080 CAAAGAAGACTGAAGGAGACAGG + Intergenic
1166894833 19:46016766-46016788 CAGTCAAGGCAGCAGGGGGCTGG - Exonic
1167978985 19:53256561-53256583 CATTGAAAAGAGAAAGAGGCTGG - Intergenic
1168296528 19:55379728-55379750 CAGTGAAGACAGAAGGAGGCCGG + Intronic
1168679024 19:58300378-58300400 CAGTGAAGACTGAAAGAAGGGGG + Exonic
925650157 2:6081022-6081044 CATTGACAACAGTAGGAGGCAGG - Intergenic
925691683 2:6530727-6530749 CAGGGAAGGCAGAAGGAAGAAGG - Intergenic
925749494 2:7074821-7074843 AAGGGAAGAAAGAAGGAGGGGGG + Intergenic
926094111 2:10070003-10070025 CACTGAAGCCAGACAGAGGCTGG + Intronic
926306577 2:11641400-11641422 AACAGAAGAGAGAAGGAGGCAGG + Exonic
927371022 2:22355428-22355450 CACTGAACTTAGAAGGAGGCTGG - Intergenic
927374755 2:22400931-22400953 CAGAGCAGAGAGAAGTAGGCAGG + Intergenic
927464746 2:23328747-23328769 CAGTGAAACCAGAGGGAGGCAGG - Intergenic
927486901 2:23494812-23494834 GAAAGAAGACAGAAGGAGCCCGG - Intronic
928605839 2:32944765-32944787 CACTGAAGACAGGTAGAGGCTGG + Intergenic
928959726 2:36911658-36911680 AAGTGAAGACACAAGGAGGCTGG - Intronic
929694336 2:44101230-44101252 CAGAGAAGAAACAACGAGGCTGG + Intergenic
930000740 2:46859983-46860005 CAGTGACCCCAGAAGGAGGAAGG + Intergenic
930997443 2:57737503-57737525 CAGAGCAGAAAGAAGGAGACTGG + Intergenic
931212254 2:60208354-60208376 CAGTGGAGACAGAGGCAGGTTGG - Intergenic
932220717 2:69997023-69997045 AAGTGGACACACAAGGAGGCTGG + Intergenic
933088793 2:78092998-78093020 AAATGAAGAAAGAAGGAGACTGG - Intergenic
934107220 2:88706500-88706522 CAGTGAGAACACATGGAGGCAGG + Intronic
934115314 2:88785032-88785054 CATTAAAGACATAAGGAGTCAGG + Intergenic
934163788 2:89275927-89275949 GAGTGCAGAGAGGAGGAGGCAGG - Intergenic
934203484 2:89906597-89906619 GAGTGCAGAGAGGAGGAGGCAGG + Intergenic
934631335 2:95926962-95926984 CATTAAAGACAAAAGGAGTCAGG - Intronic
934738677 2:96703471-96703493 GAGTGCAGACAGCAGGAGCCGGG - Intergenic
934802702 2:97182022-97182044 CATTAAAGACATAAGGAGTCAGG + Intronic
934818188 2:97348472-97348494 CAGTGCAGACAGGAGGAGGCAGG + Intergenic
934833497 2:97558548-97558570 CATTAAAGACATAAGGAGTCAGG - Intronic
934887624 2:98038816-98038838 TAGAAAAGAAAGAAGGAGGCCGG - Intergenic
935882917 2:107584355-107584377 CACTGGAGAAAGATGGAGGCCGG + Intergenic
936060616 2:109293470-109293492 CAGTGGAGAGAGAAGGGGGCAGG - Intronic
938029826 2:127982525-127982547 CAGTGAAGACGGAAGAAGCCTGG + Intronic
938107390 2:128542659-128542681 CAGCCCAGAAAGAAGGAGGCTGG - Intergenic
939257785 2:139766696-139766718 CAGTGCAGGCAGAAGGAAGTGGG + Intergenic
943006101 2:182389799-182389821 CAGTGCAGACAGAATAAGGCAGG + Intronic
943976915 2:194493655-194493677 CAGAGAAAAGAGAAGGAAGCTGG + Intergenic
945020169 2:205562835-205562857 CAGAGAAGACAGGAGGAGGTAGG - Intronic
945108106 2:206336314-206336336 GAATGAAGAGAGAAGGAAGCAGG - Intergenic
947006104 2:225513324-225513346 CCATGAAGACAAAAGGAGCCAGG - Intronic
947603327 2:231467989-231468011 GAAGGAAGACAGAAGGAGGCTGG - Intronic
948003287 2:234586364-234586386 CACTTAACACAAAAGGAGGCTGG - Intergenic
