ID: 1168310071

View in Genome Browser
Species Human (GRCh38)
Location 19:55455764-55455786
Sequence TCCCCAGCTCGGGCACCGTG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 118}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168310060_1168310071 19 Left 1168310060 19:55455722-55455744 CCATGCTGAAGCAGGTCTTGGCC 0: 1
1: 0
2: 1
3: 16
4: 143
Right 1168310071 19:55455764-55455786 TCCCCAGCTCGGGCACCGTGGGG 0: 1
1: 0
2: 1
3: 12
4: 118
1168310064_1168310071 -9 Left 1168310064 19:55455750-55455772 CCGAAGGCCCTCAGTCCCCAGCT 0: 1
1: 0
2: 3
3: 44
4: 340
Right 1168310071 19:55455764-55455786 TCCCCAGCTCGGGCACCGTGGGG 0: 1
1: 0
2: 1
3: 12
4: 118
1168310063_1168310071 -2 Left 1168310063 19:55455743-55455765 CCAGCGGCCGAAGGCCCTCAGTC 0: 1
1: 0
2: 0
3: 1
4: 88
Right 1168310071 19:55455764-55455786 TCCCCAGCTCGGGCACCGTGGGG 0: 1
1: 0
2: 1
3: 12
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168310071 Original CRISPR TCCCCAGCTCGGGCACCGTG GGG Exonic
901031557 1:6310121-6310143 TCCCAAGCTCTGGCAGCCTGTGG - Intronic
901828794 1:11879708-11879730 TCCCCAGTGCAGGCACCGCGTGG + Intergenic
902923174 1:19679317-19679339 GCCGCAGCTCGGGCTCCGCGGGG - Exonic
903034361 1:20485004-20485026 TCCCCGGCTGGGTCACCCTGGGG - Intronic
903318242 1:22525709-22525731 TCCTAAGCTCGGTCACTGTGTGG + Intronic
904405161 1:30283700-30283722 TCCCCAGCAAGGGCCCCGGGAGG + Intergenic
906103761 1:43279523-43279545 GCCCCAGCTCGGGCACCCTGTGG + Intergenic
906673606 1:47677554-47677576 ACCTCAGCTCGGGAACCGCGGGG - Intergenic
912318927 1:108692450-108692472 TGCCCAGCTGGGGCACAGCGAGG + Exonic
920536086 1:206737400-206737422 TCCCCAGGTGGGGCAGAGTGGGG + Intergenic
922561742 1:226574751-226574773 TCCCCACCTCGGGCTCCCTGAGG - Intronic
922783719 1:228272853-228272875 TCCCCAGCTCAGGGACAGGGTGG - Intronic
922804807 1:228379796-228379818 TCCCCACCCCGGGAACCCTGGGG - Intergenic
923014256 1:230113674-230113696 TCCCCAGCACAGACAGCGTGCGG + Intronic
1063371428 10:5525214-5525236 CCCGCAGCTCGGCCTCCGTGGGG - Exonic
1063663934 10:8050899-8050921 TACCCAGGTCGGGCAGCGCGCGG + Intergenic
1067295511 10:44973229-44973251 TCCCCAGGCCGGGCACCCTGTGG + Intronic
1067551252 10:47237986-47238008 ACCCCATCAGGGGCACCGTGTGG + Intergenic
1069144114 10:64867644-64867666 CCCCCAGCACGTGCACAGTGAGG - Intergenic
1070508373 10:77137555-77137577 TCCCCAGCTTGGTCACTGTGAGG + Intronic
1073491474 10:103855688-103855710 TCTCCGGCTCGGGCTCCGGGGGG + Intergenic
1075520992 10:123143389-123143411 TCCCCACCTCGTGCACCTTCAGG - Intergenic
1075720586 10:124584403-124584425 TTCCCAGCTCCAGAACCGTGAGG - Intronic
