ID: 1168314085

View in Genome Browser
Species Human (GRCh38)
Location 19:55476549-55476571
Sequence CCGCCCCCGGACCCTCCCAT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 183}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168314085_1168314093 23 Left 1168314085 19:55476549-55476571 CCAATGGGAGGGTCCGGGGGCGG 0: 1
1: 0
2: 0
3: 14
4: 183
Right 1168314093 19:55476595-55476617 ACGCACCGACGGCGACGTCGGGG 0: 1
1: 0
2: 0
3: 2
4: 15
1168314085_1168314091 21 Left 1168314085 19:55476549-55476571 CCAATGGGAGGGTCCGGGGGCGG 0: 1
1: 0
2: 0
3: 14
4: 183
Right 1168314091 19:55476593-55476615 TGACGCACCGACGGCGACGTCGG 0: 1
1: 0
2: 0
3: 0
4: 10
1168314085_1168314090 12 Left 1168314085 19:55476549-55476571 CCAATGGGAGGGTCCGGGGGCGG 0: 1
1: 0
2: 0
3: 14
4: 183
Right 1168314090 19:55476584-55476606 CGTGCGTTGTGACGCACCGACGG 0: 1
1: 0
2: 0
3: 1
4: 10
1168314085_1168314092 22 Left 1168314085 19:55476549-55476571 CCAATGGGAGGGTCCGGGGGCGG 0: 1
1: 0
2: 0
3: 14
4: 183
Right 1168314092 19:55476594-55476616 GACGCACCGACGGCGACGTCGGG 0: 1
1: 0
2: 0
3: 0
4: 13

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168314085 Original CRISPR CCGCCCCCGGACCCTCCCAT TGG (reversed) Exonic
900140552 1:1137812-1137834 CCGCCCCAGGACCCAGCCAAGGG - Intergenic
900393865 1:2445150-2445172 CAGACCCCAGACCCTCCCCTAGG - Intronic
901066618 1:6497405-6497427 CCGCCGCCGGACCCTCGCACGGG + Intronic
901251691 1:7784228-7784250 CCGCCCCCGGGCCGTGCGATTGG - Intergenic
901651221 1:10744262-10744284 CCGCCCCAGGACCCCACCCTTGG - Intronic
904352898 1:29920510-29920532 CCCCACCCAGACCCTCCCCTTGG + Intergenic
904836217 1:33338832-33338854 CCTCCCCCAGCCTCTCCCATCGG - Intronic
905734608 1:40316757-40316779 CCGCCCCCGCCGCCTCCCAGGGG - Intronic
906078196 1:43067508-43067530 CCAGCCCCAGACCCTCCCATTGG - Intergenic
912977837 1:114346217-114346239 GCGCACCCAGACCCTCCCCTGGG + Intergenic
913167194 1:116199367-116199389 CCCCCTCCACACCCTCCCATTGG + Intergenic
915246275 1:154558442-154558464 CCGGCCCCGGGCCCCCCCCTGGG + Exonic
920116759 1:203627022-203627044 CCTCCCCCTGCCCCTCCAATGGG - Exonic
922823493 1:228501306-228501328 CCTCTCCCGGACTCCCCCATGGG - Intergenic
923380360 1:233411299-233411321 CCGCCCTAGGTCCCTGCCATGGG - Intergenic
923526840 1:234779091-234779113 CTGCCCCCGCACCCCCCCACCGG - Intergenic
923744299 1:236686400-236686422 CCGCCCCCGGCCCCGCCCGTCGG - Intergenic
1062908344 10:1195086-1195108 CCGCCCCCTTAGCCTCCCGTGGG + Intronic
1063376517 10:5557714-5557736 CCACTCCCAGACCCTCCCAAGGG - Intergenic
1063704681 10:8419459-8419481 CTGCCTCAAGACCCTCCCATTGG - Intergenic
1064271808 10:13872170-13872192 GCGCCCCCGGGCCTTCCTATAGG - Intronic
1064583514 10:16817208-16817230 CCGCACCCGGACCAGCCCCTGGG - Exonic
1065634408 10:27715849-27715871 CAGCCCCCAGCCCATCCCATAGG - Intronic
1065722536 10:28640704-28640726 CCTCCCCCCGACCCCCTCATAGG - Intergenic
1066370422 10:34814858-34814880 GCGCCCCCGGCCCCTCACCTTGG + Exonic
1067769912 10:49115574-49115596 CCGCCCCCGGCCCGCCCCTTGGG + Intergenic