948169157 2:235887386-235887408 CAGAGGAGAGAAAAGGAGGCAGG - Intronic
1168805531 20:670310-670332 CAGAGCAGAAAGTAGGAGGCCGG - Intronic
1169277212 20:4241862-4241884 GAGAGAAGGCAGGAGGAGGCAGG - Intronic
1169392906 20:5204661-5204683 GTAAGAAGACAGAAGGAGGCCGG - Intergenic
1170295741 20:14823429-14823451 AAGTGCAGACATAAGGAGTCTGG + Intronic
1171847899 20:30288847-30288869 AGGTGGAGACAGAAGGAGTCAGG - Intergenic
1172232714 20:33347904-33347926 CAGCGAGGACCAAAGGAGGCAGG + Intergenic
1172408393 20:34705391-34705413 CAGTGAGGACAGAAGGGGTCAGG - Exonic
1173112831 20:40209957-40209979 AAGGGAAGAAAGGAGGAGGCAGG + Intergenic
1173115385 20:40236892-40236914 TAGTGAGGACAGGAGGAGGCAGG - Intergenic
1173144213 20:40510854-40510876 CAGGGAGGAAAGAAGGAGGAAGG + Intergenic
1173317886 20:41961395-41961417 CTGTGGAGACACAGGGAGGCAGG - Intergenic
1173436344 20:43035169-43035191 CAGTCCAGACCAAAGGAGGCTGG + Intronic
1173454721 20:43192666-43192688 CAGTGCTGAAGGAAGGAGGCAGG + Intergenic
1174218214 20:48933287-48933309 CAACGATGACAGAAGGAGGACGG - Intronic
1174729367 20:52900317-52900339 TAGTGAAGACAGAAAGAGGCAGG - Intergenic
1174791295 20:53480762-53480784 GAGTGAAGAGAGAAGGGGGTAGG + Intronic
1175303078 20:57956790-57956812 CAGTGAGGGCAGAAAGGGGCTGG - Intergenic
1175787077 20:61718437-61718459 CACCCAACACAGAAGGAGGCAGG + Exonic
1175889337 20:62309485-62309507 CAGGGAAGATGGAAGAAGGCTGG + Intronic
1175931360 20:62495382-62495404 CAGGGCAGACAGATGGATGCGGG + Intergenic
1177833473 21:26166292-26166314 CACAGAAGACAGAAGGTGGCAGG - Intronic
1178255459 21:31048200-31048222 CAGTGAAAGCAGGAGAAGGCTGG + Intergenic
1178568909 21:33716399-33716421 GAGTGAAGAAGGAAGGAGGTAGG - Intronic
1179293811 21:40042967-40042989 TAGTGAAAACAGTAGGAGCCAGG + Intronic
1180051667 21:45334458-45334480 TAGTGAAGACAGCAGGAGGTGGG - Intergenic
1180499999 22:15922412-15922434 CAGAGGACACAGAAGGAGGGAGG - Intergenic
1181473434 22:23154464-23154486 CAGTCAAGAGCAAAGGAGGCTGG + Intronic
1181562703 22:23714984-23715006 CAGTGAGGCCAGGAGCAGGCAGG - Intergenic
1182847467 22:33443412-33443434 CAGTGCAGACAGGAGCAGGTGGG - Intronic
1183078695 22:35442675-35442697 CAGTCATTAAAGAAGGAGGCAGG - Intergenic
1183465383 22:37977803-37977825 CAGTGGAGACAGGAGATGGCTGG - Intronic
1183623547 22:38988348-38988370 CAGTGAAGACAGTTGGAGAGGGG + Intronic
1184001164 22:41674670-41674692 CAGAGCAGACAGAAGCAGGGTGG - Exonic
1184226275 22:43130371-43130393 GAGAGAAGACATAAGGAGGCAGG - Intergenic
1184544173 22:45154763-45154785 AAGTGAAGGCTGAAGGAGCCAGG - Intergenic
1184631931 22:45788462-45788484 CAGTGGGGACAGAAAGATGCAGG - Intronic
949808751 3:7983560-7983582 CAATGAAAACAGAGAGAGGCTGG + Intergenic
950252946 3:11482102-11482124 CAGTGATGAGAGAAGGAACCGGG - Intronic
950313999 3:11984392-11984414 GTGTGAAGACAGATGGAGGGAGG - Intergenic
950599863 3:14024293-14024315 CACTCAACACAGAAGCAGGCAGG - Intronic
950658493 3:14452134-14452156 CTGTGAAAACAGAGGGAGGAAGG - Intronic
951045097 3:18028927-18028949 TAGTGAGCAAAGAAGGAGGCAGG + Intronic
