ID: 1168308270

View in Genome Browser
Species Human (GRCh38)
Location 19:55447944-55447966
Sequence GACAACTCCAGCAGGGGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168308264_1168308270 3 Left 1168308264 19:55447918-55447940 CCAAGGAGACACAGCTCTAGGCC No data
Right 1168308270 19:55447944-55447966 GACAACTCCAGCAGGGGGACAGG No data
1168308260_1168308270 30 Left 1168308260 19:55447891-55447913 CCAACTGCACGCACGTGGTGCAC No data
Right 1168308270 19:55447944-55447966 GACAACTCCAGCAGGGGGACAGG No data
1168308263_1168308270 4 Left 1168308263 19:55447917-55447939 CCCAAGGAGACACAGCTCTAGGC No data
Right 1168308270 19:55447944-55447966 GACAACTCCAGCAGGGGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168308270 Original CRISPR GACAACTCCAGCAGGGGGAC AGG Intergenic
No off target data available for this crispr