ID: 1168303910

View in Genome Browser
Species Human (GRCh38)
Location 19:55423678-55423700
Sequence GTGACAAAGGCGAACACTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168303908_1168303910 -4 Left 1168303908 19:55423659-55423681 CCAGTTGAGCGAGTGTTAGGTGA No data
Right 1168303910 19:55423678-55423700 GTGACAAAGGCGAACACTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168303910 Original CRISPR GTGACAAAGGCGAACACTGA AGG Intergenic
No off target data available for this crispr