951686523 3:25350526-25350548 CTATGAAGAAAAAAGGAGGCAGG - Intronic
952505317 3:34001987-34002009 CAGTGAACACAGAACTAGGCTGG - Intergenic
952832556 3:37577108-37577130 CAGGGAAGACAGAAAGATGAGGG + Intronic
952846433 3:37691410-37691432 CAGTGAAGACAGTGGGAAGATGG + Intronic
953545964 3:43863760-43863782 CAGTGAGGTCTGATGGAGGCTGG + Intergenic
953847636 3:46440707-46440729 CAGTGATTACTGAAGGAGGGAGG + Intronic
953992499 3:47495214-47495236 CTGTGAAGACTGCAGGAGGTGGG - Intergenic
955106572 3:55904689-55904711 CAGTGAAGAAAGAAAGCGTCTGG + Intronic
955226225 3:57062492-57062514 CAGAGAAGAGGGAAGGAAGCAGG + Intronic
955407659 3:58635651-58635673 CAGTGAAGAACGCAGGAGGCCGG - Intronic
955436093 3:58900153-58900175 CTGTGAAGGCAGAAGGACTCTGG + Intronic
956608015 3:71092505-71092527 GATTGAGGACAGGAGGAGGCTGG + Intronic
956615940 3:71172726-71172748 CAGTGAATCCAGAAGGAAGAGGG - Intronic
956700233 3:71952332-71952354 CAGTGATGGCAGAGGGAGGAAGG - Intergenic
956863698 3:73349132-73349154 CAGTGAAGAAAGAAGTAGGATGG + Intergenic
956961826 3:74411843-74411865 TAGTAAAGACAGAATGTGGCAGG + Intronic
957512061 3:81201781-81201803 CAGTGAAGAGAGAAGGGGCAGGG + Intergenic
958962358 3:100522409-100522431 CTGTGAATTCAGAAGGAGGATGG - Intronic
959589294 3:108059896-108059918 TAGTGAAGACAGCAGGAAGAAGG - Intronic
960584484 3:119308471-119308493 CTTTGAAGACAGATGGAGGAAGG - Intronic
961058389 3:123808125-123808147 CAGTGAAGGGTGAAGGAGGCTGG - Intronic
961335274 3:126172835-126172857 CAGTGAAGCCAGGGAGAGGCAGG + Intronic
961449207 3:126994927-126994949 AAGTGAAGAAGGCAGGAGGCGGG - Intronic
961723291 3:128909841-128909863 AAGGGAAAACAGAAGGTGGCTGG + Intronic
961758423 3:129146220-129146242 CAGCAAAGACACAATGAGGCTGG + Intronic
962739988 3:138356627-138356649 CAGAGATGATAGAAGGAGGGTGG + Intronic
962904894 3:139792713-139792735 CAGAGAAGAAAGGAGGAGACAGG + Intergenic
962974929 3:140437610-140437632 CTGTGACAACAGAAAGAGGCTGG + Intronic
963039168 3:141056087-141056109 CATTGGAGCCAGGAGGAGGCAGG + Intronic
963432774 3:145230749-145230771 CACTGAAGAAAGATGTAGGCTGG + Intergenic
963681353 3:148381822-148381844 CAGCAAAGATAGCAGGAGGCAGG + Intergenic
964120048 3:153173992-153174014 CAGTAAAGACTTAAGGGGGCAGG - Intergenic
965448746 3:168809947-168809969 CTGTGAAGACAGAAAGGGGAAGG - Intergenic
965802859 3:172512418-172512440 CAGTGATGGGAGAAGGTGGCAGG - Intronic
965910788 3:173772788-173772810 CAGTGAATACAGAAAAAGGATGG - Intronic
966321604 3:178707078-178707100 AAGTGGAGACAGAAGGAGAAAGG + Intronic
967978389 3:195048319-195048341 GGGTGAAAACAGAAGCAGGCAGG + Intergenic
968653674 4:1769767-1769789 CAGGGATGAGACAAGGAGGCAGG - Intergenic
969062690 4:4450598-4450620 TAATAAATACAGAAGGAGGCTGG - Intronic
969282721 4:6181938-6181960 CTGTGCAGACAGGAGGAGGAGGG + Intronic
969355206 4:6621020-6621042 CAGTGTGGTGAGAAGGAGGCTGG + Intronic
970212999 4:13730538-13730560 CAGTGAAGAAACATGGAGACTGG + Intergenic
971417809 4:26449602-26449624 CATTGGAGACAGAAGCAGGGAGG + Intergenic