1070808785 10:79286856-79286878 CGGCCCCTGGGGCCTCCCATGGG + Intronic
1074853229 10:117455316-117455338 CCACCCCCGCACCCTCCCCCCGG - Intergenic
1076696765 10:132250959-132250981 CCGCCACTGTACCCTCCCACTGG - Intronic
1076864465 10:133160199-133160221 CCGCCCCCGGTGCCTCCCCCAGG + Intergenic
1076890859 10:133282629-133282651 CCTCCTCCGGACCCTCCCCATGG + Intronic
1076991906 11:279911-279933 CCTCCCCGGGACCCTCCAAGTGG - Intronic
1077299575 11:1840797-1840819 CCGCCCCCACACCCACCCCTAGG + Exonic
1082748641 11:56995256-56995278 CCACCCCTGGACACTACCATGGG - Intergenic
1082814602 11:57499731-57499753 CCAGCGCCGGACCCTGCCATTGG + Intronic
1083272889 11:61580915-61580937 CCGCCCTCGGACCCGCCCCCGGG - Intronic
1083739080 11:64698357-64698379 ACGGCCCCTGACCCTCCCAGGGG + Intronic
1084687359 11:70704403-70704425 CCTCACCAGGACCTTCCCATGGG - Intronic
1085532795 11:77201845-77201867 CCACCCCCGGCCCCACCCCTTGG - Intronic
1086143381 11:83523822-83523844 CCGCCCCCTGCCCCTGCCATTGG - Intronic
1089306380 11:117528923-117528945 CCGCCCCCCGCCCCCCCCCTTGG + Intronic
1089494728 11:118902361-118902383 CCACCCACGGCCCCTCCCAGCGG - Exonic
1090369432 11:126238069-126238091 CCGCACCCGGCCTCTTCCATTGG - Intronic
1092247848 12:6873341-6873363 CCGCCCCCAGCTCCTCCCTTGGG + Intronic
1094536247 12:31324783-31324805 TGGCCCCCCGACCCTCCCCTCGG + Intronic
1095803565 12:46293948-46293970 TCCCCCCGGGTCCCTCCCATGGG + Intergenic
1097245802 12:57607062-57607084 CCTCCCCCGGCCCCTCCAAATGG + Exonic
1102370911 12:112381919-112381941 CGGCCCCCGGCCCCCGCCATCGG - Intronic
1102504371 12:113374452-113374474 CTGCCCCCGCCCCCTCCCCTAGG + Exonic
1103564401 12:121808254-121808276 CACCCCCCAGACCCTCCCAGTGG + Exonic
1104944239 12:132408586-132408608 CCACCCCAGGACCCTGCCAGAGG + Intergenic
1113452769 13:110423432-110423454 CCTCCCCCCGACCCACCCACAGG - Intronic
1116898710 14:50341442-50341464 CCCCCCCCAGACCCTCCCCAGGG - Intronic
1123919522 15:25060573-25060595 CAGGCCCAGGACCCTCCCGTGGG + Intergenic
1124414833 15:29466469-29466491 CCTCCCCTGGACCCTCCCCTGGG - Intronic
1124414895 15:29466638-29466660 CCTCCCCTGGGCCCTCCCCTGGG - Intronic
1124414925 15:29466705-29466727 CCACCCCTGGGCCCTCCCCTGGG - Intronic
1124414964 15:29466807-29466829 CCTCCCCTGGGCCCTCCCCTGGG - Intronic
1124414979 15:29466841-29466863 CCTCCCCTGGGCCCTCCCCTGGG - Intronic
1124415021 15:29466943-29466965 CCTCCCCTGGGCCCTCCCCTGGG - Intronic
1124415051 15:29467010-29467032 CCACCCCTGGGCCCTCCCCTGGG - Intronic
1124415066 15:29467044-29467066 CCTCCCCTGGGCCCTCCCCTGGG - Intronic
1124415081 15:29467078-29467100 CCTCCCCTGGGCCCTCCCCTGGG - Intronic
1127293679 15:57591880-57591902 CCGCCCCCGGCCCCACCCCCGGG + Intergenic
1131234419 15:90683559-90683581 CCGCCCCCAGCCACACCCATGGG - Intergenic
1132915542 16:2341527-2341549 CCCTCCCCGGACCATCCCGTCGG - Intergenic
1133215969 16:4292689-4292711 CCGCCCCCGGACCCACACTGGGG - Intergenic
1136061233 16:27728117-27728139 CAGCGCCCAGACCCTGCCATGGG - Intronic
1136227556 16:28869229-28869251 CCGCCCCATGACCCTCCCTCTGG + Exonic
