ID: 1168315526

View in Genome Browser
Species Human (GRCh38)
Location 19:55483259-55483281
Sequence CGTGCCCCCCGCCACCTCGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 100}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168315526_1168315532 -2 Left 1168315526 19:55483259-55483281 CCCTCGAGGTGGCGGGGGGCACG 0: 1
1: 0
2: 0
3: 7
4: 100
Right 1168315532 19:55483280-55483302 CGGCCCAGGCCCCGAGCTTGGGG 0: 1
1: 0
2: 1
3: 32
4: 184
1168315526_1168315530 -4 Left 1168315526 19:55483259-55483281 CCCTCGAGGTGGCGGGGGGCACG 0: 1
1: 0
2: 0
3: 7
4: 100
Right 1168315530 19:55483278-55483300 CACGGCCCAGGCCCCGAGCTTGG 0: 1
1: 0
2: 0
3: 25
4: 263
1168315526_1168315531 -3 Left 1168315526 19:55483259-55483281 CCCTCGAGGTGGCGGGGGGCACG 0: 1
1: 0
2: 0
3: 7
4: 100
Right 1168315531 19:55483279-55483301 ACGGCCCAGGCCCCGAGCTTGGG 0: 1
1: 0
2: 0
3: 9
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168315526 Original CRISPR CGTGCCCCCCGCCACCTCGA GGG (reversed) Exonic
900363457 1:2300899-2300921 CGGTCCTCCCGCCACCTCCACGG + Intronic
900584219 1:3424748-3424770 GGGGCCCCCAGCCACCTCGAGGG + Intronic
900599629 1:3497504-3497526 GGAGCCCCCCGCCACCCCGGAGG + Intronic
902920866 1:19665374-19665396 CTTGCCGCCCGCCCCCTCCAGGG + Exonic
905673477 1:39808345-39808367 GGTGCCCCCCACCTCCTGGACGG - Intergenic
913356611 1:117929463-117929485 CGTGCCGCCCGCCGCCCGGATGG - Exonic
919926590 1:202194693-202194715 CGCCCCCCCCGCCCCCACGAAGG - Intronic
920886926 1:209938315-209938337 CGAGCCCCCCGCCAGCTGGGTGG - Intronic
922775325 1:228211836-228211858 CTTGCCCACCGACACCACGAAGG - Exonic
1070820512 10:79351433-79351455 CGTGGCCCCCGCCTGCTCCATGG + Intronic
1072045439 10:91650129-91650151 CTTGCCCCCCACCCCCTGGAAGG - Intergenic
1074130377 10:110568141-110568163 GGTGCCCCCCGCCAGCTCTGGGG - Intronic
1076699049 10:132260751-132260773 CGTGCCCATCACCACCTGGAGGG + Intronic
1076821642 10:132942674-132942696 CCTGCCCCCCGCCAGCTCCGCGG + Intronic
1076992083 11:280627-280649 CGCGCCGCTCGCCGCCTCGAAGG - Exonic
1077875174 11:6298723-6298745 CGTGCTCCCTGCCACCTGGGCGG - Intergenic
1081863538 11:46347557-46347579 CGCGCCGCCCGCCACCTCCATGG - Intronic
1082957496 11:58885796-58885818 GGTGACCCCTGCCACCTCAAAGG - Intronic
1082973088 11:59043861-59043883 GGTGACCCCTGCCACCTCAAAGG - Intergenic
1082977483 11:59087426-59087448 GGTGACCCCTGCCACCTCAAAGG - Intergenic
1083202501 11:61129120-61129142 CGTGCCCCCTGCCACCACTCTGG + Intergenic
1083261586 11:61525970-61525992 TGTGCCCCCCGGCACCTCCTGGG - Intronic
1102136899 12:110583045-110583067 CCGGCCCCCCGCCTCCTCGGGGG - Exonic
1105885588 13:24638406-24638428 TGTGCCCCCCGCGCCCCCGAAGG - Intergenic
1120190453 14:81435869-81435891 CCTGCCTCCCGACACCCCGAAGG + Intronic
1122581865 14:102776633-102776655 CGTGCCCCCAGCGTCCTCGGCGG - Intergenic