972032436 4:34478180-34478202 AAGTGAAGACGGAAAAAGGCTGG + Intergenic
972570122 4:40303100-40303122 CAGGAAGGAGAGAAGGAGGCCGG + Intergenic
972663629 4:41142714-41142736 CAGAGAAGAGAGAAGGACGTTGG - Intronic
972831326 4:42817012-42817034 AAGTGAATAAAGAGGGAGGCAGG + Intergenic
974144543 4:57930641-57930663 ATGAGAAGACAGAAGGAGGCCGG + Intergenic
976093809 4:81486628-81486650 CAGAGCACACAGAAGGAGGGAGG + Intronic
976379206 4:84380058-84380080 CAGTGAAGACACCAGGGGTCTGG - Intergenic
976558299 4:86475102-86475124 CAGTGAAGAGAGATGGAGTGGGG - Intronic
976607910 4:86999831-86999853 CAGTGATGGCAGAAGGAGACTGG + Intronic
978698945 4:111619098-111619120 AAGTCAAGACGGAAGGAAGCTGG - Intergenic
979914967 4:126420557-126420579 CAGTGATGGCAGTAGTAGGCAGG + Intergenic
981643946 4:146976808-146976830 GAGTGAAGACTGAAGAGGGCTGG + Intergenic
981766640 4:148258337-148258359 AAGGAAAGAGAGAAGGAGGCAGG + Intronic
983267695 4:165524483-165524505 AAGTGAAGGCCCAAGGAGGCAGG + Intergenic
983859760 4:172691075-172691097 CAGTGAGCACTGGAGGAGGCAGG + Intronic
984109013 4:175585944-175585966 TAGTCAAGACAGAAGGATTCTGG - Intergenic
984598942 4:181704481-181704503 CAGTGAAGACAGGAGGGAGGAGG - Intergenic
984800583 4:183712411-183712433 AAGTGAAGAAAGAAAGAGGTGGG + Intronic
984944878 4:184963025-184963047 CAGGGAAAACTGAAGGAGGATGG - Intergenic
985057936 4:186051311-186051333 CAGGGAAGACAGGAAGAGGAGGG - Intergenic
985857147 5:2437709-2437731 CAGCAAAGACAGAAGGAGAAGGG + Intergenic
986039085 5:3969476-3969498 CAGGGGAGACAGTAGGAGGCAGG + Intergenic
986097655 5:4575610-4575632 CAGTGAAGAAAGAGGGAGTTAGG - Intergenic
986365249 5:7022563-7022585 CAGGAAAGAGAGAAGGTGGCAGG + Intergenic
987117110 5:14734543-14734565 CAGTGAAAACCGAAAGAGCCGGG + Intronic
987922550 5:24302516-24302538 CAGTGAAGGCAAAAAGAGACGGG + Intergenic
989107826 5:37880077-37880099 CAGTCAAGAAAGAAGAAAGCTGG + Intergenic
989408269 5:41086725-41086747 AAGAGAAACCAGAAGGAGGCTGG - Intergenic
989503841 5:42202566-42202588 CAGTGAAGATAGAAGGTGAAAGG + Intergenic
991403290 5:66276692-66276714 CTGTGAAGCCATAAGGACGCTGG + Intergenic
992114453 5:73526283-73526305 GCATGAAGACTGAAGGAGGCCGG + Intergenic
992781087 5:80128557-80128579 CAGTGAAGAAAAGAGGAGGCAGG + Intronic
994037765 5:95222211-95222233 CAGTGTGGAGAGAAGAAGGCAGG - Intronic
994791840 5:104237153-104237175 GAGTGAGAACAGAAGGAGGTGGG + Intergenic
996281042 5:121729243-121729265 AGGAGAAGACAGAAGGAGGCGGG - Intergenic
996805719 5:127452157-127452179 CAATGAAGACAGAATCTGGCAGG + Intronic
997365057 5:133320319-133320341 CAGTGAAACCAGCAGGGGGCAGG - Intronic
997398133 5:133580900-133580922 CTGTGCAGATTGAAGGAGGCGGG - Intronic
997724101 5:136105887-136105909 CAGTGAAGACAGAGGTAAGCAGG - Intergenic
998790125 5:145757477-145757499 CCTTGAAGACAGGAGGAGACTGG + Intronic
999377919 5:151099808-151099830 CTGTGAAGACAGCAACAGGCAGG - Intergenic
999875720 5:155803577-155803599 CAGAGAAGAGAGAGGGAAGCAGG + Intergenic
1001141351 5:169146584-169146606 CAGTGGAGGCAGGAGGAGCCGGG - Intronic