1136382109 16:29900507-29900529 CCACCCCCGAACCCTCCCAGTGG - Intronic
1137665140 16:50245615-50245637 CCGCCCCTGAGCCCTGCCATAGG + Intergenic
1139826671 16:69762514-69762536 CCGCGCCAGGCCCCTCCCACAGG - Intronic
1141130537 16:81433380-81433402 CAGCCCCAGGACACTCCCACTGG - Intergenic
1141512253 16:84519972-84519994 CAGCCCCCGGACCAACCCACAGG + Intronic
1142234465 16:88915256-88915278 CCACCCCGCGACCCACCCATAGG - Intronic
1142335949 16:89489961-89489983 CCCCCCCCGGAGCCCCCTATGGG + Intronic
1143493046 17:7294813-7294835 CGGCCCCCGGCCCAACCCATTGG + Intergenic
1143586422 17:7852896-7852918 CAGCCCCAGGGCCCTCCCCTAGG - Intronic
1146445316 17:32928175-32928197 CCGCGCCCGGACTTTGCCATCGG + Exonic
1147317331 17:39627226-39627248 CCGCTCCCGCGCCCTCCCCTCGG + Exonic
1147935201 17:44006963-44006985 CCGCCCCTGGCCCCGCCCACCGG - Intronic
1148769889 17:50060586-50060608 CTGCCTCCTCACCCTCCCATTGG - Intronic
1150604051 17:66675979-66676001 CCGCCCCCGGAACATCACGTGGG + Intronic
1151603980 17:75124719-75124741 CTGCCCCTCGGCCCTCCCATGGG - Intronic
1151663304 17:75531212-75531234 TGGCCCCGGGACCCTCCCTTTGG + Intronic
1153636550 18:7117848-7117870 CCGCCCTCGGACACACCCCTCGG + Intergenic
1160730471 19:639719-639741 CCGCCCCCGAGACGTCCCATTGG + Intergenic
1160752332 19:740293-740315 CCGCCCCCGCACCCCCCCGCCGG - Intronic
1160813821 19:1026447-1026469 TCGCCCCCGGACCCCCGCCTGGG - Intergenic
1160864055 19:1249475-1249497 CCGCTCCCGGCCGCTCCCTTGGG + Intronic
1161003233 19:1921586-1921608 CCGCCCCCGCAGCTTCCCACTGG - Intronic
1161133774 19:2607736-2607758 CCGCCCCCCGCCCCTCCCAGTGG + Intronic
1161172570 19:2820239-2820261 CCGGCTCCCGACCCTCCCGTGGG - Intronic
1161215712 19:3094298-3094320 TGGCCGCCGGCCCCTCCCATTGG + Intergenic
1161418210 19:4159787-4159809 GCACCCCCACACCCTCCCATGGG + Intronic
1162050463 19:8029410-8029432 CCGCCCCCCCAGCCTCCCAGTGG + Intronic
1162364876 19:10242567-10242589 CTGCCCCCAGTGCCTCCCATTGG + Intergenic
1162953521 19:14085700-14085722 CCGCCCCGGGAGCCTCCGACTGG + Exonic
1163284627 19:16338623-16338645 CAGCTCCCGGACCCTGCCAGAGG - Intergenic
1165099017 19:33427388-33427410 CAGCCCCAGGAGCCCCCCATCGG + Intronic
1165247162 19:34504452-34504474 CCACCCCAGGACCCTCCAAGAGG - Exonic
1167982962 19:53291209-53291231 CCTCCGCGGGACCCTCCCGTTGG - Exonic
1168296093 19:55377923-55377945 CCTCCGCCGGACCCTCCCCCTGG - Intronic
1168314085 19:55476549-55476571 CCGCCCCCGGACCCTCCCATTGG - Exonic
925274395 2:2638484-2638506 CAGCCCCCTAACCCTCCCTTGGG + Intergenic
926101799 2:10122673-10122695 GCGCTCCCGGCCCTTCCCATTGG - Exonic
926580926 2:14632643-14632665 CCGCCCCAGGACGCGCTCATTGG - Intergenic
927698373 2:25252318-25252340 CCGCCCCCCTCCCCTCCCAGTGG - Intronic
928441488 2:31295822-31295844 CCACCCCTGGACACTGCCATGGG + Intergenic
930011393 2:46940954-46940976 CCGCCCCCTCCCCATCCCATCGG - Intronic
930780804 2:55223667-55223689 GCGCCCCCGGACCCGCTCAGCGG + Intronic
932556028 2:72825684-72825706 CCGGCGCCGGCCCCTCCCTTCGG - Intronic
