ID: 1168298807

View in Genome Browser
Species Human (GRCh38)
Location 19:55391413-55391435
Sequence CTCTTAGTCCAGTAGCTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 130}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168298805_1168298807 21 Left 1168298805 19:55391369-55391391 CCTGCATAAGGCAGGTGTCTCAG 0: 1
1: 0
2: 0
3: 11
4: 146
Right 1168298807 19:55391413-55391435 CTCTTAGTCCAGTAGCTGCATGG 0: 1
1: 0
2: 0
3: 9
4: 130
1168298804_1168298807 22 Left 1168298804 19:55391368-55391390 CCCTGCATAAGGCAGGTGTCTCA 0: 1
1: 0
2: 1
3: 16
4: 127
Right 1168298807 19:55391413-55391435 CTCTTAGTCCAGTAGCTGCATGG 0: 1
1: 0
2: 0
3: 9
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168298807 Original CRISPR CTCTTAGTCCAGTAGCTGCA TGG Intronic
901748662 1:11392077-11392099 CTCTGTGCCCAGGAGCTGCAGGG + Intergenic
901954922 1:12777193-12777215 CTCTAAGTCCAGGGTCTGCAGGG - Exonic
901972642 1:12920034-12920056 CTCTAAGTCCAGGGTCTGCAGGG - Exonic
902012538 1:13281728-13281750 CTCTAAGTCCAGGGTCTGCAGGG + Exonic
902225718 1:14995302-14995324 CTCTTAGACCAGGCGCTCCAGGG + Intronic
904975506 1:34452991-34453013 CTCTTAGCACAGTAACTGCTGGG - Intergenic
907516305 1:54995498-54995520 CTGTTCTTCCTGTAGCTGCATGG - Intergenic
911826298 1:102489271-102489293 CCCTCAGTCCAGCAACTGCAAGG - Intergenic
914222884 1:145696183-145696205 CTCTTAGTCCAGGGGTTGCAAGG + Intronic
916917050 1:169418293-169418315 CTCTTTTTCAAATAGCTGCATGG - Intronic
917431289 1:174972252-174972274 CTGTTAGACCAGAAGCTACATGG + Intronic
922896939 1:229108047-229108069 CCCTGAGTCCAGTAGCAGGAAGG - Intergenic
922919755 1:229292630-229292652 CTCTTAGTCAGGAAGCTTCAAGG - Intronic
1063097343 10:2920056-2920078 CTCTTAGCGCAGTTGCTGCTAGG - Intergenic
1065813707 10:29465266-29465288 CTCTCAGTCTTGTTGCTGCATGG - Intronic
1065957950 10:30709709-30709731 CTCTCAGTCTTGTTGCTGCATGG + Intergenic
1066459252 10:35598758-35598780 CACTTGGACCAGTGGCTGCATGG - Intergenic
1070144243 10:73762156-73762178 TTCCTAGTCCAGTAAGTGCAGGG + Intronic
1074497238 10:113990803-113990825 ATTTTAATCCAGTAGCTCCAGGG - Intergenic
1078157996 11:8815145-8815167 CTCTCAGGCCAGCAGCTCCAAGG + Intronic
1081457146 11:43235024-43235046 CTCATAGTCCATTAGCTTCCAGG + Intergenic
1082043531 11:47706620-47706642 CACCTAGTCCAGAGGCTGCAGGG + Intronic
1083514385 11:63243083-63243105 CTCACAGCCCAGCAGCTGCATGG - Intronic
1083818043 11:65148626-65148648 CTCAGAGTCCAGTAGCTTCAAGG + Intergenic
1089295712 11:117466307-117466329 CTCTTAGTGCAGTGTCTTCAAGG - Intronic
1090451477 11:126810139-126810161 CTCTTAGTCCAGTGTGAGCAAGG - Intronic
1093023708 12:14226563-14226585 CTCTTAGTTAAGTGGCTGTAAGG - Intergenic