1001147427 5:169197005-169197027 CACTGAAGACAGCAGCAAGCTGG - Intronic
1001310679 5:170608055-170608077 GAGTGAGGACAGAAGAAGGTAGG + Intronic
1001400604 5:171444211-171444233 GAGTGAACAGCGAAGGAGGCAGG - Intronic
1001485165 5:172114862-172114884 CAGTGAAGGCCGAAGGTGGGGGG - Intronic
1001594287 5:172887894-172887916 GAGTGGAAACAGGAGGAGGCAGG + Intronic
1002195114 5:177497159-177497181 CTGTGGAGACAGATGGGGGCTGG + Intronic
1002213697 5:177613039-177613061 TGGTGAAGCCAGAATGAGGCAGG + Intergenic
1002319377 5:178365897-178365919 CAGTGAACACAGCAGGAAGGGGG + Intronic
1002909881 6:1481686-1481708 CAGGGAATGCAGAGGGAGGCTGG - Intergenic
1003051695 6:2786409-2786431 CACTCCAGACAGAAGGAGGGAGG - Intronic
1004082068 6:12404522-12404544 CAGACAAGACAGAAGGAGAGAGG - Intergenic
1004859977 6:19793906-19793928 GAGGGAGGACAGAAGAAGGCAGG + Intergenic
1005083454 6:21980596-21980618 CAGAGCAGGAAGAAGGAGGCAGG - Intergenic
1005083678 6:21981824-21981846 CAGTGCAGGAAGGAGGAGGCAGG - Intergenic
1005492988 6:26363958-26363980 GAATGAAGTCAGAAGCAGGCTGG - Intergenic
1005502263 6:26439282-26439304 GAATGAAGTCAGAAGCAGGCTGG - Intergenic
1005893033 6:30155256-30155278 CACAGATGACAGAAGGAGGGCGG - Intronic
1006183765 6:32169025-32169047 CAGACAAGACAGTAGGAGGTGGG + Exonic
1006297443 6:33176200-33176222 CAGTGAAGAGAGGAGATGGCAGG + Intronic
1006598212 6:35208951-35208973 CAGTGGAGAGAGAAGGGAGCAGG + Intergenic
1006738620 6:36292351-36292373 CAGTGAAGTCAGAACGGGGGTGG - Intronic
1007322334 6:41036797-41036819 CAGTGAAGCTGGAATGAGGCAGG + Intronic
1007488691 6:42200826-42200848 CCATGAAGACAGAAGTAGGCAGG - Intergenic
1007663188 6:43498952-43498974 CTGAGAAGCAAGAAGGAGGCAGG - Intronic
1008424141 6:51337351-51337373 AGATGAAGACAGAAGGAGGCTGG - Intergenic
1008603643 6:53119577-53119599 CTGGGAAGACAGAATGTGGCAGG - Intergenic
1008627843 6:53335332-53335354 CAGGGAAGCCAGAGGGAGACAGG - Intronic
1008663814 6:53696723-53696745 CACTGAAGACAGCGGGAGGTGGG - Intergenic
1009195930 6:60684371-60684393 AAGAGAAGAGAGAAGGAGGGAGG + Intergenic
1010342808 6:74776238-74776260 CAGTAGGGACAGATGGAGGCAGG - Intergenic
1011002686 6:82608513-82608535 CAGAGAGGACAGATGGAGTCAGG - Intergenic
1011059685 6:83250611-83250633 CAGTGAAGTTAGAAGTAGACAGG - Intronic
1011496809 6:87944634-87944656 TAATGATGACAGAAGGAGGGAGG + Intergenic
1011500464 6:87982610-87982632 CATTGAAGACACCTGGAGGCTGG + Intergenic
1011733260 6:90287964-90287986 AAGTGAGCACAGAAGGAGGATGG + Intronic
1012133013 6:95519785-95519807 AAGCGAAGGCAGCAGGAGGCCGG + Intergenic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1013899966 6:115143371-115143393 CAGTGAGGATAGAGGTAGGCTGG - Intergenic
1014982857 6:127966008-127966030 GAGTGAAGCTAGAAGGCGGCTGG - Intergenic
1015163960 6:130182612-130182634 GAGGGAAGAAAGAAGGAGGGAGG + Intronic
1015555768 6:134459842-134459864 CAGTGAGTGCAGAAGGAAGCGGG - Intergenic
1015657817 6:135539797-135539819 CACAGAAGAAAGATGGAGGCTGG + Intergenic
1015882559 6:137883640-137883662 CAGGAAAGAGAGAAGTAGGCAGG + Intergenic
