ID: 1168309288

View in Genome Browser
Species Human (GRCh38)
Location 19:55452483-55452505
Sequence CAGGAGTTCCGGGACCCACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168309288_1168309296 -6 Left 1168309288 19:55452483-55452505 CCATGTGGGTCCCGGAACTCCTG No data
Right 1168309296 19:55452500-55452522 CTCCTGCGTCTGGGGGAGCCGGG No data
1168309288_1168309295 -7 Left 1168309288 19:55452483-55452505 CCATGTGGGTCCCGGAACTCCTG No data
Right 1168309295 19:55452499-55452521 ACTCCTGCGTCTGGGGGAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168309288 Original CRISPR CAGGAGTTCCGGGACCCACA TGG (reversed) Intergenic
No off target data available for this crispr