ID: 1168298299

View in Genome Browser
Species Human (GRCh38)
Location 19:55388665-55388687
Sequence GCACCCTTCTGGGCTAGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 137}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168298299_1168298312 18 Left 1168298299 19:55388665-55388687 CCTTTTCTAGCCCAGAAGGGTGC 0: 1
1: 0
2: 1
3: 13
4: 137
Right 1168298312 19:55388706-55388728 TGGGCCCTGGTGCTGTAGCACGG 0: 1
1: 0
2: 1
3: 16
4: 212
1168298299_1168298316 24 Left 1168298299 19:55388665-55388687 CCTTTTCTAGCCCAGAAGGGTGC 0: 1
1: 0
2: 1
3: 13
4: 137
Right 1168298316 19:55388712-55388734 CTGGTGCTGTAGCACGGTTTGGG 0: 1
1: 0
2: 1
3: 6
4: 76
1168298299_1168298317 25 Left 1168298299 19:55388665-55388687 CCTTTTCTAGCCCAGAAGGGTGC 0: 1
1: 0
2: 1
3: 13
4: 137
Right 1168298317 19:55388713-55388735 TGGTGCTGTAGCACGGTTTGGGG 0: 1
1: 0
2: 0
3: 10
4: 93
1168298299_1168298315 23 Left 1168298299 19:55388665-55388687 CCTTTTCTAGCCCAGAAGGGTGC 0: 1
1: 0
2: 1
3: 13
4: 137
Right 1168298315 19:55388711-55388733 CCTGGTGCTGTAGCACGGTTTGG 0: 1
1: 0
2: 1
3: 5
4: 72
1168298299_1168298308 -1 Left 1168298299 19:55388665-55388687 CCTTTTCTAGCCCAGAAGGGTGC 0: 1
1: 0
2: 1
3: 13
4: 137
Right 1168298308 19:55388687-55388709 CAGGCTGAGGGCTGGGCCCTGGG 0: 1
1: 0
2: 11
3: 125
4: 813
1168298299_1168298306 -8 Left 1168298299 19:55388665-55388687 CCTTTTCTAGCCCAGAAGGGTGC 0: 1
1: 0
2: 1
3: 13
4: 137
Right 1168298306 19:55388680-55388702 AAGGGTGCAGGCTGAGGGCTGGG 0: 1
1: 1
2: 2
3: 51
4: 522
1168298299_1168298309 5 Left 1168298299 19:55388665-55388687 CCTTTTCTAGCCCAGAAGGGTGC 0: 1
1: 0
2: 1
3: 13
4: 137
Right 1168298309 19:55388693-55388715 GAGGGCTGGGCCCTGGGCCCTGG 0: 1
1: 2
2: 19
3: 157
4: 1305
1168298299_1168298305 -9 Left 1168298299 19:55388665-55388687 CCTTTTCTAGCCCAGAAGGGTGC 0: 1
1: 0
2: 1
3: 13
4: 137
Right 1168298305 19:55388679-55388701 GAAGGGTGCAGGCTGAGGGCTGG 0: 1
1: 1
2: 4
3: 69
4: 670
1168298299_1168298307 -2 Left 1168298299 19:55388665-55388687 CCTTTTCTAGCCCAGAAGGGTGC 0: 1
1: 0
2: 1
3: 13
4: 137
Right 1168298307 19:55388686-55388708 GCAGGCTGAGGGCTGGGCCCTGG 0: 1
1: 0
2: 32
3: 157
4: 1089

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168298299 Original CRISPR GCACCCTTCTGGGCTAGAAA AGG (reversed) Intronic
900806238 1:4769953-4769975 GGGCCCTTCTGGCCCAGAAATGG + Intronic
901285782 1:8077535-8077557 TCACCTTAATGGGCTAGAAAAGG + Intergenic
901731201 1:11281056-11281078 GCATGCTCCTGGACTAGAAAGGG - Intronic
902570301 1:17342682-17342704 GCACCTTTCTGGGCTGGGCACGG + Intronic
903278821 1:22238549-22238571 GCACCCTCCTGGGCGGGCAAAGG - Intergenic