1122629822 14:103102517-103102539 CGCGCCCTCCGCCTCCCCGAAGG - Exonic
1122905552 14:104800153-104800175 CTGGCCTCCCGCCACCTCGCAGG - Intergenic
1124248834 15:28094706-28094728 CGGGCCCACCCCCACCTCGCAGG - Intronic
1128212406 15:65911983-65912005 CACGCCCCCCGCCACATGGAGGG - Intronic
1128727677 15:69999872-69999894 TGTGCCCCTCCCCACCACGATGG - Intergenic
1129037570 15:72660005-72660027 CGTGCTGCCCGACACTTCGAAGG + Exonic
1129212317 15:74077220-74077242 CGTGCTGCCCGACACTTCGAAGG - Exonic
1129398080 15:75263859-75263881 CGTGCTGCCCGACACTTCGAAGG + Exonic
1129401691 15:75288140-75288162 CGTGCTGCCCGACACTTCGAAGG + Exonic
1129475282 15:75780847-75780869 CGTGCTGCCCGACACTTCGAAGG + Intergenic
1129729447 15:77921538-77921560 CGTGCTGCCCGACACTTCGAAGG - Intergenic
1129839071 15:78732432-78732454 CGTGCTGCCCGACACTTCGAAGG + Intergenic
1129880224 15:79001482-79001504 CCCGCCCCCCGCCACCCCAAGGG - Intronic
1136559888 16:31033130-31033152 CGCGCCCCTCCCCACCTCGCGGG + Intronic
1142126530 16:88413363-88413385 CGTTCCTCCTGCCACCTCCAGGG - Intergenic
1147900130 17:43778563-43778585 CGTGCACCCCGCCACGGGGAAGG + Intronic
1148818188 17:50345834-50345856 TGTGCTCCCCTCCACCTGGACGG - Intergenic
1152033891 17:77859898-77859920 CGCCCCCCCCGCCACCTCAATGG - Intergenic
1152132643 17:78486292-78486314 CGTGCCCCCCGACTCCCCCAGGG - Exonic
1152811534 17:82384980-82385002 CGTGCACCACGCCACCTCCCGGG - Intergenic
1153772287 18:8425780-8425802 GGAGCCCCCGGCCACCTGGAGGG + Intergenic
1157099862 18:44719624-44719646 TGTGCCCCACTCCACCTCCAGGG + Intronic
1160625474 18:80201436-80201458 CTTGCCCCCAGCAACCCCGAAGG + Intronic
1161741921 19:6026612-6026634 CTTTCCCCACGCCACATCGATGG + Intronic
1162238169 19:9324446-9324468 CGTGCCCCCCGCCTCCTCCCGGG - Intronic
1162320089 19:9966505-9966527 CGGTCCCCCCGCCACTTGGATGG - Intronic
1163559096 19:18008620-18008642 TGTGCCTCCCACCACCTGGACGG + Intronic
1165832845 19:38737661-38737683 CCTGCCCGGCCCCACCTCGAGGG + Intronic
1167578472 19:50328903-50328925 CGGGCCCCCCGGCACCCCGCGGG - Exonic
1168238947 19:55079844-55079866 CGTGCCCCCCGGCACCTTGGAGG - Exonic
1168315526 19:55483259-55483281 CGTGCCCCCCGCCACCTCGAGGG - Exonic
1168320160 19:55504198-55504220 CGTGCCCGCCTCCACCACGAGGG - Intronic
1168694337 19:58396254-58396276 CCTGCCCCCCGCCTCCCCGGTGG + Exonic
927809379 2:26173133-26173155 CGCGCCCGCCGCCACCTCCCGGG - Exonic
927927614 2:27024673-27024695 CTTGCCCCCTGCCCCCTGGATGG + Intronic
930798504 2:55419199-55419221 AGTGCCCCCCTCCTCCACGATGG - Exonic
932699672 2:73984585-73984607 CGTGCCCCACCCCGCCTCGCCGG + Intergenic
1169142495 20:3234259-3234281 CGTGCGCACCGCGACCTAGATGG - Exonic
1170608901 20:17895495-17895517 CCTGCCCACCCCCACCTGGAAGG + Intergenic
1173752053 20:45484892-45484914 CGTGCTCTCAGCCACCTGGAAGG - Intergenic
1176016764 20:62937983-62938005 CGTCCGCCCCGCCCCCTCGCGGG + Intergenic