1016888887 6:148985917-148985939 CTGTGAAGGGAAAAGGAGGCAGG + Intronic
1016998214 6:149976176-149976198 CAGTGAAGACAGGGAGAGACTGG + Intergenic
1017520045 6:155194177-155194199 CAGAGAAGCCGGGAGGAGGCCGG + Intronic
1017614679 6:156232284-156232306 CAGTTAAAACAGAAAGAGGCTGG - Intergenic
1018039912 6:159912488-159912510 AAGTGAAGAAAGGAGGAGGTGGG + Exonic
1018171508 6:161146861-161146883 GAGGGAAGACGGAATGAGGCAGG - Intronic
1018381388 6:163261125-163261147 CCGGGAAGACAGAGGGAGGAGGG - Intronic
1018949377 6:168369232-168369254 CAGTACATACAGAAGGAGGGAGG - Intergenic
1019100629 6:169626411-169626433 CAGAGAAGGCAGCAGGAGCCTGG - Intronic
1019412649 7:913138-913160 CAGTTAATACAAAAGAAGGCCGG - Intronic
1019521359 7:1461832-1461854 CAGTGAGGCCAGAAGGCAGCGGG - Intergenic
1019546586 7:1580238-1580260 CATGGGAGACAGAAGGAGACAGG - Intergenic
1019730654 7:2627628-2627650 GAGGGAGGACAGAAGGAGGGAGG + Intergenic
1019853672 7:3583820-3583842 CACTGGAGAAAGAAGGTGGCAGG + Intronic
1021396769 7:20159005-20159027 AAGTAAAGACAGAAGGAGAAAGG - Exonic
1022232116 7:28424066-28424088 CAGAGAAGACAGAAGAAGGAGGG - Intronic
1022319980 7:29279027-29279049 CATTGCAGAGAGAAGGAAGCAGG - Intronic
1023031743 7:36095642-36095664 GAGGGAAGAGAGAAGGAAGCGGG + Intergenic
1023728039 7:43164227-43164249 CAGAGAAGGCAGGAGGAGGAAGG + Intronic
1024242726 7:47447995-47448017 CAGAGAAGACAGCAGGAGGCTGG + Intronic
1024295989 7:47842721-47842743 CAGTGGAGACAGAAGGAGAAGGG + Intronic
1025227562 7:57178176-57178198 CAGTGCAGCCAGGAGCAGGCAGG - Intergenic
1025230676 7:57201620-57201642 CAGTGTGGCCAGGAGGAGGCAGG - Intergenic
1025638173 7:63342847-63342869 CAGTGAAGACAGAGTGAAGCAGG + Intergenic
1025644523 7:63405242-63405264 CAGTGAAGACAGAGTGAAGCAGG - Intergenic
1025714100 7:63938342-63938364 CAGTGAAGACACAATGAAGCAGG - Intergenic
1025730313 7:64102136-64102158 CAGTGCAGCCAGGAGCAGGCAGG + Intronic
1026185786 7:68081864-68081886 CTGTGAAGAGAGAAGGTGGTGGG + Intergenic
1027634179 7:80648890-80648912 CAGTGAAGATGGAAGGAAGAAGG + Intronic
1029556706 7:101275350-101275372 TAGAGAAGCCAGAAAGAGGCCGG + Intergenic
1030329083 7:108253854-108253876 CAGGGATGACAGAAGGTTGCTGG + Intronic
1030380365 7:108803965-108803987 CAGGGAGGAGAGAGGGAGGCAGG - Intergenic
1033583329 7:142755819-142755841 GAGGGAAGAGAGAAGGAGGGTGG - Intronic
1033586340 7:142777327-142777349 GAGGGAAGAGAGAAGGAGGGTGG - Intergenic
1033800403 7:144894959-144894981 CAGTGAAGTCAAAAGGAATCAGG - Intergenic
1034471806 7:151258744-151258766 CAGGGCAGAGAGAAGGTGGCGGG - Intronic
1034519446 7:151608065-151608087 ACGTGAAGACAGGTGGAGGCTGG + Intronic
1034733122 7:153405129-153405151 CTGTCACGACAGAGGGAGGCAGG + Intergenic
1034917051 7:155048951-155048973 CAGTGACCAGAAAAGGAGGCAGG - Intergenic
1035117130 7:156533839-156533861 CAGTGAAGGCAGAAGGAAGAGGG + Intergenic
1035310953 7:157968515-157968537 CTGGAAAAACAGAAGGAGGCTGG - Intronic
1035754753 8:2022912-2022934 CGGGGCAGACAGAGGGAGGCAGG - Intergenic
1035761091 8:2069399-2069421 CAGAAAAGAGAAAAGGAGGCGGG - Intronic