1095058461 12:37649590-37649612 CTCTTTTTTCAGTATCTGCAAGG + Intergenic
1095276822 12:40295512-40295534 CTCTTAGTTCATTTGCTGAAAGG - Exonic
1096684199 12:53277109-53277131 CACAGAGTCCAGAAGCTGCAGGG - Exonic
1098881808 12:75925157-75925179 CTCAGACTCCAGTAGCTGAAGGG - Intergenic
1099170534 12:79358892-79358914 CTCCTAGTCAAATAGCTCCAGGG + Intronic
1101641807 12:106591097-106591119 CTCTTAGTCATGAAGCTGTATGG + Intronic
1102005512 12:109586927-109586949 CTCACAGTGCACTAGCTGCAAGG + Intronic
1102059825 12:109923905-109923927 CACTTAGCCCAGTGGCTGCTCGG + Intronic
1106770763 13:32958742-32958764 CTGTTAGGCCAGCAGCTTCAGGG + Intergenic
1113411893 13:110097388-110097410 CTCTTTGGCCAGTAGGAGCACGG - Intergenic
1113822603 13:113225711-113225733 CTCTGACTCCAGGAGCTGGACGG - Intronic
1114460351 14:22882672-22882694 CTCTTAGCCCAGAAGAGGCAGGG + Intergenic
1118035860 14:61865152-61865174 CTCTGGGCCCAGTAACTGCAGGG - Intergenic
1118766099 14:68910141-68910163 CTCCTCCTTCAGTAGCTGCAGGG - Intronic
1119469086 14:74882285-74882307 CTCTGAGTCAAGTATCTGGACGG - Intronic
1123016172 14:105376760-105376782 CTCCGAGTCCAGGACCTGCACGG - Exonic
1125067771 15:35510915-35510937 CTCTGAGTCCAGTATCCACAAGG - Intronic
1127966733 15:63928320-63928342 CTCCTAGTCCAAGAGCTGCTGGG + Intronic
1138621016 16:58211431-58211453 CTCTGAGTCCTGTCCCTGCAGGG + Intergenic
1143800863 17:9379380-9379402 CTCTTAGTCCAGTATTTAAATGG - Intronic
1145572202 17:25010111-25010133 CTCTTTTTCCAGAATCTGCAAGG + Intergenic
1145627248 17:25811633-25811655 CTCTTTTTCCAGAATCTGCAAGG + Intergenic
1145635480 17:25930802-25930824 CTCTTTTTCCAGAATCTGCAAGG + Intergenic
1145678458 17:26555340-26555362 CTCTTTTTCCAGAATCTGCAAGG + Intergenic
1145942184 17:28748379-28748401 TCCTTAGTGCAGTAGGTGCAGGG - Exonic
1147534257 17:41308518-41308540 CTCTGTGACCAGTAGCTGCCAGG - Exonic
1148376978 17:47156912-47156934 CTCTTAGTCCATTAACCCCAAGG - Exonic
1150020922 17:61612241-61612263 CTCTTGGAGCAGTAGCTGGAAGG + Intergenic
1152775920 17:82201924-82201946 CTCTGAGCCCAGTGGCAGCATGG + Exonic
1153228418 18:2914858-2914880 CTCTTTGTCCAGGAGCGGGAGGG + Exonic
1154417649 18:14190831-14190853 CTATTTGTCGAGTAGCTCCAAGG + Intergenic
1154535720 18:15407750-15407772 CTCTTTTTCCAGAATCTGCAAGG + Intergenic
1156900927 18:42299515-42299537 CTCTCAGTGCAATAGCTGCTGGG - Intergenic
1159659400 18:71075369-71075391 CCCTTAGTCCCATAGCAGCAAGG + Intergenic
1162650594 19:12086047-12086069 CTTTTATTCCAGTAGCAGCCTGG + Intergenic
1163215769 19:15876038-15876060 CTCTTTGTTCAGTGGCTGAAGGG - Intergenic
1164571351 19:29376884-29376906 CTCTTCGTCCAGCATCAGCATGG + Intergenic
1168298807 19:55391413-55391435 CTCTTAGTCCAGTAGCTGCATGG + Intronic