907606956 1:55827724-55827746 GCACCAGTCATGGCTAGAAAAGG + Intergenic
913068573 1:115279798-115279820 GCACCCTGCTGGATTAGATAGGG + Intergenic
915213795 1:154327474-154327496 CCACCCTTCTGGGCTGGCAGAGG - Intronic
916518134 1:165539291-165539313 GCACCATTTAGGGCTAGAGAGGG + Intergenic
916960225 1:169882050-169882072 GCCCCCTTCTGGGCTGGCCAAGG + Intronic
917627537 1:176861480-176861502 GAACCCATCCTGGCTAGAAAGGG - Exonic
919703520 1:200655054-200655076 GCAACCTCCTGAGCCAGAAAAGG + Intronic
922155895 1:223039434-223039456 GCAGCCGTCTGGGTTAGCAAAGG - Intergenic
922307028 1:224352906-224352928 GCCCCCTTCTGGGCTGGCCAAGG - Intergenic
922416524 1:225427757-225427779 CCACCCGACTGGGCCAGAAAAGG + Intronic
924280277 1:242430300-242430322 GCCCACTTCTGGGCTTGCAAAGG + Intronic
1063174275 10:3537774-3537796 GCACCATGCTGGGCACGAAACGG + Intergenic
1063581962 10:7316315-7316337 CCAGCCAGCTGGGCTAGAAAAGG + Intronic
1065963424 10:30752519-30752541 TCCCCCTTCTGGGCAACAAATGG - Intergenic
1069992915 10:72325894-72325916 GCCCCTTTCTGGGCTAGCCAAGG + Intergenic
1071333315 10:84582521-84582543 GCACCCAACAGGGCCAGAAATGG - Intergenic
1072685575 10:97534679-97534701 CCCCACTTCTGGGGTAGAAAAGG + Intronic
1073786321 10:106894071-106894093 CCACCCCTCTGGGAGAGAAAAGG - Intronic
1075098517 10:119489777-119489799 GCACCCTTCTGGGAGAGACAAGG + Intergenic
1075450623 10:122549579-122549601 GCACTCTCCTGGCCTAGAAAAGG + Intergenic
1075472680 10:122704696-122704718 TCACCCTTCTTGGCATGAAAGGG + Intergenic
1077427455 11:2490013-2490035 GCTCCCTTCTGGCCTAGAGCAGG - Intronic
1077496973 11:2891149-2891171 GCGCCTTTCTGGGCTAGGAAGGG + Intronic
1081422014 11:42881322-42881344 GCCCCTTTCTGGGCTAGCCAAGG + Intergenic
1083926943 11:65813173-65813195 TTACCCCTCTGTGCTAGAAAGGG + Intergenic
1085186454 11:74579943-74579965 GCACCCTGCTTGGCTAAAACTGG - Intronic
1087472950 11:98600748-98600770 GCTCCCTTCTGGCCTAGGGAAGG + Intergenic
1090588204 11:128237029-128237051 GCCCCTTTCTGGGCTGGCAAAGG + Intergenic
1094563046 12:31573929-31573951 GCTCCATTCTGGGCAACAAAGGG + Intronic
1094749064 12:33384228-33384250 GCACCCTTCTGTGTAAGAATGGG - Intronic
1095478658 12:42611199-42611221 GCCCCTTTCTGGGCTGGCAAGGG - Intergenic
1096476175 12:51910641-51910663 GCAGCTTTCTGGGCTAGCAAAGG + Intronic
1097075782 12:56392692-56392714 GCAGACTTCAGGGCTGGAAATGG + Intergenic
1097903380 12:64895754-64895776 GCAGCCTTCTGAGCCAGAATAGG - Intergenic
1098394693 12:70005618-70005640 GCAGCCTGCTAGGCTAGAATTGG + Intergenic
1103392460 12:120584549-120584571 GCACCCTCCTGGGCCAGAAGGGG - Intergenic