1037115385 8:15219678-15219700 AAGTGAATACAGAAGGAAACAGG + Intronic
1038083400 8:24165585-24165607 CAGTGCAGGCAGGAGAAGGCAGG - Intergenic
1038092757 8:24272359-24272381 CAGTGTAGTCAGAAGGAAGGTGG - Intergenic
1038338570 8:26664735-26664757 AAGGGAAGACAGGAGGAAGCTGG - Intergenic
1040769073 8:50951023-50951045 GACAGAAAACAGAAGGAGGCAGG + Intergenic
1041022998 8:53657370-53657392 CAGTGAGGATAGACTGAGGCAGG + Intergenic
1041732401 8:61075849-61075871 AAGGGAAGAAGGAAGGAGGCTGG - Intronic
1041850957 8:62391923-62391945 CAGTTGAGACAGAATGAGCCAGG - Intronic
1041866670 8:62582084-62582106 AAGGAAAGACAGAAGGAGGGAGG - Intronic
1042040547 8:64584516-64584538 GAGTGAGGGCAGAAGGAGGGAGG + Intergenic
1043695076 8:83207894-83207916 CTGTGGAGTCAGAAGGAGCCAGG + Intergenic
1044258449 8:90092637-90092659 AAGTGAAGACAAAGAGAGGCTGG + Intronic
1044823380 8:96174071-96174093 CTGTGAAGAAAGAAGGGGGTAGG - Intergenic
1045310672 8:100999392-100999414 CCGTCAAGAAAGAAAGAGGCCGG - Intergenic
1045622377 8:103995461-103995483 CAGTGGAGACAGAGGGAGAATGG + Intronic
1046073938 8:109294454-109294476 CAGAGATGACAGATGAAGGCAGG + Intronic
1046400103 8:113694081-113694103 CATGGAAGCCAGAAGGAGGTGGG - Intergenic
1046785535 8:118262057-118262079 AAGTGAATACAGACAGAGGCAGG + Intronic
1047184094 8:122616444-122616466 ATGTGGTGACAGAAGGAGGCAGG - Intergenic
1047203513 8:122785353-122785375 CAGTGTAGAAAGAAGTAGTCTGG - Intronic
1048455144 8:134570940-134570962 CAGCGAAGACAGACAGAGACAGG + Intronic
1049328588 8:142037867-142037889 CAGTAAGGACAGAGGGAGGTGGG - Intergenic
1049630513 8:143652657-143652679 CAGTGGGGACAGGAGGAGGCAGG + Exonic
1049795584 8:144495993-144496015 CAGTCAGGACAGGAGGAGGCGGG + Intronic
1049870903 8:144975108-144975130 AAGAGATGACAAAAGGAGGCTGG - Intergenic
1050444283 9:5702412-5702434 CAGTCATGACAGAAGGAGAAGGG + Intronic
1050810364 9:9738559-9738581 CTGTAATCACAGAAGGAGGCTGG - Intronic
1050960721 9:11726903-11726925 CAGGAAAGACAGAACAAGGCTGG - Intergenic
1051093410 9:13436985-13437007 CAGTGACTTCAGGAGGAGGCTGG - Intergenic
1052021749 9:23533007-23533029 CAGTGAAGTCAGATGGAGCCAGG - Intergenic
1052364356 9:27595668-27595690 GAGTGAAGAGAGAAAGAGGGAGG + Intergenic
1052445936 9:28561086-28561108 AAGTGAGGAAAGAAGGAGGGAGG + Intronic
1052902088 9:33801985-33802007 GAGGGAAGAGAGAAGGAGGGTGG - Intergenic
1053786034 9:41653497-41653519 AGGTGGAGACAGAAGGAGTCAGG - Intergenic
1054159016 9:61660699-61660721 AGGTGGAGACAGAAGGAGTCAGG + Intronic
1054174750 9:61867430-61867452 AGGTGGAGACAGAAGGAGTCAGG - Intergenic
1054478790 9:65591704-65591726 AGGTGGAGACAGAAGGAGTCAGG + Intergenic
1054662788 9:67713363-67713385 AGGTGGAGACAGAAGGAGTCAGG + Intergenic
1056030807 9:82551491-82551513 CAGTGAAGTCTGAGTGAGGCTGG + Intergenic
1056721119 9:89072972-89072994 AAGTGAATAGAGAATGAGGCTGG + Intronic
1056918847 9:90768440-90768462 CATGGAAGACAGGAAGAGGCAGG + Intergenic
1057151387 9:92799040-92799062 CAGTGGAGACTGGAGAAGGCCGG + Intergenic
