ID: 1168301303

View in Genome Browser
Species Human (GRCh38)
Location 19:55406818-55406840
Sequence GGCCCTCGATGGTGACCTGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 2, 1: 0, 2: 0, 3: 8, 4: 140}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168301293_1168301303 8 Left 1168301293 19:55406787-55406809 CCCCTTCTCTTTTTCCTTCCAAA 0: 1
1: 0
2: 12
3: 133
4: 1117
Right 1168301303 19:55406818-55406840 GGCCCTCGATGGTGACCTGGAGG 0: 2
1: 0
2: 0
3: 8
4: 140
1168301298_1168301303 -6 Left 1168301298 19:55406801-55406823 CCTTCCAAACTCACCAGGGCCCT 0: 1
1: 0
2: 3
3: 22
4: 234
Right 1168301303 19:55406818-55406840 GGCCCTCGATGGTGACCTGGAGG 0: 2
1: 0
2: 0
3: 8
4: 140
1168301295_1168301303 6 Left 1168301295 19:55406789-55406811 CCTTCTCTTTTTCCTTCCAAACT 0: 1
1: 1
2: 12
3: 117
4: 1162
Right 1168301303 19:55406818-55406840 GGCCCTCGATGGTGACCTGGAGG 0: 2
1: 0
2: 0
3: 8
4: 140
1168301299_1168301303 -10 Left 1168301299 19:55406805-55406827 CCAAACTCACCAGGGCCCTCGAT 0: 1
1: 0
2: 0
3: 25
4: 289
Right 1168301303 19:55406818-55406840 GGCCCTCGATGGTGACCTGGAGG 0: 2
1: 0
2: 0
3: 8
4: 140
1168301294_1168301303 7 Left 1168301294 19:55406788-55406810 CCCTTCTCTTTTTCCTTCCAAAC 0: 1
1: 1
2: 9
3: 139
4: 1107
Right 1168301303 19:55406818-55406840 GGCCCTCGATGGTGACCTGGAGG 0: 2
1: 0
2: 0
3: 8
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168301303 Original CRISPR GGCCCTCGATGGTGACCTGG AGG Exonic