1176267353 20:64217124-64217146 CGTGGCCCCCGCCACACCCAGGG + Exonic
1179914059 21:44464911-44464933 GGTGCCCCCCTCCACCTCCAAGG - Intergenic
1181297009 22:21847810-21847832 GGTGCCCCCCACCTCCTGGACGG - Intronic
1184342109 22:43891759-43891781 CGAGCCCCGCGCCTCCTCCAGGG - Exonic
1184372172 22:44089602-44089624 CGACCCCCCCGCCACCTGAACGG - Intronic
1185282866 22:49983174-49983196 GGTGACCCTCGCCACCTGGATGG - Intergenic
952706185 3:36380392-36380414 CGCGCCCGCGGCCACCTCGCCGG - Exonic
953907008 3:46873488-46873510 CTTGCCCCCCTCCACCCCCAAGG + Intronic
961123914 3:124398864-124398886 CTGGCCCCCTGCTACCTCGATGG - Exonic
978765736 4:112403195-112403217 AGTGCCCCCCGCCCCCTCCCCGG + Intronic
980883719 4:138739541-138739563 GGTGCCCCCCACCTCCTTGATGG - Intergenic
985535671 5:464616-464638 CATGGCTCCCTCCACCTCGAGGG - Intronic
985617479 5:932373-932395 CGGGCTCCCAGCCACCTGGAAGG + Intergenic
992195007 5:74330525-74330547 CCTGCCCCACGCCACCCCAAGGG + Intergenic
997297452 5:132777028-132777050 CGCGCCCCCCGCCAGCTGCAGGG + Intronic
1001477522 5:172061124-172061146 CTTGCACACCCCCACCTCGAAGG + Exonic
1002140354 5:177133930-177133952 CGTGCCCCGCGCCCCCTCCCGGG - Exonic
1002350182 5:178577608-178577630 CCTGCCCCCCGCTGCCTGGATGG + Intronic
1005824690 6:29625704-29625726 TCTGCTCCCCGCCACCTCCAGGG + Intronic
1005860306 6:29895755-29895777 GGTGCCCCCCACCTCCTGGACGG + Intergenic
1007665475 6:43510580-43510602 CGTGCCCAACGCCATCTCCACGG - Exonic
1012475905 6:99614281-99614303 GGTGCCTCCCGCCGCCGCGACGG - Exonic
1015644211 6:135368498-135368520 GGTGCCCCCCACCACCACCATGG - Intronic
1016840415 6:148519539-148519561 CGTGCTCCTCCCCACCTGGAGGG - Exonic
1017712426 6:157182514-157182536 AGTGACCCCCGCCACCTTGGTGG - Intronic
1018191743 6:161315029-161315051 CGTGCGCCCCGCCGCCTTGTGGG - Intergenic
1019347797 7:539182-539204 GGAGCCCCCCGCCAGCTGGAAGG - Intergenic
1019461400 7:1160723-1160745 GCTGCCCCCCGCCCCCTGGACGG + Intronic
1019622117 7:1997700-1997722 CCTGCCCCCCGCCACCGCACTGG - Intronic
1020614526 7:10441824-10441846 TGTGCTCCCTGCCACCTAGAAGG + Intergenic
1034435203 7:151059998-151060020 CGCGCCCCCTGCCACCAGGAGGG + Intronic
1038425707 8:27462634-27462656 CCTGCCTGCCGCCACCTCCAAGG + Intronic
1039391012 8:37180768-37180790 CCTGCTCCCCTCCACCTTGACGG - Intergenic
1041522729 8:58772831-58772853 CGTGCCTCCTGCCACCTCCCAGG - Intergenic
1049406328 8:142453213-142453235 CGTGCCCCCAGCCTCCCGGACGG - Intronic
1049425489 8:142536205-142536227 CATGCCCCCCACCACCCCCAAGG + Intronic
1049466154 8:142752149-142752171 TGGGCCCCCGCCCACCTCGAAGG + Intronic
1049581264 8:143412144-143412166 TGTGCCCCCCCCAACCACGATGG + Intergenic
1060702409 9:125768120-125768142 CTTGCCCCCCACCACCCCCAAGG - Intronic
1060800849 9:126545185-126545207 AGTGCCCACGGCCACCTCCAGGG - Intergenic
1185880412 X:3735208-3735230 CGTGCCCTCAGCCATCTCCATGG - Intergenic