1103497504 12:121374403-121374425 GCCCCTTTCTGGGCTAGCCAAGG + Intronic
1104068942 12:125328258-125328280 GCACCGTGCTGGGCTGGAAAGGG - Intronic
1105876742 13:24561127-24561149 GCCCCCTTCTGGGCTGGCCAAGG - Intergenic
1106634537 13:31513448-31513470 GCACCATTCTGGGCAAGCAGTGG + Intergenic
1116000164 14:39234520-39234542 GCAGCCTTCTGAGCCAGAATAGG - Intronic
1117077809 14:52122181-52122203 GCCCCTTTCTGGGCTAGCCAAGG + Intergenic
1118932310 14:70254659-70254681 GCCCCCTTCTGGGCTGGCCAAGG + Intergenic
1120300553 14:82701164-82701186 ATACCACTCTGGGCTAGAAATGG - Intergenic
1125353535 15:38792237-38792259 GCACGCTTATAGCCTAGAAATGG - Intergenic
1125781603 15:42273931-42273953 GTACTCTTCAGGGCTAGAAGGGG - Intronic
1139600250 16:67982215-67982237 GCCCCTTTCTGGGCTGGACAAGG + Intergenic
1141669853 16:85485980-85486002 GCAGGCTTCTGGGCCAGAACAGG - Intergenic
1143527644 17:7481841-7481863 GAACTCTTCGGAGCTAGAAAGGG - Intronic
1143614381 17:8040795-8040817 TCACCCTCCAGGGCTAGCAAGGG + Intronic
1144052198 17:11506622-11506644 GTACTCCTCTGGGCTAAAAATGG - Intronic
1146793345 17:35765168-35765190 GTACCGTTCTGGGGTAGAGAGGG - Intronic
1148906422 17:50915235-50915257 TCACCCTTCTGGGCTGGGCATGG + Intergenic
1150772228 17:68051812-68051834 GCACCTTTCTGGGCTGGCCAAGG + Intergenic
1154128814 18:11717325-11717347 GCCCCCTTCTGGGCTGGCCAAGG - Intronic
1156763063 18:40616658-40616680 GCCCCCTTCCAGGCTAGCAATGG + Intergenic
1157574533 18:48734640-48734662 GCAACATTCTGGGAGAGAAAGGG + Intronic
1159822495 18:73164033-73164055 TCACCCTACTGTGCTAGAAAAGG + Intronic
1160562208 18:79765638-79765660 CCACCCTACGGGGCTGGAAATGG - Intergenic
1164398933 19:27889596-27889618 GGACCCTGGTGGGCTAGAATGGG - Intergenic
1165520529 19:36310902-36310924 GCAGCCTCCAGGGCAAGAAATGG + Intergenic
1165623542 19:37267682-37267704 GCAGCCTCCAGGGCAAGAAATGG - Intergenic
1168298299 19:55388665-55388687 GCACCCTTCTGGGCTAGAAAAGG - Intronic
925336171 2:3100838-3100860 GGGCCCTCCTGGGCTTGAAAGGG + Intergenic
925910393 2:8569900-8569922 TCACCCTGCTCTGCTAGAAAAGG - Intergenic
926616695 2:15002956-15002978 GCCCCCTTCTGGGCTGGCCAAGG - Intergenic
933727956 2:85437158-85437180 GCCCCAATCTGGGGTAGAAACGG - Intergenic
935311175 2:101785104-101785126 GCACCCCTCTGGGCTATTTAGGG + Intronic
938116906 2:128608423-128608445 GCCCCCTGCTGGGCTGGGAAAGG - Intergenic
939063170 2:137449175-137449197 GCATTATTCTGGGCCAGAAATGG + Intronic
940282105 2:151999201-151999223 GCACCGTTCTGGGCTGGAGCTGG - Intronic
940846696 2:158650137-158650159 GAATCCTTCTGGGGCAGAAACGG - Intronic
942797514 2:179839390-179839412 TGACCTTTCTGGGCCAGAAAAGG + Intronic
