ID: 1168302051

View in Genome Browser
Species Human (GRCh38)
Location 19:55410702-55410724
Sequence TCTCTGCTCAAAGCCACCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168302051_1168302055 13 Left 1168302051 19:55410702-55410724 CCATTGGTGGCTTTGAGCAGAGA No data
Right 1168302055 19:55410738-55410760 ACTTATGAACAGAAACAGGGAGG No data
1168302051_1168302057 25 Left 1168302051 19:55410702-55410724 CCATTGGTGGCTTTGAGCAGAGA No data
Right 1168302057 19:55410750-55410772 AAACAGGGAGGCCAATGAGGAGG No data
1168302051_1168302054 10 Left 1168302051 19:55410702-55410724 CCATTGGTGGCTTTGAGCAGAGA No data
Right 1168302054 19:55410735-55410757 CAGACTTATGAACAGAAACAGGG No data
1168302051_1168302056 22 Left 1168302051 19:55410702-55410724 CCATTGGTGGCTTTGAGCAGAGA No data
Right 1168302056 19:55410747-55410769 CAGAAACAGGGAGGCCAATGAGG No data
1168302051_1168302053 9 Left 1168302051 19:55410702-55410724 CCATTGGTGGCTTTGAGCAGAGA No data
Right 1168302053 19:55410734-55410756 TCAGACTTATGAACAGAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168302051 Original CRISPR TCTCTGCTCAAAGCCACCAA TGG (reversed) Intergenic
No off target data available for this crispr