ID: 1168303518

View in Genome Browser
Species Human (GRCh38)
Location 19:55420525-55420547
Sequence TGTGAGAAGAATAATGAGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168303515_1168303518 19 Left 1168303515 19:55420483-55420505 CCATTTCCCTGAAAAAAGCAAGT No data
Right 1168303518 19:55420525-55420547 TGTGAGAAGAATAATGAGTTTGG No data
1168303517_1168303518 12 Left 1168303517 19:55420490-55420512 CCTGAAAAAAGCAAGTACAAATG No data
Right 1168303518 19:55420525-55420547 TGTGAGAAGAATAATGAGTTTGG No data
1168303516_1168303518 13 Left 1168303516 19:55420489-55420511 CCCTGAAAAAAGCAAGTACAAAT No data
Right 1168303518 19:55420525-55420547 TGTGAGAAGAATAATGAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168303518 Original CRISPR TGTGAGAAGAATAATGAGTT TGG Intergenic
No off target data available for this crispr