945069591 2:205977169-205977191 GCACCTTTCTGGGCTGGCCAAGG + Intergenic
945136208 2:206630489-206630511 GTACCCTTCTGGTCCTGAAAGGG + Intergenic
945229172 2:207566483-207566505 GAACTCTTCTAGTCTAGAAAAGG + Intronic
946721180 2:222609994-222610016 GCTCCCTTCTGAGCTACCAAGGG + Intronic
947700647 2:232231473-232231495 GCACCCTTATGAGCCAGAACTGG + Intronic
1172002824 20:31793697-31793719 TCATCCTTCTTGGATAGAAAAGG + Intronic
1178585704 21:33868738-33868760 GCCCCCTTCTGGGCTGGCCAAGG - Intronic
1179278332 21:39911931-39911953 TTACCTATCTGGGCTAGAAACGG + Intronic
1180125420 21:45786946-45786968 GCAGCCTGCTGGGATGGAAAGGG + Intronic
1182356672 22:29725215-29725237 GCATCCTTGGGGGCTGGAAAAGG + Intronic
1182658307 22:31906893-31906915 GCACACTCCTGGGCAAGAAGTGG - Exonic
951722458 3:25715171-25715193 GAACACTTCTGAGATAGAAAGGG - Intergenic
952355330 3:32578693-32578715 GCCCCCTTCTGGGCTGGCCAAGG + Intergenic
952900905 3:38111317-38111339 GCAGAATTCTGGGCTAGAGATGG + Intronic
954287470 3:49629313-49629335 CCACCCTTCTGGTGCAGAAAGGG - Intronic
958521403 3:95192526-95192548 GTATCTTTCTGTGCTAGAAAAGG - Intergenic
961688739 3:128653334-128653356 GCCCCCTTCTGGGCTGGCCAAGG + Intronic
962476915 3:135763051-135763073 GCACCTTCCTGGGCTTGGAAAGG + Intergenic
966076017 3:175937314-175937336 GCCCCTTTCTGGGCTGGCAAAGG + Intergenic
967718286 3:192788971-192788993 GCCCCCTTCTGGGCTGGCCAAGG + Intergenic
968606213 4:1536900-1536922 GCACCCTGCTGGGCAAAAAATGG - Intergenic
971756702 4:30717356-30717378 GCGCCGTTCTGGGCAAGCAAAGG - Intergenic
978999631 4:115200617-115200639 GCCCCCTTCTGGGCTGGTCAAGG - Intergenic
979308260 4:119173720-119173742 GCCCCTTTCTGGGCTGGACAAGG + Intronic
979445727 4:120808987-120809009 GCCCCCTTCTGGGCTGGACAAGG - Intronic
979461884 4:120993104-120993126 GCACACTGCTGGGCTGGACATGG - Intergenic
981226367 4:142299242-142299264 TCACCCTCCTGGGCTCAAAAAGG + Intronic
984948783 4:184990509-184990531 GCCCCCTTCTGGGCTGGCCAAGG - Intergenic
985403932 4:189617066-189617088 GCCCCCTTCTGGGCTGGCCAAGG - Intergenic
986626106 5:9725248-9725270 GCCCCCTTCTGGGCTGGCCAAGG + Intergenic
988279609 5:29128043-29128065 GCCCCTTTCTGGGCTGGCAAAGG - Intergenic
990731596 5:58814689-58814711 CCACCCTTCTGGACAACAAAGGG - Intronic
993370169 5:87083522-87083544 GCACCTTCCAGGGCTATAAAAGG + Intergenic
993748933 5:91641931-91641953 GCCCCCTTCTGGTATAAAAAAGG - Intergenic
995953239 5:117742646-117742668 GCACAATTTTGGGCTAGACAGGG - Intergenic
997714382 5:136030938-136030960 GCACTCTTCTGGGCTCTGAAGGG - Intronic
999114730 5:149152651-149152673 GCCCTCTTTTGGGCTAGAAAAGG - Intronic