945936166 2:215904721-215904743 CAGCCCCCGGTGCCTCCCAGTGG + Intergenic
946389802 2:219408588-219408610 CAGCCCCCAGACCCTCTCCTGGG - Intergenic
946718929 2:222583718-222583740 TCCCACCCAGACCCTCCCATGGG - Intronic
947982168 2:234419920-234419942 CTGCCTCCAGACCCTGCCATTGG - Intergenic
948459131 2:238120700-238120722 CCGTCACCAGACCCTCCCAGAGG - Intronic
948487265 2:238288824-238288846 CCGCCCCCGGCCTCCGCCATTGG + Intronic
1169367292 20:5001588-5001610 CCGCCCCCGACCCCTGCCCTCGG + Intronic
1171251964 20:23655774-23655796 CCACCCCCGCACCCCCACATAGG + Intergenic
1171453431 20:25252357-25252379 CCACCCCCCGACCCCCCCAGAGG - Intronic
1172814077 20:37672536-37672558 CCCCCACCGGCGCCTCCCATTGG - Intergenic
1174386375 20:50190539-50190561 CCGCCCCCGGACCGCCCCTCTGG - Intergenic
1174436409 20:50510264-50510286 CCGCCCCCGGCTCCTCCCCGCGG + Intergenic
1174560792 20:51429287-51429309 CCACCCCAGGACCCTCCAATGGG - Intronic
1175874055 20:62221087-62221109 CCTCCCCCGTCCCCTCCCACAGG - Intergenic
1175911400 20:62407002-62407024 CCGCCGCCGGAGCCCCCCACCGG - Exonic
1176085316 20:63293127-63293149 CCACCCCCCGACCCACCCCTCGG - Intergenic
1176245815 20:64096018-64096040 CCTCCCCAGGAGCCTCCCTTAGG - Intronic
1178892958 21:36535144-36535166 CCGCCCCCTCAGCCTCCCAAAGG - Intronic
1180559172 22:16601795-16601817 CCGCCCGCGGCCCCTCCCCCGGG - Intergenic
1181130308 22:20727312-20727334 GCGCCCACGGACCCACCCACAGG - Exonic
1181870040 22:25890933-25890955 CTGCTCCCCGACCCTCTCATTGG + Intronic
1183428333 22:37751330-37751352 TGCCCCACGGACCCTCCCATGGG - Intronic
1184732369 22:46377915-46377937 CCTCCCCCGGCCCCTCCCCGGGG - Intronic
950053941 3:10010963-10010985 GAGCCCCCGGATCTTCCCATGGG - Intronic
950518672 3:13483390-13483412 CCAGCCCCAGACCCTCCCACAGG - Intronic
955059913 3:55485419-55485441 CCACCCCCCGACCCTCTCAACGG - Intronic
961054192 3:123774006-123774028 CAGCCCCAGGACCCTGCCAAGGG - Intronic
961473963 3:127135662-127135684 CCGCCCCCGCACCCTCCCCGCGG + Intergenic
962709336 3:138072329-138072351 GCCTCCCTGGACCCTCCCATGGG - Intronic
966872303 3:184299068-184299090 CCGCCCTCGGACCCCGCCCTCGG - Exonic
967255857 3:187591230-187591252 CCGCCCCCTGCCCCTCCCCCTGG - Intergenic
970494246 4:16609337-16609359 CCCCCCCCGCCCCCTCCCCTGGG - Intronic
974598089 4:64038947-64038969 CCCCCACCGGACCCTCCAACAGG - Intergenic
975139105 4:70902351-70902373 CCGCCCCCTCCCCCTGCCATTGG + Intronic
985164164 4:187074701-187074723 CCGCTCTCAGACCCTCTCATCGG - Intergenic
985630010 5:1009228-1009250 CCGCCCCCCGCCCCGCCCGTCGG - Intronic
985640326 5:1060673-1060695 CCTCCCCGGGACCCTCCGACCGG + Intronic
985670836 5:1205853-1205875 CAGCCCCCACACCCTCCCATAGG + Intronic
989178837 5:38556578-38556600 CCGCCGCCAGAGCCTCCCAGAGG + Intronic
990738949 5:58892882-58892904 CCGCCCCCCGCCCCTCTGATAGG - Intergenic
991491008 5:67182537-67182559 CCGGCCCCGGAGTCTCCCACAGG - Exonic
994551471 5:101239838-101239860 CCACCCCCTGACCCTCACAGGGG - Intergenic
996669653 5:126101923-126101945 CCACCCCTGGACACTGCCATGGG - Intergenic