925566988 2:5266678-5266700 TTCTTGGTCCAGCAGCTACATGG - Intergenic
927176358 2:20411584-20411606 GACATAGTGCAGTAGCTGCATGG + Intergenic
927635593 2:24813780-24813802 CTCTGAGGCCAGAGGCTGCAGGG + Intronic
929210153 2:39347157-39347179 CTCGTATTCCAGTAGCTGTCAGG - Intronic
929458357 2:42082959-42082981 TTCTTAGTCCAGTAGGTGATGGG - Intergenic
929828303 2:45327763-45327785 TTCTTAGTGCTATAGCTGCAGGG + Intergenic
932630822 2:73341781-73341803 CCCTCAGTCCTGCAGCTGCAAGG + Intergenic
934472522 2:94565215-94565237 CTCTTTTTCCAGAATCTGCAAGG - Intergenic
936169085 2:110152488-110152510 CTCTGAGTCCAGAAGGAGCATGG + Intronic
937894389 2:126967535-126967557 CTCTTAGTCCAGCAGCTTCCAGG + Intergenic
1170708112 20:18764257-18764279 CCCTTTATCCAGTAGCTACATGG + Intergenic
1175523751 20:59619429-59619451 ATCTTAGTGCCATAGCTGCAGGG + Intronic
1179369687 21:40793178-40793200 CTCTTAGTCCTTCAGCTGCTGGG + Intronic
1181183078 22:21080750-21080772 GTCTCAGCCCAGCAGCTGCAGGG - Intergenic
1185074029 22:48673571-48673593 CTCTCAGTCCAGCAGCGACAGGG - Intronic
953408224 3:42670910-42670932 CTCCTACTTCACTAGCTGCAAGG + Intergenic
953439566 3:42906219-42906241 GTCTTACTCCGGTGGCTGCAGGG + Exonic
957233865 3:77559027-77559049 TTGTTAGTCCAGTAGCCACAAGG - Intronic
958209382 3:90450334-90450356 CTCTTTTTCCAGAACCTGCAGGG - Intergenic
961994677 3:131229472-131229494 CTTTTATTTTAGTAGCTGCATGG - Intronic
965342505 3:167507480-167507502 TTCTTAATCCAATAACTGCAAGG - Intronic
966745490 3:183271508-183271530 CTCTAACACCAGTAGCTACATGG - Exonic
968877142 4:3277315-3277337 TTACTAGTCCAGTAGATGCAAGG - Intergenic
972131419 4:35839390-35839412 CTCTTAGCTAAGTAGCTCCAGGG + Intergenic
972439278 4:39069994-39070016 CTCTCAGTGCAGTAGCGGAAAGG + Intronic
975644726 4:76534957-76534979 CTCTTAGTCCATTTGCTACAAGG - Intronic
977979621 4:103306903-103306925 CTCTTAGTCGGGTGGCAGCAAGG + Intergenic
980191058 4:129525681-129525703 CTCTTATTTTAGTAGCTGCATGG - Intergenic
981085257 4:140676692-140676714 CTCTTCTTCCAGAAGCTGCATGG - Intronic
989205079 5:38802133-38802155 CCCTCAGTCCTGTAACTGCAAGG - Intergenic
991571442 5:68058248-68058270 CTCTTACTCCTGTAGCAGCGTGG - Intergenic
999608531 5:153344105-153344127 CCCTTAGTCCTATAGCTGCAAGG - Intergenic
1000281172 5:159783582-159783604 CTCTTTCTCCAGTAGTTGAAAGG + Intergenic
1001886977 5:175301503-175301525 CTTGTAGTGTAGTAGCTGCAGGG - Intergenic
1005670276 6:28098869-28098891 CACTTGGGCCAATAGCTGCAGGG + Intergenic
1006896486 6:37474675-37474697 CCCCTAGTCCCCTAGCTGCAGGG - Intronic
1006987784 6:38188156-38188178 CTCCTATTCCAGCAGCTGCCGGG + Intronic
1007768182 6:44173448-44173470 CTCTTCCCCCAGTATCTGCACGG + Intronic