1004861431 6:19807388-19807410 GCCCCTTTCTGGGCTGGACAAGG - Intergenic
1005600930 6:27425248-27425270 GCCCCTTTCTGGGCTGGCAAAGG - Intergenic
1005711965 6:28511779-28511801 GCCCCCTTCTGGGCTGGCCAAGG + Intronic
1005725112 6:28640162-28640184 GCCCCTTTCTGGGCTAGCCAAGG - Intergenic
1010153213 6:72760648-72760670 GAAACCCTCTGGGCTAGAAGGGG + Intronic
1018395379 6:163374196-163374218 GCACAGTTCTGGGCTGGAAGGGG + Intergenic
1019643341 7:2116192-2116214 GCTCCCTTCTGTGCTGGGAAGGG - Intronic
1026866833 7:73829352-73829374 GCATCCTTCTGGGTCAGAACTGG + Exonic
1027915260 7:84309555-84309577 GGACCCTTCTGGGCTAGCAATGG + Intronic
1028359616 7:89952231-89952253 GCAAAATTCCGGGCTAGAAATGG - Intergenic
1029675616 7:102066436-102066458 GCACACTTCGGGGCTATAATGGG - Intronic
1030600041 7:111582363-111582385 GCCCCTTTCTGGGCTAGCCAAGG - Intergenic
1032493968 7:132347248-132347270 CAACCTTTCTGGGCTAGAAAAGG - Intronic
1033414616 7:141151191-141151213 GCATCCCTGTGTGCTAGAAATGG + Intronic
1033664163 7:143424817-143424839 GCCCCCTTCTGGGCTGGCCAAGG - Intergenic
1034412109 7:150947187-150947209 GCCCCCAGCTGGGCTAGGAATGG + Intronic
1035046637 7:155972094-155972116 ACACCCTTCTTGGATACAAATGG - Intergenic
1036914920 8:12796235-12796257 GCCCCTTTCTGGGCTAGCCAAGG + Intergenic
1038261788 8:26002430-26002452 GCACATGTCTGGGCTACAAAAGG - Intronic
1044862204 8:96534230-96534252 GCCCCCTTCTGGGCTAGCCGAGG - Intronic
1046108141 8:109691332-109691354 GGGCCCTTCTGGGCGAGAAAGGG - Exonic
1046720234 8:117610944-117610966 GCAGCCTTCTGAGCCAGAATAGG + Intergenic
1047143322 8:122167414-122167436 GCAACCTCCGGGGCTGGAAAGGG - Intergenic
1048402228 8:134082881-134082903 CTACCCTTCTGGGCTTGTAAAGG + Intergenic
1050058033 9:1676244-1676266 GCAACCTTGTGAGCTAGACAAGG - Intergenic
1053475189 9:38377516-38377538 GCCCCCTTCTGGGCTGGCCAAGG + Intergenic
1058763681 9:108161168-108161190 GAACTCTTCTGGACCAGAAACGG + Intergenic
1060105939 9:120873621-120873643 GCGTCAGTCTGGGCTAGAAAAGG - Intronic
1062641561 9:137521184-137521206 GCAGCCTGCAGGGCCAGAAAGGG + Intronic
1193438752 X:81512904-81512926 GCTCCCTTCTGGCCTAGAGCAGG - Intergenic
1195381849 X:104278510-104278532 GCATCCTTCTGAGTCAGAAAGGG - Intergenic
1197000349 X:121431950-121431972 GCCCCTTTCTGGGCTAGCCAAGG - Intergenic
1197340238 X:125256926-125256948 GCACAATTATGGGCTAGAAAGGG + Intergenic
1197761266 X:130030125-130030147 GCACCCTTGTGAGACAGAAAGGG - Intronic
1199356304 X:146867300-146867322 GCACCTTTCTGGGCTGGCCAAGG - Intergenic
1199831347 X:151551609-151551631 GCCCCCTTCTGGGCTGGCCAAGG - Intergenic
1201588073 Y:15583459-15583481 GCAGCCTTTTGGGTTATAAAAGG + Intergenic