1001778047 5:174343955-174343977 CCCCGCCCGGACCCTCATATTGG + Intergenic
1002309770 5:178307226-178307248 CTGCCTCAGGAGCCTCCCATGGG - Intronic
1004202137 6:13558757-13558779 CTGCCCCAGAACCCTCCCAGAGG + Intergenic
1007327238 6:41072275-41072297 GCCTCCCCGCACCCTCCCATAGG - Intronic
1007465470 6:42048558-42048580 CCGCCTCCGGAGCCTGCCTTTGG + Intronic
1012399892 6:98834502-98834524 CCCCCTCCGCCCCCTCCCATTGG - Intergenic
1017906278 6:158759285-158759307 CCGCCCACAGACCCGCCCCTGGG + Intronic
1019404548 7:876835-876857 CCGCCCCCGCCGCCTCCCATTGG + Intronic
1026897467 7:74018533-74018555 CTGCCCCCTGCCCCTCCCAGAGG - Intergenic
1029715653 7:102324073-102324095 CCCCCCCCGGGCTCTCCCAAGGG + Intergenic
1031899459 7:127392900-127392922 CCGCCCCGGTTCCCTCCCCTCGG - Intronic
1031966566 7:128031702-128031724 CCGCCCCCGGACTCTCTGAAGGG - Intronic
1035287100 7:157813618-157813640 ACTCCCCCGGACCCGCCCAGAGG - Intronic
1036163718 8:6411809-6411831 CCGCCCCCAACCCCTCCCAGTGG - Intronic
1037805485 8:22056059-22056081 CCACCCCAGGAGCCTCTCATTGG - Intronic
1037886743 8:22599590-22599612 CGGCCCCCAGACACTCCCAGCGG - Intronic
1037994012 8:23339860-23339882 CAGCCCCCAGCCCCTCACATGGG - Intronic
1038436725 8:27541585-27541607 CCGCCCGCGGGGCTTCCCATTGG + Intronic
1040915724 8:52565161-52565183 GCGCCCCCGGGGCCTCCCGTGGG + Exonic
1045584430 8:103516805-103516827 CCTCTCCCCGACCTTCCCATTGG - Intronic
1047454709 8:124998462-124998484 CCGCCCCCGGTCCCTCGTCTGGG + Intergenic
1047655425 8:126971810-126971832 CCTCACCCAGACCCTCCCACTGG - Intergenic
1049250182 8:141584018-141584040 ACGCCCCCCTCCCCTCCCATAGG - Intergenic
1049594660 8:143477797-143477819 CAGCCCCCTCACCCTCCCAATGG - Intronic
1049762620 8:144337967-144337989 CCGCGCCCGGACGCTCCCCGGGG - Intergenic
1050041893 9:1504371-1504393 CCACCCCTGGACACTGCCATGGG + Intergenic
1051171557 9:14322659-14322681 CCGCCCCCGGCTCCTCCTTTCGG - Intronic
1052006884 9:23360093-23360115 CCACCCCCAGCCCCTCCCATTGG + Intergenic
1057665098 9:97038868-97038890 CCCCGCCCGGGCCCTCCCAGTGG + Intronic
1059022681 9:110593679-110593701 CCACCCCCCCACCCTCCCACGGG + Intergenic
1060989979 9:127843063-127843085 CCCCCACCCGACCCTGCCATGGG + Intronic
1061108966 9:128553094-128553116 CCGCCCCCGGTCCCTTCCCTCGG + Intronic
1061195218 9:129103608-129103630 CCGCCCCTGGATCCCACCATGGG + Intronic
1061225574 9:129279130-129279152 CCCCCCCCGGTCCCTCCCCTGGG + Intergenic
1061237728 9:129352182-129352204 CCGCCCCCGGACCCTCTGGCGGG - Intergenic
1062097284 9:134709934-134709956 CAGCCACTGGACCCTCCCACAGG - Intronic
1062379485 9:136280400-136280422 CCCACCCCGGCCCCTCCCCTGGG - Intergenic
1062421083 9:136483103-136483125 CCGCCCCTGGCCCCGCCCCTCGG + Intronic
1186633452 X:11376512-11376534 CTGCCCCTGGAGCCTCCCAAAGG + Intronic
1188133493 X:26466827-26466849 CCTCCCCTGGTCCCTCCCTTGGG - Intergenic
1189292198 X:39894495-39894517 CAGGCACCGGCCCCTCCCATCGG + Intergenic
1193710033 X:84868709-84868731 CCGCCCCCAGATGCTGCCATGGG - Intergenic
1197774614 X:130110980-130111002 CCGCCCGCAGTCCCTCCCGTCGG - Intergenic