ID: 1168302055

View in Genome Browser
Species Human (GRCh38)
Location 19:55410738-55410760
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168302051_1168302055 13 Left 1168302051 19:55410702-55410724 CCATTGGTGGCTTTGAGCAGAGA No data
Right 1168302055 19:55410738-55410760 ACTTATGAACAGAAACAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168302055 Original CRISPR ACTTATGAACAGAAACAGGG AGG Intergenic
No off target data available for this crispr