1076371789 10:129960032-129960054 TCCCCAGCTCGGGTTCCCAGCGG - Intronic
1076871109 10:133195577-133195599 TGCCCACCTCAGGCACCCTGAGG - Intronic
1076882961 10:133248399-133248421 TCCACAGCTGGGGCTCCCTGAGG + Intergenic
1077189900 11:1251561-1251583 TTCCCAGCTCGTCCACCGTGGGG + Exonic
1077267630 11:1659920-1659942 TCCCCCGCCCGGGTCCCGTGGGG + Intergenic
1078347012 11:10559040-10559062 TCCCCAGCTGGGGCAGGGTAAGG + Exonic
1082890974 11:58138251-58138273 TCCCCAGCTGGGGCTGCCTGAGG + Intronic
1083478860 11:62930660-62930682 TCCCCAGCTAGGACACCCTGTGG - Intergenic
1083553559 11:63608511-63608533 CCCCCGGCTCTGGCACTGTGCGG + Intronic
1090632314 11:128660695-128660717 TCCCCATCTCAGGCAAGGTGGGG + Intergenic
1092238933 12:6825903-6825925 TGCCCAGCTCTGGCACTATGGGG + Intronic
1094412452 12:30181448-30181470 TCCACAGCTCAGGCACTGTGTGG + Intergenic
1104376429 12:128267924-128267946 TCCACAGCTTCGGCACTGTGGGG + Intronic
1104910886 12:132240477-132240499 TGCCCAGCTCGGACCCCGGGCGG + Intronic
1105699789 13:22927075-22927097 TCCGCAGCTCGTCCTCCGTGCGG - Intergenic
1106687490 13:32076442-32076464 TCCCCAGTGCAGGCACCTTGTGG - Intronic
1108582372 13:51838335-51838357 TCCCCAGCTCTACCACCCTGGGG + Intergenic
1113783652 13:112990470-112990492 TCCCCGCCTCGGCCACCGGGTGG - Intronic
1113950171 13:114067099-114067121 CCCCCAGCTGGGGCACTCTGGGG + Intronic
1114206649 14:20578454-20578476 TCCAGAGCTGGGGCACAGTGGGG + Intergenic
1114768650 14:25403956-25403978 TTCCCAGCTCCGGAACTGTGAGG - Intergenic
1122643985 14:103179405-103179427 CCCCCAGCTCTGGCTCAGTGTGG - Intergenic
1122803892 14:104247133-104247155 TCCCCGGCCAGGGCACCCTGTGG - Intergenic
1123991871 15:25689430-25689452 TCCCCAGCTCAGCCAAGGTGGGG - Intronic
1127576226 15:60295108-60295130 GCCCCAGCAGGGGCACTGTGCGG + Intergenic
1128747388 15:70124084-70124106 TCCCCAGCTGGACCACTGTGAGG + Intergenic
1131826323 15:96324577-96324599 TCCCCAGCTCGGGCACCAGTGGG - Intergenic
1132209504 15:100009481-100009503 TCCCCAGCTGTGCCACCTTGGGG + Intronic
1134560345 16:15203713-15203735 TCCCTAGATTGGGCACTGTGAGG + Intergenic
1134920885 16:18115327-18115349 TCCCTAGATTGGGCACTGTGAGG + Intergenic
1139936776 16:70577309-70577331 GCCCCAGAGAGGGCACCGTGCGG + Exonic
1144608881 17:16690807-16690829 TCCCCATCCCGGGTGCCGTGGGG - Intronic
1145128645 17:20321729-20321751 TCCCCATCCCGGGTGCCGTGGGG - Intergenic
1145195978 17:20895586-20895608 TCCCCATCCCGGGTGCCGTGGGG + Intronic
1147806994 17:43138833-43138855 TCACCAGCCTGGGGACCGTGGGG + Intergenic
1148168945 17:45503437-45503459 TCACCAGCCTGGGGACCGTGGGG + Intergenic