1057500100 9:95590031-95590053 CAGAGAAGACAGAAGGACCGAGG - Intergenic
1057997293 9:99829563-99829585 CAGAGAAGGGAGATGGAGGCAGG + Intronic
1058480231 9:105385553-105385575 CAGTGAAGACAGAGAGAGAGAGG - Intronic
1058816797 9:108691822-108691844 CAGTGTAGCCACAAGGAAGCAGG + Intergenic
1060397285 9:123325139-123325161 CATTGAAGGCAGAAGGAAACAGG - Intergenic
1060522249 9:124300486-124300508 CAGGTGAGACAGCAGGAGGCGGG + Intronic
1060706459 9:125806261-125806283 CAGTGAAGAGACTAGGTGGCTGG + Intronic
1060814467 9:126627323-126627345 CAATGAAGTCAGAAGCAAGCAGG - Intronic
1060967645 9:127720803-127720825 GAGGGAAGAAAGAAGGAGGGAGG - Intronic
1061105267 9:128525290-128525312 CTGCGAAGACAAGAGGAGGCAGG + Exonic
1062288132 9:135782542-135782564 CAGTGAAGACAGGAGCACACAGG - Intronic
1062517007 9:136941863-136941885 CAGTGAAAACAAACGCAGGCAGG - Intronic
1062627239 9:137448841-137448863 CAGTGTAGACAGAGCCAGGCTGG + Exonic
1062726520 9:138077171-138077193 CACTGATGACAGCCGGAGGCAGG - Intronic
1186096974 X:6112743-6112765 CACTTAAGAAAGCAGGAGGCCGG - Intronic
1186483177 X:9911680-9911702 CAGGGAAGACAAAGGCAGGCTGG - Intronic
1186554862 X:10547274-10547296 CAAAAAAGAAAGAAGGAGGCCGG + Intronic
1186962608 X:14752928-14752950 CAGAGAAGAAGGAAGGAGGGAGG - Intergenic
1187580530 X:20602918-20602940 TAGTGATGACAGAAGTAGTCAGG - Intergenic
1187824210 X:23318445-23318467 CAGAGAAGGGAGAAGGAGGTTGG - Intergenic
1187882913 X:23862944-23862966 CAGGGAAGGGAGAAGGAGGGAGG + Intronic
1187892783 X:23952817-23952839 CTGTGAAGACAAAAGGAGAGTGG - Intergenic
1188266040 X:28076009-28076031 CAGTGAAAGCAAAAGGAGACAGG + Intergenic
1188341229 X:29004474-29004496 CAGTGAACACATAAGGAAACTGG + Intronic
1188781111 X:34286558-34286580 CACTGAAGAAAGAAGGAGGCTGG + Intergenic
1189703635 X:43737533-43737555 CAGAAAAGGCAGAAGGAGGAAGG + Intronic
1189989495 X:46580721-46580743 GAGTGAACAGGGAAGGAGGCTGG + Intronic
1190101606 X:47526422-47526444 AAATGAAGACAGAAGAAGGAAGG - Intergenic
1194308372 X:92275490-92275512 AAGTGAAGACAAAGAGAGGCTGG + Intronic
1194351457 X:92827779-92827801 AAGTGAAGACAAAGAGAGGCTGG - Intergenic
1195682050 X:107554537-107554559 CAGTGGACAAAGAAGCAGGCAGG + Intronic
1197551315 X:127896234-127896256 CAGTGGAGACCCAGGGAGGCTGG - Intergenic
1197790770 X:130251816-130251838 CAGAGGTGACAGAAGGAGCCAGG + Intronic
1198428407 X:136542142-136542164 GAGGGGAGAGAGAAGGAGGCTGG - Intronic
1199294515 X:146141965-146141987 GAATAAAGAAAGAAGGAGGCAGG + Intergenic
1199490007 X:148387594-148387616 AAGTGAAAACAGAGGTAGGCAGG - Intergenic
1200659779 Y:5944471-5944493 AAGTGAAGACAAAGAGAGGCTGG - Intergenic
1200764444 Y:7068549-7068571 CAGTCTAGACAGAAGGTTGCAGG - Intronic
1201321110 Y:12699449-12699471 AAGTGCAGACTGAAGGTGGCTGG + Intergenic
1202273667 Y:23094715-23094737 AAGAGAAGAGAGAAGGAGGAAGG + Intergenic
1202292360 Y:23325966-23325988 AAGAGAAGAGAGAAGGAGGAAGG - Intergenic
1202426663 Y:24728460-24728482 AAGAGAAGAGAGAAGGAGGAAGG + Intergenic
1202444126 Y:24941626-24941648 AAGAGAAGAGAGAAGGAGGAAGG - Intergenic