ID: 1168297386

View in Genome Browser
Species Human (GRCh38)
Location 19:55384076-55384098
Sequence CGGCGTGTTCGCGCAGCTGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 48
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 45}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168297386_1168297391 17 Left 1168297386 19:55384076-55384098 CCTGCAGCTGCGCGAACACGCCG 0: 1
1: 0
2: 1
3: 1
4: 45
Right 1168297391 19:55384116-55384138 GCCCGCCACATCCAGCGCCACGG 0: 1
1: 0
2: 0
3: 11
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168297386 Original CRISPR CGGCGTGTTCGCGCAGCTGC AGG (reversed) Exonic
904847323 1:33430430-33430452 CGGCGTGACAGCGCAGCCGCTGG - Intronic
920824942 1:209416299-209416321 CGGCATGCTGGGGCAGCTGCAGG + Intergenic
1065712575 10:28532545-28532567 CGGCGCCTTCGGGCCGCTGCTGG - Intronic
1067698367 10:48551571-48551593 CTGCGTGTCCCCGCAGCTTCAGG + Intronic
1068410263 10:56645737-56645759 GGGCATGTTGGCGCAGCTACTGG - Intergenic
1092193195 12:6534639-6534661 GGATGTGTTCGCGCCGCTGCGGG + Intronic
1102647643 12:114414219-114414241 CGGCGTGCTGGAGCGGCTGCGGG + Intergenic
1102767048 12:115442688-115442710 CGGGGTGTTCGGGCAGCACCTGG - Intergenic
1105000436 12:132687133-132687155 CGGCGAGTGCGGGCGGCTGCGGG + Intronic
1116868595 14:50051150-50051172 CGGTGTGTTCGTGAAGCTGTGGG + Intergenic
1119261011 14:73237991-73238013 CGGGGTGGCCGCGCAGGTGCCGG - Intronic
1128322733 15:66704151-66704173 CTGCGGGTCGGCGCAGCTGCGGG + Intronic
1129319704 15:74767753-74767775 CTGCCTGTTTGCCCAGCTGCAGG - Intergenic
1132665465 16:1079492-1079514 GGGCTTCTTCGCGCCGCTGCTGG + Exonic
1133113771 16:3564621-3564643 AGTCGTGTTCCCTCAGCTGCAGG + Exonic
1141666287 16:85467124-85467146 CTGCATGCTCGCCCAGCTGCTGG - Intergenic
1141835385 16:86535357-86535379 CGGCGTGGTCATCCAGCTGCTGG - Intronic
1142373296 16:89694740-89694762 CGACTTGATCGTGCAGCTGCTGG + Exonic
1145011425 17:19370534-19370556 CAGTGTGTTTGCTCAGCTGCTGG + Intronic
1152686421 17:81695947-81695969 CGGCATGCACCCGCAGCTGCTGG + Exonic
1161312068 19:3600268-3600290 CGGCCTGTCCCCGCTGCTGCTGG - Exonic
1161821312 19:6532785-6532807 GGGCATGTTTGCGCAGCTGGTGG + Exonic
1162104926 19:8364477-8364499 CCGCGTGTTCGCGCAGCCCCTGG - Exonic
1163019271 19:14473939-14473961 CGGCCTGTGCCCGCTGCTGCTGG - Exonic
1163219325 19:15903119-15903141 CGGCGTGGCCGCGCAGGTGGAGG - Intergenic
1166748371 19:45152714-45152736 GGGCGAGAGCGCGCAGCTGCTGG - Exonic
1168297386 19:55384076-55384098 CGGCGTGTTCGCGCAGCTGCAGG - Exonic
929778471 2:44942872-44942894 CGGCGCGGTCGCGCTGCCGCCGG - Exonic
934966844 2:98731061-98731083 CGCCGTGCTCCCGCGGCTGCCGG + Intronic
937993058 2:127674874-127674896 CGTCGGATTCTCGCAGCTGCCGG - Intronic
1177225268 21:18245229-18245251 CCGCGTGGTCTCGCTGCTGCTGG + Exonic
1183607328 22:38873133-38873155 CGGAAGCTTCGCGCAGCTGCGGG - Intergenic
1185278916 22:49961639-49961661 CCGCTTCTTCGCGCAGGTGCTGG + Exonic
965384499 3:168029919-168029941 CCTGGTGTTCCCGCAGCTGCTGG + Exonic
978478679 4:109162809-109162831 CTGCATGTTCAGGCAGCTGCTGG - Intronic
1003064518 6:2891904-2891926 CGAGGTGCGCGCGCAGCTGCTGG - Exonic
1019546686 7:1580933-1580955 CGGCGCTTTCGCGGAGCAGCCGG - Intergenic
1023830953 7:44038816-44038838 GGGCGTCTTCGCGAAGCTGAGGG + Intergenic
1024877021 7:54037467-54037489 CAGCTTGTTAGAGCAGCTGCAGG - Intergenic
1029741287 7:102493125-102493147 GGGCGTCTTCGCGAAGCTGAGGG + Exonic
1029759277 7:102592294-102592316 GGGCGTCTTCGCGAAGCTGAGGG + Exonic
1029776646 7:102688204-102688226 GGGCGTCTTCGCGAAGCTGAGGG + Intergenic
1034355524 7:150448222-150448244 CTGCGTTTTCTCGCACCTGCTGG + Intergenic
1049639377 8:143707725-143707747 CGGGGTGCGCGCGCAGCTGTTGG - Exonic
1055654934 9:78442220-78442242 CGGCGCACTCTCGCAGCTGCTGG - Intergenic
1061874616 9:133537484-133537506 CGGCGTGTTCCCGCAGTTGCGGG + Exonic
1189192662 X:39123857-39123879 GGGGGTGTTGGCTCAGCTGCAGG - Intergenic
1198312605 X:135436538-135436560 CCGCGAGTTGGCGGAGCTGCAGG + Intergenic