1148279872 17:46339576-46339598 TCACCAGCCTGGGGACCGTGGGG - Exonic
1148302090 17:46557432-46557454 TCACCAGCCTGGGGACCGTGGGG - Exonic
1150400140 17:64849898-64849920 TCACCAGCCTGGGGACCGTGGGG + Intergenic
1151822230 17:76502488-76502510 TCCCCAGCTCTGGGGCCATGAGG + Intergenic
1151878766 17:76882078-76882100 GCCCCAGCTCGGACACCAGGTGG + Intronic
1152381029 17:79942325-79942347 AGCCCAGCTCGGGGGCCGTGTGG + Intronic
1152610690 17:81313844-81313866 TCCCCACCTCGGTCTCCTTGGGG - Exonic
1152647837 17:81477938-81477960 TCCCCAGTGCTGGCACCATGTGG + Intergenic
1152792420 17:82288677-82288699 TCCCCACCAAGGGCACCATGTGG + Intergenic
1152845537 17:82597420-82597442 TCCCCAGCTCCGGCACCTCCAGG + Intronic
1160406055 18:78647024-78647046 TCCCCAGCTCCAGGTCCGTGAGG + Intergenic
1160622971 18:80183521-80183543 GCCCCAGCTCGAGCACTGTGCGG + Intronic
1161707285 19:5828128-5828150 CCGACAGCTCGTGCACCGTGTGG - Exonic
1164576746 19:29409538-29409560 TCCCCAGGTCAGAGACCGTGTGG - Intergenic
1165153967 19:33776675-33776697 TCCCCAGCTTGGTCCCCCTGTGG + Intergenic
1166849650 19:45753383-45753405 TCCCCAGACTGGGCACCTTGAGG - Intronic
1168155308 19:54471102-54471124 TCCCGAGCCCTGGCAGCGTGAGG - Intronic
1168310071 19:55455764-55455786 TCCCCAGCTCGGGCACCGTGGGG + Exonic
926109138 2:10170961-10170983 TCCCCAGCCCAGGCACCTCGGGG + Intronic
927156241 2:20223437-20223459 TCCCCAGCTCTGGCAAAGGGAGG - Intronic
927156591 2:20224586-20224608 TCCCCAGCGCGGGACCGGTGCGG + Intronic
932589292 2:73054201-73054223 TCCCCAACTGGGGTACAGTGGGG + Intronic
934646221 2:96060647-96060669 CCTCCAGCTCCTGCACCGTGAGG + Intergenic
934839623 2:97616729-97616751 CCTCCAGCTCCCGCACCGTGAGG + Intergenic
935590986 2:104845154-104845176 TCCCCAGCTCGGGGAGGGCGGGG + Intergenic
936251781 2:110873344-110873366 GCCCCAGCTGGGGCCCAGTGTGG + Intronic
937278034 2:120698606-120698628 TTCCCAGCACGGCCACCTTGAGG - Intergenic
937372167 2:121306432-121306454 TCCCCAGCTGGTGCACTTTGGGG + Intergenic
938319834 2:130355651-130355673 GCCCCAGCTCGGACTCCGCGCGG + Intergenic
945511890 2:210713325-210713347 TCCACAGGTGGGGCACTGTGTGG + Intergenic
948465433 2:238149679-238149701 TCCCCAACTTGGCCACCCTGGGG - Intronic
1168760709 20:347817-347839 TCCCCAGCCCGGGAGCCGGGAGG - Intronic
1173751453 20:45479979-45480001 TCCCCAGCTCGGCCTCTGTCGGG + Exonic
1178585838 21:33869804-33869826 TTCCCAGCTCTGCCACCGAGAGG - Intronic
1180913731 22:19470984-19471006 TCCCCAGCTCTGGCACATTAGGG - Intronic
1181806947 22:25380626-25380648 ACCCCAGCTCAGGCATCCTGAGG - Intronic