1008309344 6:49946843-49946865 CTCTTATCCCAGTATCTGCTAGG - Intergenic
1010054656 6:71551369-71551391 CACTTGCTCCAGTAGCTCCAGGG - Intergenic
1016687799 6:146900970-146900992 CCCTAAGCCTAGTAGCTGCAGGG - Intergenic
1019772781 7:2894228-2894250 CTTTTAGACCACTAGCTGCTTGG - Intergenic
1021384576 7:20012458-20012480 CTATTAGTTCACTAGCTGCTTGG - Intergenic
1022959507 7:35413101-35413123 CCCTCAGTCCTGCAGCTGCAAGG + Intergenic
1025500006 7:61276838-61276860 CTCTTTTTGCAGTATCTGCAAGG + Intergenic
1025514859 7:61623048-61623070 CTCTTTTTGCAGTATCTGCAAGG + Intergenic
1025539202 7:62051888-62051910 CTCTTTTTGCAGTATCTGCAAGG + Intergenic
1028734873 7:94197303-94197325 CTCTTTCTCCAGTATCTGCATGG - Intergenic
1032091686 7:128914633-128914655 CCCTCACTCCAGGAGCTGCAAGG + Intergenic
1032317867 7:130856499-130856521 CCCTCAGTCCAGTATCTGCCTGG + Intergenic
1035296576 7:157870768-157870790 CTCTGGGGCCAGGAGCTGCATGG + Intronic
1035333568 7:158112022-158112044 ATCTCAGGCCAGTAGCAGCAGGG + Intronic
1037081522 8:14793360-14793382 ATCTTAGTGCAGTAGCTCAAGGG - Intronic
1038560720 8:28576865-28576887 CTCTCAGTCCTGCAACTGCAAGG + Intergenic
1038951858 8:32423912-32423934 TTATTATTCCAGTATCTGCAAGG - Intronic
1040326597 8:46346779-46346801 CTCTTATTGCAGGATCTGCAAGG + Intergenic
1043071997 8:75648815-75648837 CTCTTAGCCCTATAGCTGCTAGG + Intergenic
1045694307 8:104790840-104790862 CTCTGTGTCCAGAGGCTGCACGG - Intronic
1049015604 8:139917923-139917945 CTCTCAGTCCCCTAACTGCATGG - Intronic
1052287721 9:26805812-26805834 TTCTTACTTCAGTAGCTGCAAGG - Intergenic
1053711662 9:40817193-40817215 CTCTTTTTCCAGAATCTGCAAGG + Intergenic
1053937793 9:43184651-43184673 CTCTTTTTCCAGAATCTGCAAGG + Intergenic
1054422125 9:64949071-64949093 CTCTTTTTCCAGAATCTGCAAGG + Intergenic
1056367701 9:85922176-85922198 CTCCTAGTCCAGTAGACCCATGG + Intergenic
1056944735 9:90984630-90984652 CTTTAAGTCCATGAGCTGCAGGG - Intergenic
1057533441 9:95875527-95875549 CTCTGAGGCCAGTAGCAGGAAGG - Intergenic
1060259282 9:122059862-122059884 ATCTCAGTCCCGCAGCTGCAAGG - Intronic
1060792889 9:126497816-126497838 GTCTTCTTCCAGCAGCTGCAGGG - Intronic
1062141620 9:134962175-134962197 CTCTCAGGCCAGCAGCAGCAAGG + Intergenic
1062509915 9:136899267-136899289 CTCTCAGACCACTCGCTGCAAGG - Intronic
1203420230 Un_KI270374v1:1885-1907 CTCTTTTTGCAGTATCTGCAAGG + Intergenic
1196934754 X:120718645-120718667 ATCTCAGTCCTATAGCTGCAAGG - Intergenic
1198095487 X:133376205-133376227 CTGTCTGTCCATTAGCTGCACGG - Intronic
1200280178 X:154770619-154770641 CTTATAGCCCACTAGCTGCAAGG - Intronic
1202150487 Y:21839597-21839619 CTCTTTCTCCACAAGCTGCAGGG + Intergenic