1182457506 22:30461337-30461359 TCCCATCCTCGGGCACCATGTGG + Exonic
952152395 3:30606986-30607008 TCCCCAGCCCGGGCTCGGCGGGG + Intronic
958426887 3:93989035-93989057 TCAGCAGCTCGGGCAGCGGGAGG - Intronic
961352898 3:126315433-126315455 CCCCCATCTGGGGCACAGTGGGG - Intergenic
966863144 3:184241695-184241717 CCCCCAGCTCGGGCTCTGAGGGG + Exonic
966993058 3:185253910-185253932 CCTCCAGCCCGGGGACCGTGCGG - Intronic
969328726 4:6460417-6460439 TCCCAAGCTCTAGCACTGTGAGG + Intronic
984852932 4:184169323-184169345 TTCCCAGCTCGGCCACCGAGAGG - Intronic
985236570 4:187881597-187881619 GCCCCAGCTCAGGCACTGTCAGG - Intergenic
985432295 4:189893061-189893083 TGCCCAGCTGGGGGACGGTGGGG + Intergenic
985729496 5:1539413-1539435 CCCCCATCTTGGGCACTGTGGGG - Intergenic
985775790 5:1841125-1841147 TCCCCAGCGCCGGCTCCCTGAGG + Intergenic
1002026649 5:176400481-176400503 TCCCCAGCTCTGGCAAGGGGTGG - Intronic
1002640652 5:180629120-180629142 TGCCCAGCTCCTGCACCGGGCGG - Intronic
1003164088 6:3661078-3661100 TCCCCAGCCCTTGCACCTTGAGG - Intergenic
1006248612 6:32761777-32761799 GCCCCAGCTCGGTCACCGCCTGG + Exonic
1006791292 6:36702973-36702995 TCCACAGCTGGGGCAGCATGGGG + Intronic
1029927094 7:104329259-104329281 TCCCCGGCTCGGGCGCCCCGGGG - Intronic
1032097711 7:128947721-128947743 TCTCCAGGTCGGTCACTGTGGGG - Exonic
1034866727 7:154648437-154648459 TCCCCAGCGCAGACACAGTGGGG - Intronic
1037618530 8:20543062-20543084 TCCCCAGCTGGGGCGCCCAGAGG + Intergenic
1039424711 8:37476496-37476518 TCCCCAGCTGGGGCACCTGGTGG + Intergenic
1040319525 8:46285637-46285659 TCCACAGGTGGGGCACCCTGAGG + Intergenic
1043874029 8:85464419-85464441 TCCCCAGGTCGGGACCCGGGAGG - Intronic
1044840181 8:96330592-96330614 TCCCCAGCTCTTGAACTGTGTGG + Intronic
1049375994 8:142289447-142289469 TCCCCAGCTCGGTCGCCAGGAGG - Intronic
1049606252 8:143530503-143530525 TCCCCAGCCTGGGCACAGGGTGG + Intronic
1053110639 9:35456934-35456956 TCCCGAACTCTGGCACCCTGCGG - Intergenic
1056786767 9:89598095-89598117 TGCCCAGCTGTGGCACAGTGGGG + Intergenic
1057550978 9:96050677-96050699 TCCCCAGCTACCGCACAGTGGGG - Intergenic
1060209204 9:121699779-121699801 TCCCCGGTTCGGGCACCGCACGG - Intronic
1061257081 9:129459494-129459516 CCCCCAGCTCGGCCGCCCTGGGG - Intergenic
1061747928 9:132753649-132753671 GCCCCAGCTGGGCCACCCTGGGG - Intronic
1062525708 9:136977320-136977342 GCCCCAGCTGAGGCAGCGTGGGG - Intergenic
1062544248 9:137054472-137054494 TCCCCAGCCCGGGCCCCGCGTGG - Intergenic
1185504151 X:619526-619548 CCCCCAGTCCGGGCACCGTGGGG + Intergenic
1199443057 X:147890066-147890088 TAACCAGCTTGGGCACAGTGGGG - Intergenic